SHARE
TWEET

FIMO CRP-S results KW20

a guest May 27th, 2015 240 Never
Not a member of Pastebin yet? Sign Up, it unlocks many cool features!
  1. #pattern name   sequence name   start   stop    strand  score   p-value q-value matched sequence
  2. 1       gi|6626252|gb|L42023.1| 1184729 1184750 +       37.8229 2.07e-13        3.78e-07        TTTTGCGATCTAGATCGCAAAA
  3. 1       gi|6626252|gb|L42023.1| 1184729 1184750 -       37.8229 2.07e-13        3.78e-07        TTTTGCGATCTAGATCGCAAAA
  4. 1       gi|6626252|gb|L42023.1| 1042868 1042889 -       36.4583 4.14e-13        5.04e-07        TTTTGCGATCTGCATCGCAAAA
  5. 1       gi|6626252|gb|L42023.1| 1072997 1073018 +       35.7396 1.21e-12        1.11e-06        TTTTGCGATCGAGATCGCAAAA
  6. 1       gi|6626252|gb|L42023.1| 388589  388610  -       35.5104 1.76e-12        1.28e-06        TTTTGCGATCTAGATCGCAAAT
  7. 1       gi|6626252|gb|L42023.1| 334176  334197  -       34.625  4.21e-12        2.56e-06        TTTTGCGATCAGGATCGCAGAA
  8. 1       gi|6626252|gb|L42023.1| 388589  388610  +       34.3958 5.17e-12        2.7e-06 ATTTGCGATCTAGATCGCAAAA
  9. 1       gi|6626252|gb|L42023.1| 65637   65658   -       32.8125 1.85e-11        8.43e-06        TTTTACGATATGGATCGCAAAA
  10. 1       gi|6626252|gb|L42023.1| 1248806 1248827 +       32.1458 3.06e-11        1.16e-05        TTTTGCGATTTAGATCGAAAAA
  11. 1       gi|6626252|gb|L42023.1| 460638  460659  -       31.9583 3.49e-11        1.16e-05        TTTTGCGATCCGCATCGTAAAA
  12. 1       gi|6626252|gb|L42023.1| 703482  703503  -       31.9583 3.49e-11        1.16e-05        TTTTGCGATCTAGATCGAAAGA
  13. 1       gi|6626252|gb|L42023.1| 1072997 1073018 -       30      1.21e-10        3.68e-05        TTTTGCGATCTCGATCGCAAAA
  14. 1       gi|6626252|gb|L42023.1| 65637   65658   +       29.4896 1.61e-10        4.52e-05        TTTTGCGATCCATATCGTAAAA
  15. 1       gi|6626252|gb|L42023.1| 1042868 1042889 +       28.5938 2.7e-10 7.04e-05        TTTTGCGATGCAGATCGCAAAA
  16. 1       gi|6626252|gb|L42023.1| 1693792 1693813 -       28.4583 2.91e-10        7.09e-05        TTTTGCGATTCAGATCCCAAAC
  17. 1       gi|6626252|gb|L42023.1| 1012042 1012063 -       27.2917 5.16e-10        0.000118        TTTTACGATATGCATCGCAGAT
  18. 1       gi|6626252|gb|L42023.1| 334176  334197  +       25.8125 1.06e-09        0.000227        TTCTGCGATCCTGATCGCAAAA
  19. 1       gi|6626252|gb|L42023.1| 460638  460659  +       25.6771 1.13e-09        0.000228        TTTTACGATGCGGATCGCAAAA
  20. 1       gi|6626252|gb|L42023.1| 282303  282324  +       23.8229 2.59e-09        0.000498        TTTTGCGATCATTATCGCATAT
  21. 1       gi|6626252|gb|L42023.1| 703482  703503  +       19.9375 1.39e-08        0.00253 TCTTTCGATCTAGATCGCAAAA
  22. 1       gi|6626252|gb|L42023.1| 1248806 1248827 -       19.7708 1.49e-08        0.00259 TTTTTCGATCTAAATCGCAAAA
  23. 1       gi|6626252|gb|L42023.1| 282303  282324  -       19.0208 2.01e-08        0.00334 ATATGCGATAATGATCGCAAAA
  24. 1       gi|6626252|gb|L42023.1| 517929  517950  +       16.9062 4.54e-08        0.0072  TTTTGTGATCAATATCCCAAAT
  25. 1       gi|6626252|gb|L42023.1| 897196  897217  +       15.1042 8.71e-08        0.0132  TACTGCGATTTAGATCGCAAAC
  26. 1       gi|6626252|gb|L42023.1| 1429214 1429235 +       13.9896 1.29e-07        0.0189  TTGTGCGATCCAGATAGCAAGT
  27. 1       gi|6626252|gb|L42023.1| 1515489 1515510 -       13.5938 1.49e-07        0.0209  ATTTGTGATCGAGATCACAAAA
  28. 1       gi|6626252|gb|L42023.1| 1693792 1693813 +       11.2604 3.3e-07 0.0446  GTTTGGGATCTGAATCGCAAAA
  29. 1       gi|6626252|gb|L42023.1| 622753  622774  +       11.1458 3.43e-07        0.0447  ATTTACGATCTGGCTCACAAAT
  30. 1       gi|6626252|gb|L42023.1| 517929  517950  -       10.8125 3.84e-07        0.048   ATTTGGGATATTGATCACAAAA
  31. 1       gi|6626252|gb|L42023.1| 1245093 1245114 -       10.7292 3.95e-07        0.048   TTTTGTGATCTTGATCACATAT
  32. 1       gi|6626252|gb|L42023.1| 1520424 1520445 -       10.5729 4.16e-07        0.049   TTTTGCGTTAAGTGTCGCAAAT
  33. 1       gi|6626252|gb|L42023.1| 897196  897217  -       10.2292 4.66e-07        0.0518  GTTTGCGATCTAAATCGCAGTA
  34. 1       gi|6626252|gb|L42023.1| 158961  158982  +       10.2188 4.68e-07        0.0518  TTTTGCGATTTTGATGGTATGC
  35. 1       gi|6626252|gb|L42023.1| 637130  637151  -       9.54167 5.83e-07        0.0625  ATTTACGATTTTGATTCCATAA
  36. 1       gi|6626252|gb|L42023.1| 622753  622774  -       9.44792 6e-07   0.0626  ATTTGTGAGCCAGATCGTAAAT
  37. 1       gi|6626252|gb|L42023.1| 1489268 1489289 +       9.3125  6.27e-07        0.0635  TTTTACGAAGTGCATCGTAAAC
  38. 1       gi|6626252|gb|L42023.1| 1515489 1515510 +       8.96875 6.99e-07        0.069   TTTTGTGATCTCGATCACAAAT
  39. 1       gi|6626252|gb|L42023.1| 1012042 1012063 +       8.63542 7.79e-07        0.0748  ATCTGCGATGCATATCGTAAAA
  40. 1       gi|6626252|gb|L42023.1| 54775   54796   -       8.51042 8.1e-07 0.0758  TTTTGTGATATGGCTCACAAAA
  41. 1       gi|6626252|gb|L42023.1| 1429214 1429235 -       8.13542 9.13e-07        0.0826  ACTTGCTATCTGGATCGCACAA
  42. 1       gi|6626252|gb|L42023.1| 1273842 1273863 -       8.08333 9.29e-07        0.0826  TTTTACGAACAGCATAGAAAAT
  43. 1       gi|6626252|gb|L42023.1| 1520424 1520445 +       7.73958 1.03e-06        0.0899  ATTTGCGACACTTAACGCAAAA
  44. 1       gi|6626252|gb|L42023.1| 1097167 1097188 +       6.65625 1.44e-06        0.122   TTTTGTGATCTAGATCCTATTT
  45. 1       gi|6626252|gb|L42023.1| 1074349 1074370 +       6.44792 1.53e-06        0.127   TTCTGTGATCTAGATCTCAGAT
  46. 1       gi|6626252|gb|L42023.1| 54775   54796   +       6.03125 1.74e-06        0.141   TTTTGTGAGCCATATCACAAAA
  47. 1       gi|6626252|gb|L42023.1| 885812  885833  +       5.80208 1.86e-06        0.147   TTTTGTGATCTACCTCAAAAAA
  48. 1       gi|6626252|gb|L42023.1| 205797  205818  -       5.73958 1.89e-06        0.147   TTTTATGATATAGTTCGCCAAA
  49. 1       gi|6626252|gb|L42023.1| 729887  729908  +       5.63542 1.96e-06        0.149   TTTTGTGATATTGATCACAATA
  50. 1       gi|6626252|gb|L42023.1| 1074349 1074370 -       5.33333 2.14e-06        0.156   ATCTGAGATCTAGATCACAGAA
  51. 1       gi|6626252|gb|L42023.1| 688201  688222  +       5.33333 2.14e-06        0.156   TTTTGCGACATTCACCGCAACA
  52. 1       gi|6626252|gb|L42023.1| 1245093 1245114 +       5.16667 2.25e-06        0.161   ATATGTGATCAAGATCACAAAA
  53. 1       gi|6626252|gb|L42023.1| 1288411 1288432 +       5.09375 2.3e-06 0.161   TATTGCGATTAGCAGCCCATAC
  54. 1       gi|6626252|gb|L42023.1| 1452969 1452990 -       4.91667 2.42e-06        0.167   TTTTACGATGGGCATCGATTAC
  55. 1       gi|6626252|gb|L42023.1| 729887  729908  -       4.76042 2.54e-06        0.171   TATTGTGATCAATATCACAAAA
  56. 1       gi|6626252|gb|L42023.1| 1127379 1127400 -       4.69792 2.58e-06        0.171   TTTAGCTATAAATATCGTATAA
  57. 1       gi|6626252|gb|L42023.1| 537974  537995  -       4.39583 2.82e-06        0.184   CTTTACGAAATTTATCGTATGA
  58. 1       gi|6626252|gb|L42023.1| 1494419 1494440 -       4.3125  2.89e-06        0.185   TTTTGTGACATAGATCATAAAA
  59. 1       gi|6626252|gb|L42023.1| 230232  230253  +       4.16667 3.02e-06        0.187   TTTTACGTTAGAAATCCCAAGT
  60. 1       gi|6626252|gb|L42023.1| 809675  809696  -       4.10417 3.07e-06        0.187   TTTTGCCTTATACATCTCAAAC
  61. 1       gi|6626252|gb|L42023.1| 5443    5464    -       4.09375 3.08e-06        0.187   TATTGTGATCTAGATCATAAAT
  62. 1       gi|6626252|gb|L42023.1| 5443    5464    +       3.9375  3.22e-06        0.189   ATTTATGATCTAGATCACAATA
  63. 1       gi|6626252|gb|L42023.1| 1199097 1199118 -       3.875   3.28e-06        0.189   GTTTACGATTTGCATTCAAAAT
  64. 1       gi|6626252|gb|L42023.1| 1545364 1545385 -       3.83333 3.32e-06        0.189   TTTTGCATTCAAAATCGCAAGT
  65. 1       gi|6626252|gb|L42023.1| 1416225 1416246 +       3.83333 3.32e-06        0.189   TTTTGCATTCAAAATCGCAAGT
  66. 1       gi|6626252|gb|L42023.1| 1024095 1024116 -       3.57292 3.58e-06        0.199   ATTTGCTAATCGTATCCCAAAT
  67. 1       gi|6626252|gb|L42023.1| 1193855 1193876 -       3.55208 3.6e-06 0.199   CTTTGCAATTTTTATCGCAGTC
  68. 1       gi|6626252|gb|L42023.1| 1224446 1224467 -       3.48958 3.67e-06        0.2     TTTAGCGATACACTTCGTCAAA
  69. 1       gi|6626252|gb|L42023.1| 1494419 1494440 +       3.41667 3.74e-06        0.201   TTTTATGATCTATGTCACAAAA
  70. 1       gi|6626252|gb|L42023.1| 205797  205818  +       3.27083 3.9e-06 0.205   TTTGGCGAACTATATCATAAAA
  71. 1       gi|6626252|gb|L42023.1| 1137047 1137068 -       3.23958 3.94e-06        0.205   ATTGGCGACCAACGTCGCAGAA
