DNA _analyzerV2

import time
import math
import csv
import os


class DNA():
    '''This is a class for DNA sequences and their properties. All that you needed is pandas and an excel or csv sheet
    formatted such that the first column is the sequence name and the second column is the sequence.

    Ex:
    Sequence 1, ATGCGCGATCGATCGATGGACTTAGCAAATCGCT
    Sequence 2, ACTACTACTCGCATGCATACGGACGACTGACTG
    ...

    Calculations are taken from http://biotools.nubic.northwestern.edu/OligoCalc.html#helpbasic'''

    def __init__(self,name,sequence):
        #   Basic sequence information
        self.name = name
        self.sequence = sequence
        self.baselength = len(sequence)

        #   Count the number of the respective nucleotides
        self.num_As = sequence.count('A')
        self.num_Ts = sequence.count('T')
        self.num_Gs = sequence.count('G')
        self.num_Cs = sequence.count('C')

        #   Basic Salt information units = M
        self.sodium = 0.050
        self.magnesium = 0

    def GC_content(self):
        '''Simple percentage of G and C out of total sequence'''
        gc = ((self.num_Cs + self.num_Gs) / self.baselength)*100
        return int(gc)


    def AnHydro_MolWeight(self):
        '''Calculation: (Anhydrous Molecular Weight = (An x 313.21) + (Tn x 304.2) + (Cn x 289.18) + (Gn x 329.21) - 61.96)
        Taken from http://biotools.nubic.northwestern.edu/OligoCalc.html#helpbasic'''
        mol = (self.num_As * 313.21) + (self.num_Ts * 304.2) + (self.num_Cs * 289.18) + (self.num_Gs * 329.21) - 61.96
        return int(mol)

    def Melting_Temp(self):
        '''Calculation: (Tm= 100.5 + (41 * (yG+zC)/(wA+xT+yG+zC)) - (820/(wA+xT+yG+zC)) + 16.6*log10([Na+]))
        Taken from http://biotools.nubic.northwestern.edu/OligoCalc.html#helpbasic'''
        tm = Tm= 100.5 + (41 * (self.num_Gs+self.num_Cs)/(self.num_As+self.num_Ts+self.num_Gs+self.num_Cs)) - (820/(self.num_As+self.num_Ts+self.num_Gs+self.num_Cs)) + 16.6*math.log10(self.sodium)
        return int(tm)

    def Estimate_Ext_Coeff(self):
        '''Calculation: (E260 = ( (nA × 15.4) + (nC × 7.4) + (nG × 11.5) + (nT × 8.7) ) × 0.9 × 1000)
        Taken from https://www.atdbio.com/content/1/Ultraviolet-absorbance-of-oligonucleotides#Calculation-of-extinction-coefficient'''
        e = ((self.num_As * 15.4) + (self.num_Cs * 7.4) + (self.num_Gs * 11.5) + (self.num_Ts * 8.7)) * 0.9 * 1000
        return int(e)

class Optical():
    '''Next is a class made for calculating concentration from absorbance'''

    def __init__(self,absorbance, extinction):
        self.Abs = absorbance
        self.path = 1   #   path is either 1 or 0.3 cm from mm
        self.ext_coeff = extinction
        self.dilution =  100

    def Concentration(self):
        conc = ((((self.Abs)/(self.path*self.ext_coeff))*self.dilution)/1E-6)
        return conc

#   name the infile
print('Please make sure the sequence file is in the (' + os.getcwd() + ') directory')
file =  'dna_seq.csv' #input('Please enter sequence file name:')
salt = 0.05 #input('Please enter sodium concentration in M units (so 50 mM would be entered as 0.050):')
start = time.time()

#   name the outfile
export_file = 'data.csv'

#   Create csv reader and writers
with open(export_file, 'w') as data_file:
    with open(file, 'r') as csv_file:
        reader = csv.reader(csv_file)
        header = ['Name',
                  'Sequence',
                  'Number As',
                  'Number Ts',
                  'Number Gs',
                  'Number Cs',
                  'Length',
                  'GC Content (%)',
                  'Formula Weight (g/mol)',
                  'Melting Temp Na Adjusted (C)',
                  'Estimate Extinction (M-1 cm-1)'
                  ]

        writer = csv.DictWriter(data_file, fieldnames=header)
        writer.writeheader()
        next(reader)
        sequence_counter = 0
        #   call DNA class and define salt based on input
        for rows in reader:
            sequence_counter += 1
            dna = DNA(rows[0], rows[1])
            dna.sodium = float(salt)

            #   Create key:value pairs for the different properties calculated
            data = {header[0]: dna.name,
                    header[1]: dna.sequence,
                    header[2]: dna.num_As,
                    header[3]: dna.num_Ts,
                    header[4]: dna.num_Gs,
                    header[5]: dna.num_Cs,
                    header[6]: dna.baselength,
                    header[7]: dna.GC_content(),
                    header[8]: dna.AnHydro_MolWeight(),
                    header[9]: dna.Melting_Temp(),
                    header[10]: dna.Estimate_Ext_Coeff()
                    }
            writer.writerow(data)

#   Print the file name and the PATH
print('--Results saved as:(' + export_file + ') --In path:(' + os.getcwd() + ')')
print('*Beware any files with the name ' + export_file + ' will be overwritten*')
seconds = time.time() - start
print('Code took %f seconds to run' % (seconds))
print('%i sequences were processed'%(sequence_counter))
input('Hit enter to exit.')