#!/usr/bin/env nextflow

// INPUT_FOLDER = "data/fastq_small"
// REFERENCE = "data/cuc_reference.fasta"
// PREFIX = "NLSOCC"
// NLSOCC18-1459-A02_S2_L001_R2_001.fastq.gz
params.reads = "$baseDir/data/fastq_small/*_R{1,2}_001.fastq.gz"
params.genome = "$baseDir/data/cuc_reference.fasta"


genome_file = file(params.genome)
/*
 * Create the `read_pairs` channel that emits tuples containing three elements:
 * the pair ID, the first read-pair file and the second read-pair file
 */
Channel
    .fromFilePairs( params.reads )
    .ifEmpty { error "Cannot find any reads matching: ${params.reads}" }
.set { read_pairs }

/*
 * Step 1. Builds the genome index required by the mapping process
 */
process buildIndex {
    publishDir 'results'
    tag "$genome_file.baseName"


    input:
    file genome from genome_file

    output:
    file genome_file.fileName + ".*" into genome_index

    """
    bwa index ${genome} -p ${genome_file.fileName}
    """
}

/*
 * Step 2. Maps each read-pair by using BWA
 */
 process mapping {
    tag "$pair_id"
    publishDir 'results'

    input:
    file genome from genome_file
    file index from genome_index
    set pair_id, file(reads) from read_pairs

    output:
    set pair_id, "*.bam" into bam

    """
    bwa mem ${genome.fileName} ${reads[0]} ${reads[1]} | samtools view -b -q 20 > ${pair_id}.bam
    """
}



// process trim_reads {
//   publishDir 'results'

//   tag "sampleId"
//   input:
//     set sampleId, file(reads) from read_pairs
//   output:
//     set sampleId, file '*.fastq.gz' into trimmed
//   script:
//   """
//     echo cutadapt -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -A AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG -q 20 -m 50 -o $sampleid"_R1.fastq.gz" -p $sampleid"_R2.fastq.gz" ${reads[0]} ${reads[1]}
//   """
// }

// process map_reads {
//   publishDir 'results'
//   input:
//     set sampleId, file(reads) from trimmed
//   output:
//     file "*.bam" into mapped
//   script:
//   """
//     echo bowtie2 $reads > $sampleId".aligned.bam"
//   """
// }