  72. 1       gi|6626252|gb|L42023.1| 690730  690751  +       2.98958 4.23e-06        0.209   CTTTACGTTCAATATCTAAAAT
  73. 1       gi|6626252|gb|L42023.1| 411611  411632  -       2.95833 4.27e-06        0.209   TTTTACGATCTACAATGCGTAA
  74. 1       gi|6626252|gb|L42023.1| 1143195 1143216 +       2.92708 4.3e-06 0.209   ATTTGCCGTTCAGATCGTATGA
  75. 1       gi|6626252|gb|L42023.1| 946962  946983  -       2.83333 4.42e-06        0.209   TTTGTCGATACTGTTCGAAAAA
  76. 1       gi|6626252|gb|L42023.1| 946962  946983  +       2.8125  4.45e-06        0.209   TTTTTCGAACAGTATCGACAAA
  77. 1       gi|6626252|gb|L42023.1| 80320   80341   +       2.78125 4.49e-06        0.209   CATTGTGATATTGATCACAAAA
  78. 1       gi|6626252|gb|L42023.1| 368225  368246  -       2.77083 4.5e-06 0.209   TTTTACGTTTTTGATCGGCAAA
  79. 1       gi|6626252|gb|L42023.1| 873400  873421  +       2.77083 4.5e-06 0.209   ATTTGTGACATGGATCACAAAT
  80. 1       gi|6626252|gb|L42023.1| 1489268 1489289 -       2.69792 4.59e-06        0.209   GTTTACGATGCACTTCGTAAAA
  81. 1       gi|6626252|gb|L42023.1| 1610822 1610843 -       2.69792 4.59e-06        0.209   TTGTGCGTTTTAGAACGAATAA
  82. 1       gi|6626252|gb|L42023.1| 1288549 1288570 +       2.66667 4.64e-06        0.209   TTTTACGAATATCATCCCAATT
  83. 1       gi|6626252|gb|L42023.1| 1416225 1416246 -       2.09375 5.46e-06        0.24    ACTTGCGATTTTGAATGCAAAA
  84. 1       gi|6626252|gb|L42023.1| 1545364 1545385 +       2.09375 5.46e-06        0.24    ACTTGCGATTTTGAATGCAAAA
  85. 1       gi|6626252|gb|L42023.1| 803148  803169  +       2.01042 5.59e-06        0.24    TTATGTGATCGAGATCATAAAT
  86. 1       gi|6626252|gb|L42023.1| 1714476 1714497 +       2.01042 5.59e-06        0.24    TTTTGCGGTAAACATCAGATAA
  87. 1       gi|6626252|gb|L42023.1| 655947  655968  +       1.88542 5.79e-06        0.246   TTTTTCGATATTCAACGAAACA
  88. 1       gi|6626252|gb|L42023.1| 249118  249139  -       1.61458 6.26e-06        0.263   TTGTGCTAAAGAGATCGCAAGT
  89. 1       gi|6626252|gb|L42023.1| 252399  252420  -       1.55208 6.37e-06        0.264   TTCTTCGATAAAGATCGCATCC
  90. 1       gi|6626252|gb|L42023.1| 803148  803169  -       1.42708 6.6e-06 0.271   ATTTATGATCTCGATCACATAA
  91. 1       gi|6626252|gb|L42023.1| 234978  234999  +       1.38542 6.68e-06        0.271   TTACGCAATACGCATCGCATAT
  92. 1       gi|6626252|gb|L42023.1| 1685200 1685221 -       1.32292 6.8e-06 0.272   CTTTGCGTTCAGCATCATAATA
  93. 1       gi|6626252|gb|L42023.1| 525117  525138  -       1.17708 7.07e-06        0.28    CTTTGCGATCTTTATGCAGAAC
  94. 1       gi|6626252|gb|L42023.1| 1609089 1609110 -       1.09375 7.24e-06        0.28    ATTGGCGAAACTCATCGAATAC
  95. 1       gi|6626252|gb|L42023.1| 1536667 1536688 -       1.07292 7.28e-06        0.28    TTCTCGGATATTCATCGAAAAA
  96. 1       gi|6626252|gb|L42023.1| 1327465 1327486 -       1.0625  7.3e-06 0.28    TATTACGATGTACATCTAAAAT
  97. 1       gi|6626252|gb|L42023.1| 1408540 1408561 +       0.927083        7.58e-06        0.288   TTGTGAGATCAGGATCGCCTGT
  98. 1       gi|6626252|gb|L42023.1| 1390678 1390699 +       0.71875 8.02e-06        0.299   TTTTGATATTGAAATCGAAGAA
  99. 1       gi|6626252|gb|L42023.1| 1710428 1710449 +       0.71875 8.02e-06        0.299   TTTTGTGATAAAGATCTCATTC
  100. 1       gi|6626252|gb|L42023.1| 252399  252420  +       0.677083        8.12e-06        0.299   GGATGCGATCTTTATCGAAGAA
  101. 1       gi|6626252|gb|L42023.1| 549612  549633  +       0.645833        8.19e-06        0.299   TGTAACGATTTAGATCAAAGAA
  102. 1       gi|6626252|gb|L42023.1| 603192  603213  -       0.5625  8.38e-06        0.301   TGTTTCCATAAGGATCGAATAA
  103. 1       gi|6626252|gb|L42023.1| 550087  550108  -       0.541667        8.42e-06        0.301   TTTTGTGATATTCAGCGTGAAA
  104. 1       gi|6626252|gb|L42023.1| 689828  689849  -       0.427083        8.69e-06        0.303   TATGGCGAAAATCATCGAAAAA
  105. 1       gi|6626252|gb|L42023.1| 1351985 1352006 -       0.427083        8.69e-06        0.303   TTTTGTGATTATGGTGGCAAAC
  106. 1       gi|6626252|gb|L42023.1| 1506801 1506822 +       0.395833        8.77e-06        0.303   TTTTGGGTTCTATATCCCATTA
  107. 1       gi|6626252|gb|L42023.1| 1829995 1830016 -       0.375   8.81e-06        0.303   TTTTGTGATCTATATCAAATCA
  108. 1       gi|6626252|gb|L42023.1| 873400  873421  -       0.291667        9.02e-06        0.308   ATTTGTGATCCATGTCACAAAT
  109. 1       gi|6626252|gb|L42023.1| 154978  154999  -       0.197917        9.25e-06        0.312   GTTTATGATCTACACCGAATAA
  110. 1       gi|6626252|gb|L42023.1| 1536667 1536688 +       0.104167        9.49e-06        0.312   TTTTTCGATGAATATCCGAGAA
  111. 1       gi|6626252|gb|L42023.1| 824657  824678  +       0.09375 9.52e-06        0.312   ATATGCGATTAGCTACGCAAAT
  112. 1       gi|6626252|gb|L42023.1| 1306637 1306658 +       0.09375 9.52e-06        0.312   TTTTGAGATAAAGATAGTGAAT
  113. 1       gi|6626252|gb|L42023.1| 181487  181508  -       0.0520833       9.63e-06        0.312   TTTTGCAACAATGATACCAAAA
  114. 1       gi|6626252|gb|L42023.1| 620670  620691  -       0.0416667       9.66e-06        0.312   ATTAGCGATTAAAGTCCCAAAA
  115. 1       gi|6626252|gb|L42023.1| 957686  957707  -       -0.0416667      9.88e-06        0.316   CTTGACGAACAGGATACCAAAA
  116. 1       gi|6626252|gb|L42023.1| 303062  303083  -       -0.145833       1.02e-05        0.321   CTCTGCGGTCAGCATCGGATAT
  117. 1       gi|6626252|gb|L42023.1| 1412680 1412701 -       -0.197917       1.03e-05        0.321   TATAGCGAAATACATCCAAGAA
  118. 1       gi|6626252|gb|L42023.1| 1548909 1548930 +       -0.197917       1.03e-05        0.321   TATAGCGAAATACATCCAAGAA
  119. 1       gi|6626252|gb|L42023.1| 1654467 1654488 +       -0.260417       1.05e-05        0.324   CTTTGCCATCCGCAGCCAATGC
  120. 1       gi|6626252|gb|L42023.1| 1276025 1276046 +       -0.322917       1.07e-05        0.326   TATTACGATTAACATCGCATTG
  121. 1       gi|6626252|gb|L42023.1| 87042   87063   +       -0.34375        1.07e-05        0.326   TAGAGCGATCATCATCGAAAGA
  122. 1       gi|6626252|gb|L42023.1| 132132  132153  +       -0.385417       1.08e-05        0.327   TTTTACGATAATTATGAAAAGA
  123. 1       gi|6626252|gb|L42023.1| 4863    4884    -       -0.5    1.12e-05        0.329   TTTTTCGATTTATATGGAAGTA
  124. 1       gi|6626252|gb|L42023.1| 777974  777995  +       -0.5    1.12e-05        0.329   TTTAACGATTTTGTTCAAAAAA
  125. 1       gi|6626252|gb|L42023.1| 450090  450111  -       -0.53125        1.13e-05        0.329   CTTTGTGATACACACCATAAAA
  126. 1       gi|6626252|gb|L42023.1| 1823596 1823617 +       -0.53125        1.13e-05        0.329   TTTTGAGAACTAGATCACAATT
  127. 1       gi|6626252|gb|L42023.1| 82185   82206   -       -0.770833       1.2e-05 0.349   TTTTGGTATCTAGACGGCAGAA
  128. 1       gi|6626252|gb|L42023.1| 946910  946931  -       -0.802083       1.21e-05        0.349   TGTTGCCATAAACATTGAAAAC
  129. 1       gi|6626252|gb|L42023.1| 1127379 1127400 +       -0.864583       1.24e-05        0.352   TTATACGATATTTATAGCTAAA
  130. 1       gi|6626252|gb|L42023.1| 952659  952680  -       -0.90625        1.25e-05        0.353   TATTGTGATTTGGTTTGCAAAA
  131. 1       gi|6626252|gb|L42023.1| 892983  893004  +       -1.05208        1.3e-05 0.365   GTTCACGTTCTTCATCGCAAGC
  132. 1       gi|6626252|gb|L42023.1| 713163  713184  +       -1.1875 1.35e-05        0.374   TTTTGCCACCTGCAGCCAAGAC
  133. 1       gi|6626252|gb|L42023.1| 1349471 1349492 -       -1.19792        1.35e-05        0.374   TTGTGCGAGCGGCACAGCAAAA
  134. 1       gi|6626252|gb|L42023.1| 908746  908767  -       -1.23958        1.37e-05        0.375   TTGGGCGATTAGGATCGGAAAG
  135. 1       gi|6626252|gb|L42023.1| 62030   62051   -       -1.27083        1.38e-05        0.375   TTTAGCGTTCCAGCTGGAAAAA
  136. 1       gi|6626252|gb|L42023.1| 907918  907939  -       -1.38542        1.42e-05        0.384   ATTGACGATATTCATCTAAAGT
  137. 1       gi|6626252|gb|L42023.1| 940250  940271  +       -1.41667        1.43e-05        0.384   TGGTGCGTTCTGCAGCGAAAAA
  138. 1       gi|6626252|gb|L42023.1| 236438  236459  -       -1.45833        1.45e-05        0.386   CTTTACGATCGACCACAAAAAA
  139. 1       gi|6626252|gb|L42023.1| 1003331 1003352 +       -1.54167        1.48e-05        0.392   ATTTACTATCGAAATTGAAAAA
  140. 1       gi|6626252|gb|L42023.1| 1364892 1364913 +       -1.64583        1.52e-05        0.398   TTTGGCGAGCATCATCATAAAC
  141. 1       gi|6626252|gb|L42023.1| 1569545 1569566 +       -1.65625        1.53e-05        0.398   TATTGCTATTAACATTCCAAAT
  142. 1       gi|6626252|gb|L42023.1| 1823596 1823617 -       -1.76042        1.57e-05        0.406   AATTGTGATCTAGTTCTCAAAA
