Advertisement
Not a member of Pastebin yet?
Sign Up,
it unlocks many cool features!
- <?xml version="1.0"?>
- <Bioseq-set>
- <Bioseq-set_seq-set>
- <Seq-entry>
- <Seq-entry_seq>
- <Bioseq>
- <Bioseq_id>
- <Seq-id>
- <Seq-id_general>
- <Dbtag>
- <Dbtag_db>dbGSS</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>20893449</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Seq-id_general>
- </Seq-id>
- <Seq-id>
- <Seq-id_genbank>
- <Textseq-id>
- <Textseq-id_accession>ER870415</Textseq-id_accession>
- <Textseq-id_version>1</Textseq-id_version>
- </Textseq-id>
- </Seq-id_genbank>
- </Seq-id>
- <Seq-id>
- <Seq-id_gi>148466254</Seq-id_gi>
- </Seq-id>
- </Bioseq_id>
- <Bioseq_descr>
- <Seq-descr>
- <Seqdesc>
- <Seqdesc_molinfo>
- <MolInfo>
- <MolInfo_biomol value="genomic">1</MolInfo_biomol>
- <MolInfo_tech value="survey">4</MolInfo_tech>
- </MolInfo>
- </Seqdesc_molinfo>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_title>POTLD51TR Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY103_I06.</Seqdesc_title>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_create-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2007</Date-std_year>
- <Date-std_month>5</Date-std_month>
- <Date-std_day>30</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_create-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_update-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- <Date-std_month>6</Date-std_month>
- <Date-std_day>18</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_update-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_comment>Other_GSSs: POTLD51TF~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: CAGGAAACAGCTATGACC~Class: BAC ends</Seqdesc_comment>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_source>
- <BioSource>
- <BioSource_org>
- <Org-ref>
- <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
- <Org-ref_common>potato</Org-ref_common>
- <Org-ref_db>
- <Dbtag>
- <Dbtag_db>taxon</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>4113</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Org-ref_db>
- <Org-ref_orgname>
- <OrgName>
- <OrgName_name>
- <OrgName_name_binomial>
- <BinomialOrgName>
- <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
- <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
- </BinomialOrgName>
- </OrgName_name_binomial>
- </OrgName_name>
- <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
- <OrgName_gcode>1</OrgName_gcode>
- <OrgName_mgcode>1</OrgName_mgcode>
- <OrgName_div>PLN</OrgName_div>
- </OrgName>
- </Org-ref_orgname>
- </Org-ref>
- </BioSource_org>
- <BioSource_subtype>
- <SubSource>
- <SubSource_subtype value="clone">3</SubSource_subtype>
- <SubSource_name>RHPOTKEY103_I06</SubSource_name>
- </SubSource>
- <SubSource>
- <SubSource_subtype value="clone-lib">11</SubSource_subtype>
- <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
- </SubSource>
- </BioSource_subtype>
- </BioSource>
- </Seqdesc_source>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_pub>
- <Pubdesc>
- <Pubdesc_pub>
- <Pub-equiv>
- <Pub>
- <Pub_pmid>
- <PubMedId>18554403</PubMedId>
- </Pub_pmid>
- </Pub>
- <Pub>
- <Pub_article>
- <Cit-art>
- <Cit-art_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-art_title>
- <Cit-art_authors>
- <Auth-list>
- <Auth-list_names>
- <Auth-list_names_std>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Zhu</Name-std_last>
- <Name-std_initials>W.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Ouyang</Name-std_last>
- <Name-std_initials>S.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Iovene</Name-std_last>
- <Name-std_initials>M.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>O'Brien</Name-std_last>
- <Name-std_initials>K.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Vuong</Name-std_last>
- <Name-std_initials>H.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Jiang</Name-std_last>
- <Name-std_initials>J.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Buell</Name-std_last>
- <Name-std_initials>C.R.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- </Auth-list_names_std>
- </Auth-list_names>
- </Auth-list>
- </Cit-art_authors>
- <Cit-art_from>
- <Cit-art_from_journal>
- <Cit-jour>
- <Cit-jour_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-jour_title>
- <Cit-jour_imp>
- <Imprint>
- <Imprint_date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- </Date-std>
- </Date_std>
- </Date>
- </Imprint_date>
- <Imprint_volume>9</Imprint_volume>
- <Imprint_issue>1</Imprint_issue>
- <Imprint_pages>286</Imprint_pages>
- </Imprint>
- </Cit-jour_imp>
- </Cit-jour>
- </Cit-art_from_journal>
- </Cit-art_from>
- </Cit-art>
- </Pub_article>
- </Pub>
- </Pub-equiv>
- </Pubdesc_pub>
- </Pubdesc>
- </Seqdesc_pub>
- </Seqdesc>
- </Seq-descr>
- </Bioseq_descr>
- <Bioseq_inst>
- <Seq-inst>
- <Seq-inst_repr value="raw"/>
- <Seq-inst_mol value="dna"/>
- <Seq-inst_length>603</Seq-inst_length>
- <Seq-inst_strand value="ds"/>
- <Seq-inst_seq-data>
- <Seq-data>
- <Seq-data_iupacna>
