cse180

#matches whether or not two strings are off by d mismatch

def isMatch(string1, string2, num_wrong):
    mismatch = 0
    for i in range(len(string1)):
        if string1[i] != string2[i]:
            mismatch += 1

    if mismatch <= num_wrong:
        return "true"
    else:
        return "false"

print(isMatch("aaabaaa", "aabaaaa", 2))



sequenced = {}
sequence = "ACGTTGCATGTCGCATGATGCATGAGAGCT"
k = 4
num_wrong = 1

#put all of the kmers in sequence into dictionary sequenced
for i in range(len(sequence) - k + 1):
    sequenced[sequence[i:i+k]] = 0



final_output = []
temp_output = []
max_matches = 0

#going through dictionary and compare to other sequences to see if they're similar
for currKey in sequenced:
    for compKey in sequenced:
        if isMatch(currKey, compKey, num_wrong) == "true":
            sequenced[currKey] += 1
            temp_output.append(compKey)

    if sequenced[currKey] > max_matches:
         max_matches = sequenced[currKey]
         final_output = temp_output
    temp_output = []

print(*final_output)






"""for loop that iterates through all keys in the dict: currKey
    for loop that iterates through all keys in the dict: #keythatImcomparingto
        # match the current k-mer up with all of the other keys in the dict using isMatch
        if isMatch(iejfoaijweofia) is true:
            ++value of currKey in the dict, dict[currKey] = dict[currKey] + 1
            temp_output.append(keythatImcomparingto) # an array of all stuff that matches

    if dict[currKey] > max_matches
        max_matches = value
        final_output = temp_output
    temp_output = []

print final_output
"""