  143. 1       gi|6626252|gb|L42023.1| 1539382 1539403 +       -1.84375        1.6e-05 0.412   TTTAATGATCGGTTTCGTAAAA
  144. 1       gi|6626252|gb|L42023.1| 604652  604673  -       -1.94792        1.65e-05        0.417   ATTTATGATATAGAAACCAAAA
  145. 1       gi|6626252|gb|L42023.1| 147188  147209  +       -1.95833        1.65e-05        0.417   CATTGCGATCAATATGTTAAAA
  146. 1       gi|6626252|gb|L42023.1| 1228189 1228210 +       -2      1.67e-05        0.417   TGTTGCGATAATTAACGCATCA
  147. 1       gi|6626252|gb|L42023.1| 82185   82206   +       -2.01042        1.67e-05        0.417   TTCTGCCGTCTAGATACCAAAA
  148. 1       gi|6626252|gb|L42023.1| 106414  106435  +       -2.02083        1.68e-05        0.417   TTTAACGATTTGGATCGACCGC
  149. 1       gi|6626252|gb|L42023.1| 739572  739593  +       -2.19792        1.76e-05        0.434   ATTTGCGATATTCAAGGCCTAA
  150. 1       gi|6626252|gb|L42023.1| 832843  832864  -       -2.25   1.78e-05        0.436   TTTTACTATAACGACCGCAGGC
  151. 1       gi|6626252|gb|L42023.1| 1446715 1446736 -       -2.29167        1.8e-05 0.438   TATTGTGATAGGGATCACGAAA
  152. 1       gi|6626252|gb|L42023.1| 1811988 1812009 -       -2.35417        1.83e-05        0.443   CATTGCTTACGGGATCGCAAAA
  153. 1       gi|6626252|gb|L42023.1| 1294937 1294958 +       -2.4375 1.87e-05        0.449   TTTGACGAAAGGAATCGTAAGA
  154. 1       gi|6626252|gb|L42023.1| 1339955 1339976 -       -2.55208        1.93e-05        0.459   ATTTACGATTGTCAGTCAAAAA
  155. 1       gi|6626252|gb|L42023.1| 281012  281033  +       -2.63542        1.97e-05        0.463   TTACGCGCTTCGGGTCGCAAAC
  156. 1       gi|6626252|gb|L42023.1| 688201  688222  -       -2.66667        1.98e-05        0.463   TGTTGCGGTGAATGTCGCAAAA
  157. 1       gi|6626252|gb|L42023.1| 662678  662699  -       -2.67708        1.99e-05        0.463   TTTTACGAATTGCATCATTAAC
  158. 1       gi|6626252|gb|L42023.1| 588056  588077  -       -2.75   2.03e-05        0.463   TTTCCCGAAAAGCATCGCCAAA
  159. 1       gi|6626252|gb|L42023.1| 1143930 1143951 -       -2.75   2.03e-05        0.463   CTTTGCCATAAAGCTCGCGGGC
  160. 1       gi|6626252|gb|L42023.1| 919351  919372  +       -2.77083        2.04e-05        0.463   TTTTATGATCTGTAAGGAATAA
  161. 1       gi|6626252|gb|L42023.1| 1306637 1306658 -       -2.78125        2.04e-05        0.463   ATTCACTATCTTTATCTCAAAA
  162. 1       gi|6626252|gb|L42023.1| 43956   43977   +       -2.78125        2.04e-05        0.463   GTTTACGATTTTCATCTCCGAT
  163. 1       gi|6626252|gb|L42023.1| 639020  639041  -       -2.83333        2.07e-05        0.466   TTTCGCGATCAAGCTGGCTTAA
  164. 1       gi|6626252|gb|L42023.1| 1338970 1338991 +       -2.875  2.09e-05        0.467   CTTTGCGAAAATCTTTGCAAGA
  165. 1       gi|6626252|gb|L42023.1| 155252  155273  -       -2.90625        2.11e-05        0.467   ATCTGTGATATATATCACAGAT
  166. 1       gi|6626252|gb|L42023.1| 155252  155273  +       -2.90625        2.11e-05        0.467   ATCTGTGATATATATCACAGAT
  167. 1       gi|6626252|gb|L42023.1| 1276042 1276063 +       -2.95833        2.14e-05        0.468   CATTGTGATCAACATCTAAGAC
  168. 1       gi|6626252|gb|L42023.1| 737842  737863  -       -2.96875        2.14e-05        0.468   CTTTGCGGTTTGTTACGTAGAA
  169. 1       gi|6626252|gb|L42023.1| 540263  540284  +       -3      2.16e-05        0.468   TTTGACGAACTTGATCTAAAGT
  170. 1       gi|6626252|gb|L42023.1| 1407520 1407541 +       -3.09375        2.21e-05        0.468   TTTTGCTTTCTAAATCGCCAGT
  171. 1       gi|6626252|gb|L42023.1| 1249128 1249149 +       -3.10417        2.22e-05        0.468   TTTTGCGATTGATGGCGAATTA
  172. 1       gi|6626252|gb|L42023.1| 1141050 1141071 -       -3.125  2.23e-05        0.468   TTTTGCGATTGAAATTCCTTAT
  173. 1       gi|6626252|gb|L42023.1| 1786111 1786132 -       -3.21875        2.29e-05        0.468   TTTAACGATTGAGATTGTGAAT
  174. 1       gi|6626252|gb|L42023.1| 269474  269495  +       -3.21875        2.29e-05        0.468   ATTTACGATACGAAACTCAAGT
  175. 1       gi|6626252|gb|L42023.1| 415622  415643  +       -3.25   2.3e-05 0.468   GTTTGCGATATACATTGTTGGT
  176. 1       gi|6626252|gb|L42023.1| 996691  996712  +       -3.25   2.3e-05 0.468   CATTACGGATTGGATCGTAAAC
  177. 1       gi|6626252|gb|L42023.1| 224553  224574  -       -3.28125        2.32e-05        0.468   ATTCGAGATCAATATCGAAATT
  178. 1       gi|6626252|gb|L42023.1| 461079  461100  -       -3.29167        2.33e-05        0.468   ATTTTCGATTTCTACCGCAAGC
  179. 1       gi|6626252|gb|L42023.1| 961367  961388  -       -3.29167        2.33e-05        0.468   TTGTGCGTTAGGCAAAGCAAAA
  180. 1       gi|6626252|gb|L42023.1| 1010549 1010570 -       -3.32292        2.35e-05        0.468   ATTTACTTTTCATATTGCAAAA
  181. 1       gi|6626252|gb|L42023.1| 908746  908767  +       -3.32292        2.35e-05        0.468   CTTTCCGATCCTAATCGCCCAA
  182. 1       gi|6626252|gb|L42023.1| 196730  196751  -       -3.33333        2.35e-05        0.468   TTTTGCTTTTCGCATCAAATGA
  183. 1       gi|6626252|gb|L42023.1| 1513391 1513412 -       -3.33333        2.35e-05        0.468   TTTGGCGATATTTTTAGAAAAC
  184. 1       gi|6626252|gb|L42023.1| 206198  206219  +       -3.36458        2.37e-05        0.468   CTTTGCATTTTTTACCGCAAAT
  185. 1       gi|6626252|gb|L42023.1| 1506801 1506822 -       -3.40625        2.4e-05 0.468   TAATGGGATATAGAACCCAAAA
  186. 1       gi|6626252|gb|L42023.1| 368225  368246  +       -3.4375 2.42e-05        0.468   TTTGCCGATCAAAAACGTAAAA
  187. 1       gi|6626252|gb|L42023.1| 56672   56693   -       -3.44792        2.42e-05        0.468   TTTTACGTAAGTCATCCAATAT
  188. 1       gi|6626252|gb|L42023.1| 596497  596518  -       -3.44792        2.42e-05        0.468   TGTTGCGAAAATCATCAAATAA
  189. 1       gi|6626252|gb|L42023.1| 1261385 1261406 +       -3.44792        2.42e-05        0.468   CTTTACGTCAGGCATTGAAAAA
  190. 1       gi|6626252|gb|L42023.1| 80320   80341   -       -3.46875        2.44e-05        0.468   TTTTGTGATCAATATCACAATG
  191. 1       gi|6626252|gb|L42023.1| 301130  301151  -       -3.46875        2.44e-05        0.468   ATTTGCGCTAAATTTTGCATAA
  192. 1       gi|6626252|gb|L42023.1| 1564837 1564858 +       -3.54167        2.48e-05        0.474   GTTTGCGAATTTTAACCCAAAC
  193. 1       gi|6626252|gb|L42023.1| 383134  383155  -       -3.5625 2.5e-05 0.474   TTTTGCGAGCTGTTGCACAAAT
  194. 1       gi|6626252|gb|L42023.1| 878742  878763  +       -3.625  2.54e-05        0.48    TTTAGCGAAAGAAATCGCACAC
  195. 1       gi|6626252|gb|L42023.1| 827942  827963  -       -3.67708        2.57e-05        0.48    TTTCACGATCTTCATCATCTAA
  196. 1       gi|6626252|gb|L42023.1| 1227347 1227368 +       -3.73958        2.61e-05        0.48    TTTATCGAGCAACGTCGCAAGA
  197. 1       gi|6626252|gb|L42023.1| 1314487 1314508 +       -3.73958        2.61e-05        0.48    CTTTGCAATCTGAAAAGCAAAC
  198. 1       gi|6626252|gb|L42023.1| 516238  516259  -       -3.75   2.62e-05        0.48    TTTAACGGTATTTATCTAAAAA
  199. 1       gi|6626252|gb|L42023.1| 1009695 1009716 -       -3.76042        2.63e-05        0.48    CTTTGAAAACTTCATCGAAGAT
  200. 1       gi|6626252|gb|L42023.1| 383134  383155  +       -3.79167        2.65e-05        0.48    ATTTGTGCAACAGCTCGCAAAA
  201. 1       gi|6626252|gb|L42023.1| 1224446 1224467 +       -3.79167        2.65e-05        0.48    TTTGACGAAGTGTATCGCTAAA
  202. 1       gi|6626252|gb|L42023.1| 259052  259073  -       -3.80208        2.65e-05        0.48    TAATGCGGTATGCATCGCCTAA
  203. 1       gi|6626252|gb|L42023.1| 1105997 1106018 +       -3.82292        2.67e-05        0.48    TTTTATTATCGCCATCCAAGAA
  204. 1       gi|6626252|gb|L42023.1| 1407520 1407541 -       -3.85417        2.69e-05        0.48    ACTGGCGATTTAGAAAGCAAAA
  205. 1       gi|6626252|gb|L42023.1| 1720211 1720232 +       -3.86458        2.7e-05 0.48    TTGTACGATTGGGATCTTCTAA
  206. 1       gi|6626252|gb|L42023.1| 97580   97601   -       -3.88542        2.71e-05        0.48    ATTTACTTTCTTCATCGCTGAT
  207. 1       gi|6626252|gb|L42023.1| 1204920 1204941 +       -3.88542        2.71e-05        0.48    TTTTACGCCCAACATTGCAAAG
  208. 1       gi|6626252|gb|L42023.1| 1739709 1739730 +       -3.9375 2.75e-05        0.484   CATTACGATCATCAACAAAAAA
  209. 1       gi|6626252|gb|L42023.1| 1744658 1744679 +       -3.96875        2.77e-05        0.485   TTGGGCGATCTTTAACCCAAGC
  210. 1       gi|6626252|gb|L42023.1| 321908  321929  +       -3.98958        2.78e-05        0.485   ATTTGCGCCAGTCATTGAAAAA
  211. 1       gi|6626252|gb|L42023.1| 817290  817311  +       -4      2.79e-05        0.485   TTAGGCGAACTGGATCATAAAC
