SHARE
TWEET

Untitled

a guest Nov 15th, 2019 89 Never
Not a member of Pastebin yet? Sign Up, it unlocks many cool features!
  1. Primer3 Output
  2.  
  3. WARNING: Numbers in input sequence were deleted.
  4.  
  5. Using mispriming library humrep_and_simple.txt
  6. Using 1-based sequence positions
  7. OLIGO            start  len      tm     gc%   any    3'   rep seq
  8. LEFT PRIMER       1549   20   59.13   50.00  3.00  1.00 10.00 tcaggttacggacaaggtga
  9. RIGHT PRIMER      1851   20   59.84   45.00  5.00  3.00 11.00 aaaccacccaatttgtctgc
  10. SEQUENCE SIZE: 2129
  11. INCLUDED REGION SIZE: 2129
  12.  
  13. PRODUCT SIZE: 303, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 3.00
  14.  
  15.     1 atgaaaaagataaaaattgttccacttattttaatagttgtagttgtcgggtttggtata
  16.                                                                  
  17.  
  18.    61 tatttttatgcttcaaaagataaagaaattaataatactattgatgcaattgaagataaa
  19.                                                                  
  20.  
  21.   121 aatttcaaacaagtttataaagatagcagttatatttctaaaagcgataatggtgaagta
  22.                                                                  
  23.  
  24.   181 gaaatgactgaacgtccgataaaaatatataatagtttaggcgttaaagatataaacatt
  25.                                                                  
  26.  
  27.   241 caggatcgtaaaataaaaaaagtatctaaaaataaaaaacgagtagatgctcaatataaa
  28.                                                                  
  29.  
  30.   301 attaaaacaaactacggtaacattgatcgcaacgttcaatttaattttgttaaagaagat
  31.                                                                  
  32.  
  33.   361 ggtatgtggaagttagattgggatcatagcgtcattattccaggaatgcagaaagaccaa
  34.                                                                  
  35.  
  36.   421 agcatacatattgaaaatttaaaatcagaacgtggtaaaattttagaccgaaacaatgtg
  37.                                                                  
  38.  
  39.   481 gaattggccaatacaggaacagcatatgagataggcatcgttccaaagaatgtatctaaa
  40.                                                                  
  41.  
  42.   541 aaagattataaagcaatcgctaaagaactaagtatttctgaagactatatcaaacaacaa
  43.                                                                  
  44.  
  45.   601 atggatcaaaattgggtacaagatgataccttcgttccacttaaaaccgttaaaaaaatg
  46.                                                                  
  47.  
  48.   661 gatgaatatttaagtgatttcgcaaaaaaatttcatcttacaactaatgaaacaaaaagt
  49.                                                                  
  50.  
  51.   721 cgtaactatcctctagaaaaagcgacttcacatctattaggttatgttggtcccattaac
  52.                                                                  
  53.  
  54.   781 tctgaagaattaaaacaaaaagaatataaaggctataaagatgatgcagttattggtaaa
  55.                                                                  
  56.  
  57.   841 aagggactcgaaaaactttacgataaaaagctccaacatgaagatggctatcgtgtcaca
  58.                                                                  
  59.  
  60.   901 atcgttgacgataatagcaatacaatcgcacatacattaatagagaaaaagaaaaaagat
  61.                                                                  
  62.  
  63.   961 ggcaaagatattcaactaactattgatgctaaagttcaaaagagtatttataacaacatg
  64.                                                                  
  65.  
  66.  1021 aaaaatgattatggctcaggtactgctatccaccctcaaacaggtgaattattagcactt
  67.                                                                  
  68.  
  69.  1081 gtaagcacaccttcatatgacgtctatccatttatgtatggcatgagtaacgaagaatat
  70.                                                                  
  71.  
  72.  1141 aataaattaaccgaagataaaaaagaacctctgctcaacaagttccagattacaacttca
  73.                                                                  
  74.  
  75.  1201 ccaggttcaactcaaaaaatattaacagcaatgattgggttaaataacaaaacattagac
  76.                                                                  
  77.  
  78.  1261 gataaaacaagttataaaatcgatggtaaaggttggcaaaaagataaatcttggggtggt
  79.                                                                  
  80.  
  81.  1321 tacaacgttacaagatatgaagtggtaaatggtaatatcgacttaaaacaagcaatagaa
  82.                                                                  
