Guest User

Mojiang ORF8 Sequences

a guest
May 15th, 2021
294
Never
Not a member of Pastebin yet? Sign Up, it unlocks many cool features!
  1. ORF8 Gene:
  2. RaTG\Ra499, MN996532.2 at nt 27875-28241
  3. Wuhan-Hu-1, MN908947.3 at nt 27894-28259
  4.  
  5.  
  6. Fu's alignment:
  7.  
  8. SARS2 atgaaatttcttgttttcttaggaatcatcacaactgtagctgcatttcaccaagaatgtagtttacagtcatgtactcaacatcaaccatatgta
  9. Ra4991 atgaaacttcttgttttcttaggaatcctcacaacagtaactgcatttcaccaagaatgtagtttacagtcatgtgctcaacaccaaccatatgta
  10. Ra7896 atgaaacttcttgtttttctagtcacactgagtgttgcatac......cctaaagaatgctccattcgagaatgttctctaaaccaactctacatg
  11. Ra7909 atgaaacttcttgtttttctagtcacactgagtgttgcatac......cctaaagaatgctccattcgagaatgttttctaaaccaactctacatg
  12. Ra7952 atgaaacttcttgtttttctagtcacactgagtgttgcatac......cctaaagaatgctccattcgagaatgttctctaaaccaactctacatg
  13. ****** ********** *** ** * * * * ******* * * **** * * * **** **
  14. SARS2 gttgatgacccgtgtcctattcacttctattctaaatggtatattagagtaggagctagaaaatcagcacctttaattgaattgtgcgtggatgag
  15. Ra4991 gttgatgacccgtgtcctattcacttctattctaaatggtacattagagtaggagctagaaaatcagcacctttaattgaattgtgcgtggatgag
  16. Ra7896 cccgaggacttatgtcctatgcatt..tattctgattggtttattaaaatcggtaacagacgacaaggcaagctaatacccctctgtcaaggtgac
  17. Ra7909 cccgaggacttatgtcctatgcatt..tattctgattggtttattaaaatcggtaacagacgacaaggcaagctaatacccctctgtcaaggtgac
  18. Ra7952 cccgaggacttatgtcctatgcatt..tattctgattggtttattaaaatcggtaacagacgacaaggcaagctaatacccctctgtctaggtgac
  19. ** *** ******** ** * ****** * **** **** * * ** *** * ** **** ** * ***
  20. SARS2 g...ctggttctaaatcacccattcagtacatcgatatcggtaattatacagtttcctgtttaccttttacaattaattgccaggaacctaaattg
  21. Ra4991 g...ttggttctaaatcacccattcagtacatcgatatcggcaattatacagtttcctgttcaccttttacaattaattgccaggagcctaaattg
  22. Ra7896 aaccctgacagacgcgaggtgataaattatgccatgtttgccaattttacccagtcttgctcgccttttacgaccagctgtcaacctgtaccatta
  23. Ra7909 aaccctgacagacgcgaggtgataaattatgccatgtttgccaattttacccagtcttgctcgccttttacgaccagctgtcaacctgtaccatta
  24. Ra7952 aaccctgacagacgcgaggtgataaattatgccatgtttgccaattttacccagtcttgctcgccttttacgaccagctgtcaacctgtaccatta
  25. ** ** ** * * * **** ** ** ** * ******** * ** ** ***
  26. SARS2 ggtagtcttgtagtgcgttgttcgttc.........tatgaagactttttagagtatcatgacgttcgtgttgttttagatttc......atctaa
  27. Ra4991 ggtagtcttgtagtgcgttgttcgttc.........tatgaagactttttagagtatcatgacgttcgtgttgttttagatttc......atctaa
  28. Ra7896 ggtcagttgatatttcgttgctcgtac.........tatgctgattttattgactttcatgacattcgtagtgattgatgttct........ctaa
  29. Ra7909 ggtcagttgatattttgttgctcgtac.........tatgctgattttattgactttcatgacattcgtagtgattgatgttct........ctaa
  30. Ra7952 ggtcagttgatatttcgttgctcgtac.........tatgctgattttattgactttcatgacattcgtagtgattgatgttct........ctaa
  31. *** * ** * **** **** * **** ** *** * ** * ******* ***** ** ** * ** ****
  32.  
  33. Clustal W Input:
  34.  
  35. >Wuhan-Hu-1
  36. atgaaatttcttgttttcttaggaatcatcacaactgtagctgcatttcaccaagaatgtagtttacagtcatgtactcaacatcaaccatatgtagttgatgacccgtgtcctattcacttctattctaaatggtatattagagtaggagctagaaaatcagcacctttaattgaattgtgcgtggatgaggctggttctaaatcacccattcagtacatcgatatcggtaattatacagtttcctgtttaccttttacaattaattgccaggaacctaaattgggtagtcttgtagtgcgttgttcgttctatgaagactttttagagtatcatgacgttcgtgttgttttagatttcatctaa
  37. >Ra4991
  38. atgaaacttcttgttttcttaggaatcctcacaacagtaactgcatttcaccaagaatgtagtttacagtcatgtgctcaacaccaaccatatgtagttgatgacccgtgtcctattcacttctattctaaatggtacattagagtaggagctagaaaatcagcacctttaattgaattgtgcgtggatgaggttggttctaaatcacccattcagtacatcgatatcggcaattatacagtttcctgttcaccttttacaattaattgccaggagcctaaattgggtagtcttgtagtgcgttgttcgttctatgaagactttttagagtatcatgacgttcgtgttgttttagatttcatctaa
  39. >Ra7896
  40. atgaaacttcttgtttttctagtcacactgagtgttgcataccctaaagaatgctccattcgagaatgttctctaaaccaactctacatgcccgaggacttatgtcctatgcatttattctgattggtttattaaaatcggtaacagacgacaaggcaagctaatacccctctgtcaaggtgacaaccctgacagacgcgaggtgataaattatgccatgtttgccaattttacccagtcttgctcgccttttacgaccagctgtcaacctgtaccattaggtcagttgatatttcgttgctcgtactatgctgattttattgactttcatgacattcgtagtgattgatgttctctaa
  41. >Ra7909
  42. atgaaacttcttgtttttctagtcacactgagtgttgcataccctaaagaatgctccattcgagaatgttttctaaaccaactctacatgcccgaggacttatgtcctatgcatttattctgattggtttattaaaatcggtaacagacgacaaggcaagctaatacccctctgtcaaggtgacaaccctgacagacgcgaggtgataaattatgccatgtttgccaattttacccagtcttgctcgccttttacgaccagctgtcaacctgtaccattaggtcagttgatattttgttgctcgtactatgctgattttattgactttcatgacattcgtagtgattgatgttctctaa
  43. >Ra7952
  44. atgaaacttcttgtttttctagtcacactgagtgttgcataccctaaagaatgctccattcgagaatgttctctaaaccaactctacatgcccgaggacttatgtcctatgcatttattctgattggtttattaaaatcggtaacagacgacaaggcaagctaatacccctctgtctaggtgacaaccctgacagacgcgaggtgataaattatgccatgtttgccaattttacccagtcttgctcgccttttacgaccagctgtcaacctgtaccattaggtcagttgatatttcgttgctcgtactatgctgattttattgactttcatgacattcgtagtgattgatgttctctaa
  45.  
RAW Paste Data