  212. 1       gi|6626252|gb|L42023.1| 910582  910603  -       -4.11458        2.87e-05        0.497   TTAGGCGATAAAGTTCGCATCA
  213. 1       gi|6626252|gb|L42023.1| 1385583 1385604 +       -4.19792        2.93e-05        0.505   TTTTGGCATTATGATCGATGAC
  214. 1       gi|6626252|gb|L42023.1| 1532605 1532626 -       -4.25   2.97e-05        0.509   TTTTACCATATCCATTGCAACA
  215. 1       gi|6626252|gb|L42023.1| 46242   46263   -       -4.30208        3.01e-05        0.512   TTTTGGGATAGGCAATGGAAAA
  216. 1       gi|6626252|gb|L42023.1| 100557  100578  -       -4.3125 3.02e-05        0.512   CTTTGCGTTATCGATTGAACAA
  217. 1       gi|6626252|gb|L42023.1| 147257  147278  +       -4.32292        3.03e-05        0.512   CTTTGCGATACTGATATTGAAC
  218. 1       gi|6626252|gb|L42023.1| 387264  387285  -       -4.35417        3.05e-05        0.512   TTATGCGAAATTCATTCAAAAT
  219. 1       gi|6626252|gb|L42023.1| 1324734 1324755 +       -4.375  3.07e-05        0.512   ATCTATAATCAAGATCGAATAA
  220. 1       gi|6626252|gb|L42023.1| 1248509 1248530 +       -4.38542        3.08e-05        0.512   TTCTGCAAAATGCATCGCATCA
  221. 1       gi|6626252|gb|L42023.1| 255346  255367  +       -4.4375 3.12e-05        0.515   ATTAGCCAGCAACATCGCAACA
  222. 1       gi|6626252|gb|L42023.1| 106531  106552  +       -4.44792        3.13e-05        0.515   TTTTGTGATTATCATTGCCTAC
  223. 1       gi|6626252|gb|L42023.1| 817290  817311  -       -4.45833        3.13e-05        0.515   GTTTATGATCCAGTTCGCCTAA
  224. 1       gi|6626252|gb|L42023.1| 1727032 1727053 -       -4.54167        3.2e-05 0.52    TTTTTCAATCAGCTTCTCAAAC
  225. 1       gi|6626252|gb|L42023.1| 499943  499964  +       -4.54167        3.2e-05 0.52    CTTTACGTTTTGCTTCGTGAAT
  226. 1       gi|6626252|gb|L42023.1| 1642422 1642443 +       -4.55208        3.21e-05        0.52    TTTACCGATCTTGATAAAAAAA
  227. 1       gi|6626252|gb|L42023.1| 1770635 1770656 -       -4.58333        3.23e-05        0.52    TTTTGCCTTATTTATCCCGTAA
  228. 1       gi|6626252|gb|L42023.1| 1253920 1253941 +       -4.58333        3.23e-05        0.52    TTTTGCTAGGTTCATCGCACGA
  229. 1       gi|6626252|gb|L42023.1| 960558  960579  +       -4.66667        3.3e-05 0.526   CTTTGCGTAATGGTGCGAAAAA
  230. 1       gi|6626252|gb|L42023.1| 1093446 1093467 +       -4.66667        3.3e-05 0.526   TTTTGCTTTATTCATCACAACA
  231. 1       gi|6626252|gb|L42023.1| 940696  940717  +       -4.69792        3.33e-05        0.528   TTTGACGATCCAGCTTGCGTAA
  232. 1       gi|6626252|gb|L42023.1| 917820  917841  +       -4.75   3.37e-05        0.529   CTTTACGATCTTCCTCCAGAAG
  233. 1       gi|6626252|gb|L42023.1| 240675  240696  -       -4.78125        3.4e-05 0.529   TTTTGCTAGTTTCCTCGCCAAA
  234. 1       gi|6626252|gb|L42023.1| 1700791 1700812 -       -4.79167        3.4e-05 0.529   CACCACGATAAATATCGCAAGA
  235. 1       gi|6626252|gb|L42023.1| 67433   67454   -       -4.8125 3.42e-05        0.529   TTTCGCGCAATGGATACCAGAA
  236. 1       gi|6626252|gb|L42023.1| 1637836 1637857 +       -4.8125 3.42e-05        0.529   TTTCAGGATAAAGATCCAAATT
  237. 1       gi|6626252|gb|L42023.1| 915256  915277  +       -4.82292        3.43e-05        0.529   ATTTTCGATTAACACGGAAAGA
  238. 1       gi|6626252|gb|L42023.1| 701289  701310  -       -4.83333        3.44e-05        0.529   TTTTGCGTTTCACGGCGATAAA
  239. 1       gi|6626252|gb|L42023.1| 634923  634944  -       -4.89583        3.49e-05        0.533   CTTTGCTCGAGGGATCCAAAAC
  240. 1       gi|6626252|gb|L42023.1| 1097167 1097188 -       -4.89583        3.49e-05        0.533   AAATAGGATCTAGATCACAAAA
  241. 1       gi|6626252|gb|L42023.1| 608509  608530  -       -4.9375 3.53e-05        0.537   TTCTGCGCTTCATATACAAAAT
  242. 1       gi|6626252|gb|L42023.1| 211582  211603  -       -4.95833        3.55e-05        0.537   CTTTGCGATCAAAATCAATCAA
  243. 1       gi|6626252|gb|L42023.1| 502046  502067  +       -4.97917        3.57e-05        0.538   CATTACGATAAGCATCAAACAT
  244. 1       gi|6626252|gb|L42023.1| 43582   43603   +       -5.02083        3.6e-05 0.538   ATTTGCGGTAAACACGGCAGGC
  245. 1       gi|6626252|gb|L42023.1| 1397057 1397078 -       -5.04167        3.62e-05        0.538   TGTCGCGATAAAATTCGCAGAT
  246. 1       gi|6626252|gb|L42023.1| 1814973 1814994 +       -5.05208        3.63e-05        0.538   TTTTCCTATATGTATGCCATAT
  247. 1       gi|6626252|gb|L42023.1| 1164511 1164532 -       -5.0625 3.64e-05        0.538   CTCTAACATCTAGATCCCATAC
  248. 1       gi|6626252|gb|L42023.1| 371189  371210  +       -5.07292        3.65e-05        0.538   GTTTGATATTTACACCGCAAAC
  249. 1       gi|6626252|gb|L42023.1| 610314  610335  -       -5.08333        3.66e-05        0.538   TGTTGCCATATGCATTGCATCA
  250. 1       gi|6626252|gb|L42023.1| 807544  807565  +       -5.09375        3.67e-05        0.538   GTTTGCAATAAAGCTTGAAAAA
  251. 1       gi|6626252|gb|L42023.1| 214419  214440  +       -5.13542        3.71e-05        0.54    TTAGGTGATGAAGATCGAAAAC
  252. 1       gi|6626252|gb|L42023.1| 360753  360774  -       -5.15625        3.73e-05        0.54    TTTGGCGAGAGGAAGCGTAAAA
  253. 1       gi|6626252|gb|L42023.1| 938645  938666  -       -5.15625        3.73e-05        0.54    CTTAGACATCTGCAACGCAAAC
  254. 1       gi|6626252|gb|L42023.1| 1496266 1496287 +       -5.1875 3.76e-05        0.541   TTTTGCGATTACGCTCATTAAA
  255. 1       gi|6626252|gb|L42023.1| 1781584 1781605 -       -5.19792        3.76e-05        0.541   CTTTGCTGAACGGCTCGCAAAT
  256. 1       gi|6626252|gb|L42023.1| 83616   83637   +       -5.21875        3.78e-05        0.541   TTTAGCGAATAAGAGAGAAAAA
  257. 1       gi|6626252|gb|L42023.1| 1051469 1051490 +       -5.23958        3.8e-05 0.542   TTTTACCCTCTTCCTCGCCAAA
  258. 1       gi|6626252|gb|L42023.1| 203402  203423  -       -5.30208        3.86e-05        0.548   ATTTAGGATTGGCTTCTAAAAA
  259. 1       gi|6626252|gb|L42023.1| 77538   77559   -       -5.35417        3.91e-05        0.553   CTTTCCAACTAGAATCGCAAAA
  260. 1       gi|6626252|gb|L42023.1| 743950  743971  +       -5.42708        3.98e-05        0.561   TTTTTTGCCCTGCATCGAAAGA
  261. 1       gi|6626252|gb|L42023.1| 699997  700018  +       -5.47917        4.03e-05        0.562   CTTTGCGGATTACAGCCTAAAC
  262. 1       gi|6626252|gb|L42023.1| 214419  214440  -       -5.48958        4.04e-05        0.562   GTTTTCGATCTTCATCACCTAA
  263. 1       gi|6626252|gb|L42023.1| 1475357 1475378 -       -5.48958        4.04e-05        0.562   GTTTACGTTTGTTATCTCAAAT
  264. 1       gi|6626252|gb|L42023.1| 1788904 1788925 -       -5.5    4.05e-05        0.562   ATTGGCGATTGGGATTTTAGAT
  265. 1       gi|6626252|gb|L42023.1| 194094  194115  +       -5.55208        4.1e-05 0.562   TTTTACGGTATTCAGTGAAGAT
  266. 1       gi|6626252|gb|L42023.1| 269474  269495  -       -5.5625 4.12e-05        0.562   ACTTGAGTTTCGTATCGTAAAT
  267. 1       gi|6626252|gb|L42023.1| 217933  217954  +       -5.57292        4.13e-05        0.562   TTTTGCAGTATGAATCGCATCC
  268. 1       gi|6626252|gb|L42023.1| 1793075 1793096 +       -5.57292        4.13e-05        0.562   GTATATGATCTGCACCCCAAAA
  269. 1       gi|6626252|gb|L42023.1| 1681387 1681408 -       -5.59375        4.15e-05        0.562   TTTCACAATCCACACCGCCAAC
  270. 1       gi|6626252|gb|L42023.1| 524006  524027  +       -5.60417        4.16e-05        0.562   TTATGCGAAATATAACGAACAA
  271. 1       gi|6626252|gb|L42023.1| 1340808 1340829 -       -5.63542        4.19e-05        0.562   AATAACGATCCGTATCCAATGC
  272. 1       gi|6626252|gb|L42023.1| 1200913 1200934 -       -5.65625        4.21e-05        0.562   CTTTGTGATTCTGTTCGTGGAT
  273. 1       gi|6626252|gb|L42023.1| 16919   16940   +       -5.66667        4.22e-05        0.562   ATTTACCAAGTGCATCGCGAAA
  274. 1       gi|6626252|gb|L42023.1| 1321869 1321890 +       -5.66667        4.22e-05        0.562   TTTGAATATCCAGATGGCAAGA
  275. 1       gi|6626252|gb|L42023.1| 620670  620691  +       -5.67708        4.23e-05        0.562   TTTTGGGACTTTAATCGCTAAT
  276. 1       gi|6626252|gb|L42023.1| 1215688 1215709 -       -5.69792        4.25e-05        0.562   TTTGACGATTGCCATCGGATGT
  277. 1       gi|6626252|gb|L42023.1| 912391  912412  +       -5.69792        4.25e-05        0.562   TTTTGCCATCGACCTGTAAAAA
  278. 1       gi|6626252|gb|L42023.1| 933990  934011  -       -5.73958        4.3e-05 0.564   TTTCGCGGTTTAGCTTGAAAAT
  279. 1       gi|6626252|gb|L42023.1| 859762  859783  +       -5.73958        4.3e-05 0.564   TATTGTGATATAGAGCAAAAAT
  280. 1       gi|6626252|gb|L42023.1| 46000   46021   -       -5.76042        4.32e-05        0.565   ATTTGGGATAGCTATCAAAAAC