  83.  
  84.  1381 tcatcagataacattttctttgctagagtagcactcgaattaggcagtaagaaatttgaa
  85.                                                                  
  86.  
  87.  1441 aaaggcatgaaaaaactaggtgttggtgaagatataccaagtgattatccattttataat
  88.                                                                  
  89.  
  90.  1501 gctcaaatttcaaacaaaaatttagataatgaaatattattagctgattcaggttacgga
  91.                                                       >>>>>>>>>>>>
  92.  
  93.  1561 caaggtgaaatactgattaacccagtacagatcctttcaatctatagcgcattagaaaat
  94.       >>>>>>>>                                                    
  95.  
  96.  1621 aatggcaatattaacgcacctcacttattaaaagacacgaaaaacaaagtttggaagaaa
  97.                                                                  
  98.  
  99.  1681 aatattatttccaaagaaaatatcaatctattaactgatggtatgcaacaagtcgtaaat
  100.                                                                  
  101.  
  102.  1741 aaaacacataaagaagatatttatagatcttatgcaaacttaattggcaaatccggtact
  103.                                                                  
  104.  
  105.  1801 gcagaactcaaaatgaaacaaggagaaactggcagacaaattgggtggtttatatcatat
  106.                                      <<<<<<<<<<<<<<<<<<<<        
  107.  
  108.  1861 gataaagataatccaaacatgatgatggctattaatgttaaagatgtacaagataaagga
  109.                                                                  
  110.  
  111.  1921 atggctagctacaatgccaaaatctcaggtaaagtgtatgatgagctatatgagaacggt
  112.                                                                  
  113.  
  114.  1981 aataaaaaatacgatatagatgaataacaaaacagtgaagcaatccgtaacgatggttgc
  115.                                                                  
  116.  
  117.  2041 ttcactgttttattatgaattattaataagtgctgttacttctcccttaaatacaatttc
  118.                                                                  
  119.  
  120.  2101 ttcattttcattgtatgttgaaagtgaca
  121.                                    
  122.  
  123. KEYS (in order of precedence):
  124. >>>>>> left primer
  125. <<<<<< right primer
  126.  
  127. ADDITIONAL OLIGOS
  128.                     start  len      tm     gc%   any    3'   rep seq
  129.  
  130.  1 LEFT PRIMER       1545   21   59.98   47.62  5.00  0.00 10.00 tgattcaggttacggacaagg
  131.    RIGHT PRIMER      1845   20   59.97   45.00  5.00  3.00 11.00 cccaatttgtctgccagttt
  132.    PRODUCT SIZE: 301, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 0.00
  133.  
  134.  2 LEFT PRIMER       1543   21   60.13   47.62  7.00  0.00  9.00 gctgattcaggttacggacaa
  135.    RIGHT PRIMER      1845   20   59.97   45.00  5.00  3.00 11.00 cccaatttgtctgccagttt
  136.    PRODUCT SIZE: 303, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 2.00
  137.  
  138.  3 LEFT PRIMER       1550   21   60.02   47.62  3.00  0.00 11.00 caggttacggacaaggtgaaa
  139.    RIGHT PRIMER      1851   20   59.84   45.00  5.00  3.00 11.00 aaaccacccaatttgtctgc
  140.    PRODUCT SIZE: 302, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 1.00
  141.  
  142.  4 LEFT PRIMER       1545   21   59.98   47.62  5.00  0.00 10.00 tgattcaggttacggacaagg
  143.    RIGHT PRIMER      1851   20   59.84   45.00  5.00  3.00 11.00 aaaccacccaatttgtctgc
  144.    PRODUCT SIZE: 307, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 2.00
  145.  
  146. Statistics
  147.          con   too    in    in          no    tm    tm  high  high  high        high      
  148.          sid  many   tar  excl   bad    GC   too   too   any    3'   lib  poly   end      
  149.         ered    Ns   get   reg   GC% clamp   low  high compl compl   sim     X  stab    ok
  150. Left   16643     0     0     0  2226     0  9335  1128     0     1     0   172   111  3670
  151. Right  16706     0     0     0  1748     0  9429  1278     0     3     0   166   109  3973
  152. Pair Stats:
  153. considered 1312, unacceptable product size 1303, high end compl 1, ok 8
  154. primer3 release 1.1.4
  155.  
  156.  
  157. (primer3_results.cgi release 0.4.0)
RAW Paste Data
We use cookies for various purposes including analytics. By continuing to use Pastebin, you agree to our use of cookies as described in the Cookies Policy. OK, I Understand
 
Top