  281. 1       gi|6626252|gb|L42023.1| 651354  651375  +       -5.78125        4.34e-05        0.565   TTTCGCGAACGTGAACCGAAAA
  282. 1       gi|6626252|gb|L42023.1| 108494  108515  -       -5.80208        4.36e-05        0.565   TTTCGTGATTTTGAACGCCAAC
  283. 1       gi|6626252|gb|L42023.1| 711292  711313  +       -5.82292        4.39e-05        0.565   CTTTATGATTTTGTTCGCCAGC
  284. 1       gi|6626252|gb|L42023.1| 966736  966757  -       -5.83333        4.4e-05 0.565   TTTTACTATTTCATTCGAAAAA
  285. 1       gi|6626252|gb|L42023.1| 456494  456515  +       -5.83333        4.4e-05 0.565   CTTTACGATATTGTTCAAATTA
  286. 1       gi|6626252|gb|L42023.1| 340557  340578  -       -5.85417        4.42e-05        0.566   TGTTACGATGTGGTTCAAAAAT
  287. 1       gi|6626252|gb|L42023.1| 179901  179922  +       -5.88542        4.45e-05        0.566   TTTTGCAAAATATAGCACAGAA
  288. 1       gi|6626252|gb|L42023.1| 221282  221303  -       -5.89583        4.46e-05        0.566   ATTTGGGATACGGTTTGCTGAA
  289. 1       gi|6626252|gb|L42023.1| 1496266 1496287 -       -5.90625        4.47e-05        0.566   TTTAATGAGCGTAATCGCAAAA
  290. 1       gi|6626252|gb|L42023.1| 1299666 1299687 +       -5.9375 4.51e-05        0.566   TTTTGCGAATAATCTAGCAATA
  291. 1       gi|6626252|gb|L42023.1| 147188  147209  -       -5.95833        4.53e-05        0.566   TTTTAACATATTGATCGCAATG
  292. 1       gi|6626252|gb|L42023.1| 248815  248836  -       -5.97917        4.56e-05        0.566   ATTTGCCATAAGGAATGAATGA
  293. 1       gi|6626252|gb|L42023.1| 710910  710931  -       -6      4.58e-05        0.566   CTTTGCCATTGTTAGCGCGAGA
  294. 1       gi|6626252|gb|L42023.1| 327445  327466  -       -6.01042        4.59e-05        0.566   TTGTGCCAATCGCATTGAAAAA
  295. 1       gi|6626252|gb|L42023.1| 1160636 1160657 +       -6.03125        4.61e-05        0.566   CTTTTTGATATAGTGCGAAAAA
  296. 1       gi|6626252|gb|L42023.1| 1543117 1543138 -       -6.04167        4.63e-05        0.566   TTTAACGAGTTAAATGGCAAAT
  297. 1       gi|6626252|gb|L42023.1| 1762126 1762147 -       -6.05208        4.64e-05        0.566   ATTTGCGCTATGGCATGAAAAA
  298. 1       gi|6626252|gb|L42023.1| 448530  448551  +       -6.05208        4.64e-05        0.566   ATTTACGATCCACAACAACAGC
  299. 1       gi|6626252|gb|L42023.1| 835832  835853  +       -6.05208        4.64e-05        0.566   TAATGCCATTTGCATACCAAAA
  300. 1       gi|6626252|gb|L42023.1| 1474706 1474727 +       -6.05208        4.64e-05        0.566   AATTGAGATTCATTTCCAAAAA
  301. 1       gi|6626252|gb|L42023.1| 1567267 1567288 -       -6.08333        4.67e-05        0.568   TTTTGCGATATAAATATCATCT
  302. 1       gi|6626252|gb|L42023.1| 655947  655968  -       -6.11458        4.71e-05        0.568   TGTTTCGTTGAATATCGAAAAA
  303. 1       gi|6626252|gb|L42023.1| 16919   16940   -       -6.13542        4.73e-05        0.568   TTTCGCGATGCACTTGGTAAAT
  304. 1       gi|6626252|gb|L42023.1| 1488671 1488692 -       -6.13542        4.73e-05        0.568   ATTTGCAAACGGCAACGCAGCA
  305. 1       gi|6626252|gb|L42023.1| 1386571 1386592 -       -6.14583        4.75e-05        0.568   TTTTATTATTCGCTACGCAAAA
  306. 1       gi|6626252|gb|L42023.1| 1127623 1127644 +       -6.14583        4.75e-05        0.568   CTTTGCGTTCCATATCATCTGA
  307. 1       gi|6626252|gb|L42023.1| 1681515 1681536 +       -6.16667        4.77e-05        0.569   ATTTGCACGTTCCATCGCAGAA
  308. 1       gi|6626252|gb|L42023.1| 558415  558436  -       -6.19792        4.81e-05        0.57    ATTTACGCCAAATATCAAAAAA
  309. 1       gi|6626252|gb|L42023.1| 15423   15444   +       -6.19792        4.81e-05        0.57    TTTTTTGTTCCACATCAAAAAT
  310. 1       gi|6626252|gb|L42023.1| 1202865 1202886 -       -6.27083        4.89e-05        0.573   TTTTACGGAAATCATCCACAAA
  311. 1       gi|6626252|gb|L42023.1| 644334  644355  +       -6.27083        4.89e-05        0.573   CGCTGCCATAAACATCGGAAAA
  312. 1       gi|6626252|gb|L42023.1| 585093  585114  -       -6.28125        4.91e-05        0.573   ATTCGCGATTGTGGTTGTAAAT
  313. 1       gi|6626252|gb|L42023.1| 1607125 1607146 +       -6.29167        4.92e-05        0.573   TTTTGCCACTTTCACCGCAGCA
  314. 1       gi|6626252|gb|L42023.1| 13111   13132   +       -6.30208        4.93e-05        0.573   TTTTCTGATATAGAAGGAAAAT
  315. 1       gi|6626252|gb|L42023.1| 937330  937351  +       -6.30208        4.93e-05        0.573   TTTTGTGATCTAAATCATAGTT
  316. 1       gi|6626252|gb|L42023.1| 360753  360774  +       -6.32292        4.95e-05        0.574   TTTTACGCTTCCTCTCGCCAAA
  317. 1       gi|6626252|gb|L42023.1| 1697542 1697563 +       -6.34375        4.98e-05        0.574   ATTTGCAATAAAGATGACTAAA
  318. 1       gi|6626252|gb|L42023.1| 550087  550108  +       -6.38542        5.03e-05        0.574   TTTCACGCTGAATATCACAAAA
  319. 1       gi|6626252|gb|L42023.1| 605577  605598  +       -6.38542        5.03e-05        0.574   CTTTCCTTTTGCCATCGCAAAA
  320. 1       gi|6626252|gb|L42023.1| 1327603 1327624 -       -6.39583        5.04e-05        0.574   TATTGTGTTCAAGGTCCCATAA
  321. 1       gi|6626252|gb|L42023.1| 1080027 1080048 +       -6.39583        5.04e-05        0.574   ATTAGCAGAACAGATCGCAAAC
  322. 1       gi|6626252|gb|L42023.1| 1794907 1794928 -       -6.40625        5.06e-05        0.574   TGTTGGGATACGCACTGTAAAA
  323. 1       gi|6626252|gb|L42023.1| 747774  747795  -       -6.41667        5.07e-05        0.574   TTTTGCGATCTTTTACCTTGAT
  324. 1       gi|6626252|gb|L42023.1| 1235655 1235676 -       -6.44792        5.11e-05        0.575   CTTTACCATAAACATCTAAACC
  325. 1       gi|6626252|gb|L42023.1| 116624  116645  -       -6.46875        5.13e-05        0.575   TTGTGCGATCTCTAACTCATAC
  326. 1       gi|6626252|gb|L42023.1| 1539382 1539403 -       -6.46875        5.13e-05        0.575   TTTTACGAAACCGATCATTAAA
  327. 1       gi|6626252|gb|L42023.1| 461079  461100  +       -6.46875        5.13e-05        0.575   GCTTGCGGTAGAAATCGAAAAT
  328. 1       gi|6626252|gb|L42023.1| 874780  874801  -       -6.47917        5.15e-05        0.575   CTTTGGCATAAATACCGAATAA
  329. 1       gi|6626252|gb|L42023.1| 1095560 1095581 -       -6.5625 5.25e-05        0.583   CTTTGCAAGTGTAATCGCAGGC
  330. 1       gi|6626252|gb|L42023.1| 703302  703323  +       -6.5625 5.25e-05        0.583   TTTTGAGCCAGAGATAGCAGAT
  331. 1       gi|6626252|gb|L42023.1| 1347053 1347074 -       -6.58333        5.28e-05        0.584   TACTGCAATTTAGATCGCTTGA
  332. 1       gi|6626252|gb|L42023.1| 600600  600621  +       -6.59375        5.29e-05        0.584   GTTTACGATCTTTAACGCCTGC
  333. 1       gi|6626252|gb|L42023.1| 733486  733507  -       -6.65625        5.38e-05        0.585   CTTTACCATTTTGATGGTGGAA
  334. 1       gi|6626252|gb|L42023.1| 637337  637358  +       -6.67708        5.4e-05 0.585   TCAGGCGATCGTCATCCCAAAG
  335. 1       gi|6626252|gb|L42023.1| 1572994 1573015 -       -6.69792        5.43e-05        0.585   TTTTGCACCCCACATCGTGAGA
  336. 1       gi|6626252|gb|L42023.1| 62030   62051   +       -6.69792        5.43e-05        0.585   TTTTTCCAGCTGGAACGCTAAA
  337. 1       gi|6626252|gb|L42023.1| 229120  229141  +       -6.69792        5.43e-05        0.585   ATTTTCGGTTTTAATCCAAAAT
  338. 1       gi|6626252|gb|L42023.1| 637130  637151  +       -6.69792        5.43e-05        0.585   TTATGGAATCAAAATCGTAAAT
  339. 1       gi|6626252|gb|L42023.1| 524006  524027  -       -6.71875        5.46e-05        0.585   TTGTTCGTTATATTTCGCATAA
  340. 1       gi|6626252|gb|L42023.1| 221169  221190  +       -6.72917        5.47e-05        0.585   CTTGATGATCATGATGCAAAAA
  341. 1       gi|6626252|gb|L42023.1| 1024095 1024116 +       -6.75   5.5e-05 0.585   ATTTGGGATACGATTAGCAAAT
  342. 1       gi|6626252|gb|L42023.1| 1026914 1026935 -       -6.78125        5.54e-05        0.585   CATCGCGATTGGCTTCGTATAT
  343. 1       gi|6626252|gb|L42023.1| 1010549 1010570 +       -6.78125        5.54e-05        0.585   TTTTGCAATATGAAAAGTAAAT
  344. 1       gi|6626252|gb|L42023.1| 1227591 1227612 +       -6.78125        5.54e-05        0.585   AATAGCGTTCTGCATCCAAGGC
  345. 1       gi|6626252|gb|L42023.1| 1639806 1639827 +       -6.78125        5.54e-05        0.585   TTAGGCGATTTTGATATAAAAA
  346. 1       gi|6626252|gb|L42023.1| 56922   56943   -       -6.79167        5.56e-05        0.585   TTTGGATATTCACATCCCGAAA
  347. 1       gi|6626252|gb|L42023.1| 138944  138965  -       -6.80208        5.57e-05        0.585   ATTTACGAGCTAGATAGCCATC
  348. 1       gi|6626252|gb|L42023.1| 218740  218761  -       -6.80208        5.57e-05        0.585   CTTTTTGATTTAGTTCTCAAAC
  349. 1       gi|6626252|gb|L42023.1| 1194311 1194332 -       -6.82292        5.6e-05 0.585   TTTTTCGATAATTTTTCCATAA
  350. 1       gi|6626252|gb|L42023.1| 818319  818340  -       -6.83333        5.61e-05        0.585   TTTGACGATCAATATCAACTGA
  351. 1       gi|6626252|gb|L42023.1| 808080  808101  +       -6.83333        5.61e-05        0.585   CTATACGATCTAAAGCCAATAC
  352. 1       gi|6626252|gb|L42023.1| 45809   45830   -       -6.85417        5.64e-05        0.587   TTTTTCCGTTCATAACGCAGAA
  353. 1       gi|6626252|gb|L42023.1| 343392  343413  -       -6.88542        5.69e-05        0.588   ATTTACTAAATGGGTGGCAAAA
  354. 1       gi|6626252|gb|L42023.1| 1322838 1322859 -       -6.89583        5.7e-05 0.588   ATATGCGGATAGCATCACAAAA
  355. 1       gi|6626252|gb|L42023.1| 910582  910603  +       -6.94792        5.77e-05        0.588   TGATGCGAACTTTATCGCCTAA
  356. 1       gi|6626252|gb|L42023.1| 1056490 1056511 +       -6.94792        5.77e-05        0.588   CTTTAGGATAACGATCCGAAGT
  357. 1       gi|6626252|gb|L42023.1| 1003331 1003352 -       -6.96875        5.8e-05 0.588   TTTTTCAATTTCGATAGTAAAT
  358. 1       gi|6626252|gb|L42023.1| 698802  698823  +       -6.98958        5.83e-05        0.588   TTGTGCGACTAACATTCCAAAG
  359. 1       gi|6626252|gb|L42023.1| 847075  847096  +       -6.98958        5.83e-05        0.588   AATGGCGAGTTATCTCGCAAAA
  360. 1       gi|6626252|gb|L42023.1| 1376811 1376832 +       -7      5.85e-05        0.588   CTTTATGAACAACTTCGCCAAA
  361. 1       gi|6626252|gb|L42023.1| 387509  387530  -       -7.04167        5.91e-05        0.588   TTTTAGGTTTATCATCACAAGC
  362. 1       gi|6626252|gb|L42023.1| 1312881 1312902 -       -7.04167        5.91e-05        0.588   TTTTGTTATTGATAACGCCAAA
  363. 1       gi|6626252|gb|L42023.1| 1526002 1526023 +       -7.04167        5.91e-05        0.588   TTTAACGATAAATTTCATATAA
  364. 1       gi|6626252|gb|L42023.1| 1828724 1828745 -       -7.05208        5.92e-05        0.588   TTTGCGGATTTAGATCGAATTA
  365. 1       gi|6626252|gb|L42023.1| 1369451 1369472 +       -7.05208        5.92e-05        0.588   ATGTGTGATTTTTATCGACAAT
  366. 1       gi|6626252|gb|L42023.1| 1067891 1067912 -       -7.0625 5.94e-05        0.588   TTTTTCAATTAACATTCTATAA
  367. 1       gi|6626252|gb|L42023.1| 2957    2978    +       -7.0625 5.94e-05        0.588   ATTTTAGAACGTTATCGCAAGC
  368. 1       gi|6626252|gb|L42023.1| 1327465 1327486 +       -7.0625 5.94e-05        0.588   ATTTTAGATGTACATCGTAATA
  369. 1       gi|6626252|gb|L42023.1| 1023642 1023663 +       -7.07292        5.95e-05        0.588   AATTCCGATAGCGAGCGCAAGA
  370. 1       gi|6626252|gb|L42023.1| 8050    8071    -       -7.09375        5.98e-05        0.588   ATTGGCGGTTTTTATCCCAAGG
  371. 1       gi|6626252|gb|L42023.1| 326858  326879  -       -7.09375        5.98e-05        0.588   TCTTGCAACTGACACCGAAAAA
  372. 1       gi|6626252|gb|L42023.1| 1508643 1508664 -       -7.09375        5.98e-05        0.588   TTTTACAGCCCTGATCGGAAAC
  373. 1       gi|6626252|gb|L42023.1| 966736  966757  +       -7.10417        6e-05   0.588   TTTTTCGAATGAAATAGTAAAA
  374. 1       gi|6626252|gb|L42023.1| 1046369 1046390 -       -7.125  6.03e-05        0.589   CTTGGCGATTTGCGACGCGTAA
  375. 1       gi|6626252|gb|L42023.1| 906990  907011  +       -7.13542        6.04e-05        0.589   ATTTACGACAAAATTCCAAGAA
  376. 1       gi|6626252|gb|L42023.1| 323456  323477  +       -7.15625        6.07e-05        0.589   CTGTGCGATTTTCATCAAGAGC
  377. 1       gi|6626252|gb|L42023.1| 443191  443212  +       -7.15625        6.07e-05        0.589   TTTTACGTTTAGCAGTGAATGA
  378. 1       gi|6626252|gb|L42023.1| 397617  397638  +       -7.16667        6.09e-05        0.589   TGTTGGCATTTGCATAGTAAAA
  379. 1       gi|6626252|gb|L42023.1| 566228  566249  -       -7.1875 6.12e-05        0.591   ATTTACGATAGCTTGCGCAAGT
  380. 1       gi|6626252|gb|L42023.1| 304825  304846  +       -7.19792        6.14e-05        0.591   CTTTACAAATTAAATCGTAAGC
  381. 1       gi|6626252|gb|L42023.1| 1204920 1204941 -       -7.22917        6.18e-05        0.594   CTTTGCAATGTTGGGCGTAAAA
  382. 1       gi|6626252|gb|L42023.1| 1109813 1109834 +       -7.28125        6.26e-05        0.6     AGTTACGGTCATTATGGCATAA
  383. 1       gi|6626252|gb|L42023.1| 1448604 1448625 -       -7.30208        6.29e-05        0.601   CATCGCAATAATGATCCAAAAT
  384. 1       gi|6626252|gb|L42023.1| 1337788 1337809 -       -7.32292        6.32e-05        0.601   TTTTGCCATTTGCATTAAAGAG
  385. 1       gi|6626252|gb|L42023.1| 235483  235504  -       -7.34375        6.36e-05        0.601   ATTTATTATATTGATCTAAAAC
  386. 1       gi|6626252|gb|L42023.1| 594809  594830  +       -7.34375        6.36e-05        0.601   TTCTGCTATTTGTATTGCCAAC
  387. 1       gi|6626252|gb|L42023.1| 1452996 1453017 +       -7.34375        6.36e-05        0.601   ATTTGCGGTAATAATCCAAATT
  388. 1       gi|6626252|gb|L42023.1| 688471  688492  -       -7.35417        6.37e-05        0.601   TTTTGCCACTGAAATGGTAAAA
  389. 1       gi|6626252|gb|L42023.1| 151292  151313  -       -7.40625        6.45e-05        0.607   TTTTGCGGAAAAAATGGAAAAC
  390. 1       gi|6626252|gb|L42023.1| 1228189 1228210 -       -7.42708        6.48e-05        0.607   TGATGCGTTAATTATCGCAACA
  391. 1       gi|6626252|gb|L42023.1| 470614  470635  +       -7.42708        6.48e-05        0.607   TTTTGCCATCAACACGGTGGAA
  392. 1       gi|6626252|gb|L42023.1| 190501  190522  -       -7.4375 6.5e-05 0.607   CTTTACGTTTTGCATAGAATTT
  393. 1       gi|6626252|gb|L42023.1| 615818  615839  +       -7.44792        6.52e-05        0.607   ATTAGCAATAAGCATCCAATCA
  394. 1       gi|6626252|gb|L42023.1| 508005  508026  -       -7.47917        6.57e-05        0.607   TTTTACCATTTTGCTACAAAAC
  395. 1       gi|6626252|gb|L42023.1| 1387897 1387918 +       -7.47917        6.57e-05        0.607   TTTTGCAATTTTGATAAACAAA
  396. 1       gi|6626252|gb|L42023.1| 1631294 1631315 +       -7.47917        6.57e-05        0.607   ATGTGTAATACGCACCGCAGAA
  397. 1       gi|6626252|gb|L42023.1| 885812  885833  -       -7.48958        6.58e-05        0.607   TTTTTTGAGGTAGATCACAAAA
  398. 1       gi|6626252|gb|L42023.1| 1806298 1806319 +       -7.5    6.6e-05 0.607   GGTTACGTTCTGTATCGCTGAT
  399. 1       gi|6626252|gb|L42023.1| 637337  637358  -       -7.53125        6.65e-05        0.607   CTTTGGGATGACGATCGCCTGA
  400. 1       gi|6626252|gb|L42023.1| 1283382 1283403 -       -7.53125        6.65e-05        0.607   TTTGGCTATAAAGCTCTAAAAT
  401. 1       gi|6626252|gb|L42023.1| 279014  279035  -       -7.54167        6.66e-05        0.607   TTTTGGGATTGACTACCAATAT
  402. 1       gi|6626252|gb|L42023.1| 181487  181508  +       -7.54167        6.66e-05        0.607   TTTTGGTATCATTGTTGCAAAA
  403. 1       gi|6626252|gb|L42023.1| 869665  869686  -       -7.57292        6.72e-05        0.608   TTATGCAAATCGTATTGCAAAT
  404. 1       gi|6626252|gb|L42023.1| 937330  937351  -       -7.57292        6.72e-05        0.608   AACTATGATTTAGATCACAAAA
  405. 1       gi|6626252|gb|L42023.1| 340557  340578  +       -7.59375        6.75e-05        0.61    ATTTTTGAACCACATCGTAACA
  406. 1       gi|6626252|gb|L42023.1| 1599147 1599168 -       -7.60417        6.77e-05        0.61    ATTCACGAATAGCATCTAATAA
  407. 1       gi|6626252|gb|L42023.1| 952659  952680  +       -7.625  6.8e-05 0.611   TTTTGCAAACCAAATCACAATA
  408. 1       gi|6626252|gb|L42023.1| 78440   78461   -       -7.65625        6.85e-05        0.611   ATTTGGGATTTTTAACGGATAT
  409. 1       gi|6626252|gb|L42023.1| 938510  938531  -       -7.65625        6.85e-05        0.611   TTTTACGGTATTCATCCACTCA
  410. 1       gi|6626252|gb|L42023.1| 378942  378963  -       -7.67708        6.88e-05        0.611   CTTTGCAATTCATCGCCAAAAT
  411. 1       gi|6626252|gb|L42023.1| 111486  111507  +       -7.67708        6.88e-05        0.611   CTTTGCCTTCATCATCGTATTC
  412. 1       gi|6626252|gb|L42023.1| 1294426 1294447 +       -7.69792        6.92e-05        0.611   TTTGGCGATCAACGACGTGTAA
  413. 1       gi|6626252|gb|L42023.1| 1195666 1195687 -       -7.70833        6.94e-05        0.611   TGTTGTGATAAACCACGCAGGA
  414. 1       gi|6626252|gb|L42023.1| 1311330 1311351 -       -7.70833        6.94e-05        0.611   CGTGGCCATATTGATCGTAGGC
  415. 1       gi|6626252|gb|L42023.1| 381096  381117  +       -7.70833        6.94e-05        0.611   TTTTCCGCTCTTGATGCCATCA
  416. 1       gi|6626252|gb|L42023.1| 869665  869686  +       -7.72917        6.97e-05        0.613   ATTTGCAATACGATTTGCATAA
  417. 1       gi|6626252|gb|L42023.1| 1242924 1242945 +       -7.75   7.01e-05        0.613   TTATGCGATTGGTGTGGCTGAA
  418. 1       gi|6626252|gb|L42023.1| 221282  221303  +       -7.76042        7.02e-05        0.613   TTCAGCAAACCGTATCCCAAAT
  419. 1       gi|6626252|gb|L42023.1| 1381023 1381044 +       -7.76042        7.02e-05        0.613   ATGTGCGCCCTAGATTGTAAAC
  420. 1       gi|6626252|gb|L42023.1| 891701  891722  -       -7.79167        7.08e-05        0.616   TTTTGATAATTTCATCGCGAAT
  421. 1       gi|6626252|gb|L42023.1| 630935  630956  +       -7.8125 7.11e-05        0.618   TTTTCGGTTTTAGAGCGAAGAT
  422. 1       gi|6626252|gb|L42023.1| 1115478 1115499 -       -7.84375        7.16e-05        0.618   GCTTGTGAATTGCATCGAATAA
  423. 1       gi|6626252|gb|L42023.1| 1751530 1751551 -       -7.84375        7.16e-05        0.618   TTGTGCTATTTATAACAAAAAA
  424. 1       gi|6626252|gb|L42023.1| 1770098 1770119 -       -7.86458        7.2e-05 0.618   TTTTAGGATTTGGATTGCCGCT
  425. 1       gi|6626252|gb|L42023.1| 579020  579041  +       -7.86458        7.2e-05 0.618   TTTTACGTTCTTCAAAGGAAAT
  426. 1       gi|6626252|gb|L42023.1| 913784  913805  +       -7.86458        7.2e-05 0.618   ATTTGCGTTTTTCATCAAATTT
  427. 1       gi|6626252|gb|L42023.1| 22130   22151   +       -7.91667        7.29e-05        0.624   ATATACGTTCATCATCAAATAA
  428. 1       gi|6626252|gb|L42023.1| 373937  373958  -       -7.94792        7.34e-05        0.626   TTTTAAAATCCACACGCCAAAA
  429. 1       gi|6626252|gb|L42023.1| 1115285 1115306 -       -7.95833        7.36e-05        0.626   ATGAGCGAAAGAGATTGCAAAC
  430. 1       gi|6626252|gb|L42023.1| 1130197 1130218 -       -7.95833        7.36e-05        0.626   TATTGGTATCTTGATCCCATTA
  431. 1       gi|6626252|gb|L42023.1| 417545  417566  -       -7.97917        7.4e-05 0.626   CTTTCCAATCATCATCAGAAAA
  432. 1       gi|6626252|gb|L42023.1| 641925  641946  +       -7.97917        7.4e-05 0.626   TTGTACGATAAATGTCCAACAC
  433. 1       gi|6626252|gb|L42023.1| 394764  394785  -       -7.98958        7.42e-05        0.626   CTTTACGATCGTAATCCAGATT
  434. 1       gi|6626252|gb|L42023.1| 1543117 1543138 +       -8      7.43e-05        0.626   ATTTGCCATTTAACTCGTTAAA
  435. 1       gi|6626252|gb|L42023.1| 1386613 1386634 -       -8.01042        7.45e-05        0.627   CTTTACCATTTTCATCAAAACC
  436. 1       gi|6626252|gb|L42023.1| 189554  189575  -       -8.0625 7.55e-05        0.63    TATTGTGATTAACAAACCAAAA
  437. 1       gi|6626252|gb|L42023.1| 1697542 1697563 -       -8.0625 7.55e-05        0.63    TTTAGTCATCTTTATTGCAAAT
  438. 1       gi|6626252|gb|L42023.1| 441656  441677  +       -8.07292        7.57e-05        0.63    TTTGAAAATCGGGATCGATGAA
  439. 1       gi|6626252|gb|L42023.1| 692166  692187  -       -8.10417        7.62e-05        0.63    CTTTTCAATCCTGATCACTTAA
  440. 1       gi|6626252|gb|L42023.1| 807544  807565  -       -8.10417        7.62e-05        0.63    TTTTTCAAGCTTTATTGCAAAC
  441. 1       gi|6626252|gb|L42023.1| 554980  555001  +       -8.10417        7.62e-05        0.63    ATTTACGATAAATTCCGAAATC
  442. 1       gi|6626252|gb|L42023.1| 291425  291446  -       -8.11458        7.64e-05        0.63    TTTTACGAGAGAAATCAATAAA
  443. 1       gi|6626252|gb|L42023.1| 1174760 1174781 +       -8.11458        7.64e-05        0.63    CTTTGCGATAAGCCACCCACCA
  444. 1       gi|6626252|gb|L42023.1| 762332  762353  -       -8.15625        7.71e-05        0.632   TTTTTTCAAAGTGATCGCAAAT
  445. 1       gi|6626252|gb|L42023.1| 793225  793246  -       -8.16667        7.73e-05        0.632   GTTAGCGGTAAACATACCAGAA
  446. 1       gi|6626252|gb|L42023.1| 330926  330947  -       -8.1875 7.77e-05        0.632   TTATGCGATTTACGTTGAATTA
  447. 1       gi|6626252|gb|L42023.1| 933770  933791  -       -8.1875 7.77e-05        0.632   TTTTGCACGATTCATTGCATAA
  448. 1       gi|6626252|gb|L42023.1| 1352138 1352159 +       -8.1875 7.77e-05        0.632   TTTTGCTACACGCATATCAAGT
  449. 1       gi|6626252|gb|L42023.1| 79977   79998   -       -8.19792        7.79e-05        0.632   TTTTGCGAGAAGCATTGAGATT
  450. 1       gi|6626252|gb|L42023.1| 1093253 1093274 -       -8.19792        7.79e-05        0.632   ATTGAAGAAAAAGTTCGCAAAA
  451. 1       gi|6626252|gb|L42023.1| 603192  603213  +       -8.20833        7.81e-05        0.632   TTATTCGATCCTTATGGAAACA
  452. 1       gi|6626252|gb|L42023.1| 1750098 1750119 +       -8.20833        7.81e-05        0.632   ATTCGCATTTTTCATCGCGAAA
  453. 1       gi|6626252|gb|L42023.1| 1250247 1250268 -       -8.28125        7.94e-05        0.638   TTTTATGATCGTTATCCTCACA
  454. 1       gi|6626252|gb|L42023.1| 78063   78084   +       -8.28125        7.94e-05        0.638   TTTTACTATCCCCATCAACAAC
  455. 1       gi|6626252|gb|L42023.1| 1097818 1097839 +       -8.28125        7.94e-05        0.638   TTATGCGATGGATAGAGAAGAA
  456. 1       gi|6626252|gb|L42023.1| 1014187 1014208 -       -8.33333        8.04e-05        0.64    TTTTTCGGGCAAAATCCAAAAT
  457. 1       gi|6626252|gb|L42023.1| 1532605 1532626 +       -8.33333        8.04e-05        0.64    TGTTGCAATGGATATGGTAAAA
  458. 1       gi|6626252|gb|L42023.1| 827036  827057  +       -8.34375        8.06e-05        0.64    AAGTGCGGTCAGGATCGACTAA
  459. 1       gi|6626252|gb|L42023.1| 845564  845585  +       -8.34375        8.06e-05        0.64    TGTTGCGATTTTCAATCCTAAA
  460. 1       gi|6626252|gb|L42023.1| 1695692 1695713 -       -8.35417        8.08e-05        0.64    TTTTGCGCGCAGTATCAAGAAT
  461. 1       gi|6626252|gb|L42023.1| 586230  586251  -       -8.36458        8.1e-05 0.64    ATTTGAGAAATTGGTGGCAGAA
  462. 1       gi|6626252|gb|L42023.1| 237061  237082  +       -8.36458        8.1e-05 0.64    GTTTGCGGTAAGCAGTGTAGAA
  463. 1       gi|6626252|gb|L42023.1| 1567267 1567288 +       -8.38542        8.14e-05        0.64    AGATGATATTTATATCGCAAAA
  464. 1       gi|6626252|gb|L42023.1| 374981  375002  -       -8.39583        8.16e-05        0.64    CTTTTCCATCACGATCCATAAA
  465. 1       gi|6626252|gb|L42023.1| 1029793 1029814 -       -8.39583        8.16e-05        0.64    TTTTGGGATCTTCTGCGTTAAT
  466. 1       gi|6626252|gb|L42023.1| 406209  406230  +       -8.40625        8.18e-05        0.64    CTTTTAGAAAAAGATCTAAAAA
  467. 1       gi|6626252|gb|L42023.1| 893416  893437  +       -8.40625        8.18e-05        0.64    TTTTACGATTAAAAAGGAAATA
  468. 1       gi|6626252|gb|L42023.1| 905315  905336  +       -8.42708        8.22e-05        0.64    TTTTCCCTTTTGCATCAAAAAC
  469. 1       gi|6626252|gb|L42023.1| 1376621 1376642 +       -8.4375 8.24e-05        0.64    TTTTGGGTTTTGGCTCGCACTA
  470. 1       gi|6626252|gb|L42023.1| 739871  739892  -       -8.45833        8.28e-05        0.64    TTTTACGTCAAGCAGCCAAAGT
  471. 1       gi|6626252|gb|L42023.1| 1270642 1270663 -       -8.45833        8.28e-05        0.64    TTTTATGTTAAGCGTGGCAGAA
  472. 1       gi|6626252|gb|L42023.1| 1052405 1052426 +       -8.45833        8.28e-05        0.64    TTTTGCCAGTAGGATTCCAATT
  473. 1       gi|6626252|gb|L42023.1| 1794907 1794928 +       -8.45833        8.28e-05        0.64    TTTTACAGTGCGTATCCCAACA
  474. 1       gi|6626252|gb|L42023.1| 850318  850339  -       -8.47917        8.32e-05        0.641   GTTTGCTTTTTTCAACGCAGAT
  475. 1       gi|6626252|gb|L42023.1| 992233  992254  -       -8.47917        8.32e-05        0.641   TTTTGCGATGAGGGTGCAGAAC
  476. 1       gi|6626252|gb|L42023.1| 1539996 1540017 +       -8.48958        8.34e-05        0.641   TATTACCATTTGCATAGCCAGA
  477. 1       gi|6626252|gb|L42023.1| 461632  461653  -       -8.5    8.36e-05        0.641   CAATGCGATCATTGTCCCAAGC
  478. 1       gi|6626252|gb|L42023.1| 314094  314115  -       -8.53125        8.42e-05        0.641   TAATGCGCTACACATAGTAAAC
  479. 1       gi|6626252|gb|L42023.1| 237575  237596  +       -8.54167        8.45e-05        0.641   TTTGGCGATAAAAATACGAAGA
  480. 1       gi|6626252|gb|L42023.1| 720028  720049  +       -8.54167        8.45e-05        0.641   CTTGGCGATAGGCTTCAAAAAG
  481. 1       gi|6626252|gb|L42023.1| 831793  831814  +       -8.54167        8.45e-05        0.641   AATTGTGATTAAGTTCTCAAAT
  482. 1       gi|6626252|gb|L42023.1| 1510020 1510041 -       -8.5625 8.49e-05        0.641   ATTTTCGCTTTGGCACGCAAGT
  483. 1       gi|6626252|gb|L42023.1| 1434002 1434023 -       -8.57292        8.51e-05        0.641   CTTTACTATCTGCACAGAAATA
  484. 1       gi|6626252|gb|L42023.1| 1579381 1579402 -       -8.57292        8.51e-05        0.641   CTTTGCGTTCTTGGTAGATAAT
  485. 1       gi|6626252|gb|L42023.1| 1019033 1019054 +       -8.58333        8.53e-05        0.641   TTTTCCGATAAAGATTTTACAT
  486. 1       gi|6626252|gb|L42023.1| 234978  234999  -       -8.59375        8.55e-05        0.641   ATATGCGATGCGTATTGCGTAA
  487. 1       gi|6626252|gb|L42023.1| 572269  572290  +       -8.59375        8.55e-05        0.641   TTTTGCTATTTGGATCATCGCT
  488. 1       gi|6626252|gb|L42023.1| 603768  603789  +       -8.59375        8.55e-05        0.641   TTCTGCGATAAATTTCGCTGCT
  489. 1       gi|6626252|gb|L42023.1| 870000  870021  +       -8.625  8.61e-05        0.643   TTTTACGAACTGAATCGACTTT
  490. 1       gi|6626252|gb|L42023.1| 1623219 1623240 -       -8.64583        8.65e-05        0.643   TTTTACGATTACCAAGGCGAAC
  491. 1       gi|6626252|gb|L42023.1| 570372  570393  +       -8.64583        8.65e-05        0.643   TTGTGCGTTTAATTCCGCATAA
  492. 1       gi|6626252|gb|L42023.1| 1000228 1000249 +       -8.64583        8.65e-05        0.643   TTTTGCAAGCGATATCCTCTGA
  493. 1       gi|6626252|gb|L42023.1| 1448339 1448360 +       -8.66667        8.7e-05 0.644   TGTGGCGATTTTGGTGGCAAGC
  494. 1       gi|6626252|gb|L42023.1| 1289259 1289280 -       -8.6875 8.74e-05        0.644   TTATGAGATATTGATCACATTT
  495. 1       gi|6626252|gb|L42023.1| 224553  224574  +       -8.6875 8.74e-05        0.644   AATTTCGATATTGATCTCGAAT
  496. 1       gi|6626252|gb|L42023.1| 488829  488850  +       -8.6875 8.74e-05        0.644   TTTTGCGTTTGAGGACTTAAAT
  497. 1       gi|6626252|gb|L42023.1| 991361  991382  -       -8.69792        8.76e-05        0.644   TTGTGCTCTAAGTATCTCAAGA
  498. 1       gi|6626252|gb|L42023.1| 1675858 1675879 -       -8.71875        8.8e-05 0.644   AATTTAGTTAAACATCGCAGAA
  499. 1       gi|6626252|gb|L42023.1| 1793075 1793096 -       -8.71875        8.8e-05 0.644   TTTTGGGGTGCAGATCATATAC
  500. 1       gi|6626252|gb|L42023.1| 220145  220166  -       -8.73958        8.84e-05        0.644   ACTAGTGAAAAGCATCGCAAAT
  501. 1       gi|6626252|gb|L42023.1| 1222996 1223017 +       -8.73958        8.84e-05        0.644   TTCTTCATTCGGCATCGCAGGC
  502. 1       gi|6626252|gb|L42023.1| 50421   50442   -       -8.75   8.87e-05        0.644   TTTTGCTAAGGTTATTGCAGAA
  503. 1       gi|6626252|gb|L42023.1| 1145349 1145370 -       -8.76042        8.89e-05        0.644   GTTTGCGAAAGATGTCGCGGAT
  504. 1       gi|6626252|gb|L42023.1| 1488167 1488188 -       -8.76042        8.89e-05        0.644   TTTAACCAAAGAGATTGAAAAA
  505. 1       gi|6626252|gb|L42023.1| 301130  301151  +       -8.76042        8.89e-05        0.644   TTATGCAAAATTTAGCGCAAAT
  506. 1       gi|6626252|gb|L42023.1| 1151092 1151113 +       -8.8125 9e-05   0.649   CTTTCCAATCTACACCGACTAA
  507. 1       gi|6626252|gb|L42023.1| 134174  134195  -       -8.82292        9.02e-05        0.649   TTTTACGTTCAATTTGGCTAAT
  508. 1       gi|6626252|gb|L42023.1| 391216  391237  +       -8.82292        9.02e-05        0.649   AATAGCGTTTCACAACCCAAAA
  509. 1       gi|6626252|gb|L42023.1| 1626693 1626714 -       -8.83333        9.04e-05        0.649   TCATGCGATTGTGAGCGAAGAG
  510. 1       gi|6626252|gb|L42023.1| 1288826 1288847 -       -8.84375        9.07e-05        0.649   TTTTATGATCGAGGGAGCAAGT
  511. 1       gi|6626252|gb|L42023.1| 359777  359798  +       -8.84375        9.07e-05        0.649   CTTGGCGATAAACCGCTAAAAA
  512. 1       gi|6626252|gb|L42023.1| 237959  237980  +       -8.85417        9.09e-05        0.649   ATTCGCGATTGGTTACGCCAAA
  513. 1       gi|6626252|gb|L42023.1| 517360  517381  +       -8.88542        9.15e-05        0.65    ATTAACGATCTGCATAAAAAAG
  514. 1       gi|6626252|gb|L42023.1| 1273842 1273863 +       -8.88542        9.15e-05        0.65    ATTTTCTATGCTGTTCGTAAAA
  515. 1       gi|6626252|gb|L42023.1| 648291  648312  -       -8.89583        9.18e-05        0.65    CTTTCTGATTTACATTGATAAA
  516. 1       gi|6626252|gb|L42023.1| 1199090 1199111 -       -8.89583        9.18e-05        0.65    ATTTGCATTCAAAATCCCAACT
  517. 1       gi|6626252|gb|L42023.1| 369460  369481  +       -8.90625        9.2e-05 0.65    TTTTTTGATCTATAACAAATAA
  518. 1       gi|6626252|gb|L42023.1| 1754829 1754850 +       -8.92708        9.24e-05        0.652   TTTTACGTTATATATTGCACCC
  519. 1       gi|6626252|gb|L42023.1| 487729  487750  +       -8.9375 9.27e-05        0.653   TTCTACGATATTGAAAACAAAC
  520. 1       gi|6626252|gb|L42023.1| 1029793 1029814 +       -8.95833        9.31e-05        0.654   ATTAACGCAGAAGATCCCAAAA
  521. 1       gi|6626252|gb|L42023.1| 1166772 1166793 +       -8.95833        9.31e-05        0.654   TATAGCGAACTAGATTGCAAGG
  522. 1       gi|6626252|gb|L42023.1| 1072151 1072172 +       -8.97917        9.36e-05        0.654   TGGTGCGATCTTTGTGGAAGAA
  523. 1       gi|6626252|gb|L42023.1| 291768  291789  +       -9.01042        9.42e-05        0.654   CTTTGCGTACTGCACCTTATAA
  524. 1       gi|6626252|gb|L42023.1| 286432  286453  +       -9.02083        9.45e-05        0.654   AGATGCGCTAAAAATCGCAGGA
  525. 1       gi|6626252|gb|L42023.1| 1061140 1061161 +       -9.03125        9.47e-05        0.654   TTTGGCACTAAATACCCCAAAA
  526. 1       gi|6626252|gb|L42023.1| 17139   17160   -       -9.04167        9.49e-05        0.654   TTTAGGGATTTTCACGCCAAAA
  527. 1       gi|6626252|gb|L42023.1| 201242  201263  +       -9.04167        9.49e-05        0.654   TTTTGTGATCAAGATCAGGATA
  528. 1       gi|6626252|gb|L42023.1| 1798205 1798226 -       -9.0625 9.54e-05        0.654   TTTCGCCATTATCATCGCGACC
  529. 1       gi|6626252|gb|L42023.1| 6756    6777    +       -9.0625 9.54e-05        0.654   TTGTGTCATTAACATCTTAAAA
  530. 1       gi|6626252|gb|L42023.1| 1129437 1129458 +       -9.0625 9.54e-05        0.654   ATTTGCGATACTTATAACTGGT
  531. 1       gi|6626252|gb|L42023.1| 884121  884142  +       -9.07292        9.57e-05        0.654   ATTTGCAATAGATTGCGCAACA
  532. 1       gi|6626252|gb|L42023.1| 1644620 1644641 +       -9.07292        9.57e-05        0.654   ATGCGCGCTTGATAGCGCAAAA
  533. 1       gi|6626252|gb|L42023.1| 1166772 1166793 -       -9.09375        9.61e-05        0.654   CCTTGCAATCTAGTTCGCTATA
  534. 1       gi|6626252|gb|L42023.1| 343392  343413  +       -9.09375        9.61e-05        0.654   TTTTGCCACCCATTTAGTAAAT
  535. 1       gi|6626252|gb|L42023.1| 1686589 1686610 +       -9.09375        9.61e-05        0.654   CTTTACGACAAACTTTGCCAAA
  536. 1       gi|6626252|gb|L42023.1| 252256  252277  -       -9.10417        9.63e-05        0.654   TTTTACGTACTTCATCTTTAAA
  537. 1       gi|6626252|gb|L42023.1| 450453  450474  +       -9.10417        9.63e-05        0.654   TTATCAGATTTAGATCGCACTA
  538. 1       gi|6626252|gb|L42023.1| 1044794 1044815 +       -9.11458        9.66e-05        0.654   TTTAGCGACAGACATTGTTGAA
  539. 1       gi|6626252|gb|L42023.1| 1014297 1014318 -       -9.125  9.68e-05        0.654   ATTGACAAACTGCATCTCAAGA
  540. 1       gi|6626252|gb|L42023.1| 1289993 1290014 -       -9.125  9.68e-05        0.654   CTTCACGATTTCTATCACGAAA
  541. 1       gi|6626252|gb|L42023.1| 1711563 1711584 +       -9.125  9.68e-05        0.654   CTTCACGATTTCTATCACGAAA
  542. 1       gi|6626252|gb|L42023.1| 554195  554216  -       -9.15625        9.75e-05        0.655   TTTTGCGTGACGTTTTGCAAGT
  543. 1       gi|6626252|gb|L42023.1| 475107  475128  +       -9.15625        9.75e-05        0.655   CATTACGATATTCATCCACCAT
  544. 1       gi|6626252|gb|L42023.1| 604652  604673  +       -9.15625        9.75e-05        0.655   TTTTGGTTTCTATATCATAAAT
  545. 1       gi|6626252|gb|L42023.1| 562118  562139  -       -9.16667        9.78e-05        0.655   TTGTGCGAACTGGATTGGCAAC
  546. 1       gi|6626252|gb|L42023.1| 731931  731952  -       -9.16667        9.78e-05        0.655   TATTGCTAAAGGCATAGCAAGT
  547. 1       gi|6626252|gb|L42023.1| 1039184 1039205 -       -9.17708        9.8e-05 0.655   ATTCACTATATAAATCGCTAAC
  548. 1       gi|6626252|gb|L42023.1| 143184  143205  +       -9.20833        9.87e-05        0.656   TTTTTCGCTTTAGAACGGGAAA
  549. 1       gi|6626252|gb|L42023.1| 1404436 1404457 +       -9.20833        9.87e-05        0.656   CGTGCCGATTCTGAACGAAAAA
  550. 1       gi|6626252|gb|L42023.1| 224128  224149  -       -9.21875        9.89e-05        0.656   TATTGGCATCATCAGCGAAGAA
  551. 1       gi|6626252|gb|L42023.1| 1000619 1000640 -       -9.23958        9.94e-05        0.656   TTTTGCGATATTTAACGGTTTA
  552. 1       gi|6626252|gb|L42023.1| 102375  102396  +       -9.23958        9.94e-05        0.656   ATAAATGATCTGCACCCCAAAA
  553. 1       gi|6626252|gb|L42023.1| 639020  639041  +       -9.23958        9.94e-05        0.656   TTAAGCCAGCTTGATCGCGAAA
  554. 1       gi|6626252|gb|L42023.1| 1751573 1751594 +       -9.23958        9.94e-05        0.656   GTTGGCGATCTACACACTAAAC
  555. 1       gi|6626252|gb|L42023.1| 1095852 1095873 -       -9.26042        9.99e-05        0.658   TTTTACGCTATGGATTTAATAG
RAW Paste Data
Top