- <IUPACna>GGAGTTTATGCCCAAGTTCTACTATATAATAAATATAATATGTAATATTGAAGAAACTTCCTTTTAAAAGTCCCACAAGAATATTATATATTATATTTGGGCCTAAACTCTCTTTTATAATATAGTAGAATAGAAAGTAGAATAGAATAGAATATTATAAACTACTATATTATAAAAGAGAGTTTACGGCCAAATATAATATAGTAGAATATATAGATAGAATATTATAAAAGAGAGTTTAGGGCCAAATCTTGAATATTATATATTATATATTATATTTGGCCCTAAACTCTCTCTTATAATATAGTAATAAATAGTAGATTTAGAAACAATGGAAAGTACATATAATAAGAGTATAATGCTGGTAAATGAACAAAATCATATGGTACACAACTAGTAGATAAAAGACTATTTACTTAAACTCTAGGGAGTAGGGGTGTGCATTCGGTTTTTCGGTTTGGTTTTACACTATTCGGTTTGGGTTTTCGGTTTTTGGTTTTGTAAAAGTGTAACCCAATCCGATCCAAAATAAATTTGTTTTGATTTGGTTTTCCTCTATTCGATTCGGTTTTTTTCGATTTGATTATTCGGTTATGTCAATAA</IUPACna>
- </Seq-data_iupacna>
- </Seq-data>
- </Seq-inst_seq-data>
- </Seq-inst>
- </Bioseq_inst>
- </Bioseq>
- </Seq-entry_seq>
- </Seq-entry>
- <Seq-entry>
- <Seq-entry_seq>
- <Bioseq>
- <Bioseq_id>
- <Seq-id>
- <Seq-id_general>
- <Dbtag>
- <Dbtag_db>dbGSS</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>20893448</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Seq-id_general>
- </Seq-id>
- <Seq-id>
- <Seq-id_genbank>
- <Textseq-id>
- <Textseq-id_accession>ER870414</Textseq-id_accession>
- <Textseq-id_version>1</Textseq-id_version>
- </Textseq-id>
- </Seq-id_genbank>
- </Seq-id>
- <Seq-id>
- <Seq-id_gi>148466253</Seq-id_gi>
- </Seq-id>
- </Bioseq_id>
- <Bioseq_descr>
- <Seq-descr>
- <Seqdesc>
- <Seqdesc_molinfo>
- <MolInfo>
- <MolInfo_biomol value="genomic">1</MolInfo_biomol>
- <MolInfo_tech value="survey">4</MolInfo_tech>
- </MolInfo>
- </Seqdesc_molinfo>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_title>PPTH947TF Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY184_G22.</Seqdesc_title>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_create-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2007</Date-std_year>
- <Date-std_month>5</Date-std_month>
- <Date-std_day>30</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_create-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_update-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- <Date-std_month>6</Date-std_month>
- <Date-std_day>18</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_update-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_comment>Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: TGTAAAACGACGGCCAGT~Class: BAC ends</Seqdesc_comment>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_source>
- <BioSource>
- <BioSource_org>
- <Org-ref>
- <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
- <Org-ref_common>potato</Org-ref_common>
- <Org-ref_db>
- <Dbtag>
- <Dbtag_db>taxon</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>4113</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Org-ref_db>
- <Org-ref_orgname>
- <OrgName>
- <OrgName_name>
- <OrgName_name_binomial>
- <BinomialOrgName>
- <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
- <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
- </BinomialOrgName>
- </OrgName_name_binomial>
- </OrgName_name>
- <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
- <OrgName_gcode>1</OrgName_gcode>
- <OrgName_mgcode>1</OrgName_mgcode>
- <OrgName_div>PLN</OrgName_div>
- </OrgName>
- </Org-ref_orgname>
- </Org-ref>
- </BioSource_org>
- <BioSource_subtype>
- <SubSource>
- <SubSource_subtype value="clone">3</SubSource_subtype>
- <SubSource_name>RHPOTKEY184_G22</SubSource_name>
- </SubSource>
- <SubSource>
- <SubSource_subtype value="clone-lib">11</SubSource_subtype>
- <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
- </SubSource>
- </BioSource_subtype>
- </BioSource>
- </Seqdesc_source>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_pub>
- <Pubdesc>
- <Pubdesc_pub>
- <Pub-equiv>
- <Pub>
- <Pub_pmid>
- <PubMedId>18554403</PubMedId>
- </Pub_pmid>
- </Pub>
- <Pub>
- <Pub_article>
- <Cit-art>
- <Cit-art_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-art_title>
- <Cit-art_authors>
- <Auth-list>
- <Auth-list_names>
- <Auth-list_names_std>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Zhu</Name-std_last>
- <Name-std_initials>W.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Ouyang</Name-std_last>
- <Name-std_initials>S.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Iovene</Name-std_last>
- <Name-std_initials>M.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>O'Brien</Name-std_last>
- <Name-std_initials>K.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Vuong</Name-std_last>
- <Name-std_initials>H.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Jiang</Name-std_last>
- <Name-std_initials>J.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Buell</Name-std_last>
- <Name-std_initials>C.R.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- </Auth-list_names_std>
- </Auth-list_names>
- </Auth-list>
- </Cit-art_authors>
- <Cit-art_from>
- <Cit-art_from_journal>
- <Cit-jour>
- <Cit-jour_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-jour_title>
- <Cit-jour_imp>
- <Imprint>
- <Imprint_date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- </Date-std>
- </Date_std>
- </Date>
- </Imprint_date>
- <Imprint_volume>9</Imprint_volume>
- <Imprint_issue>1</Imprint_issue>
- <Imprint_pages>286</Imprint_pages>
- </Imprint>
- </Cit-jour_imp>
- </Cit-jour>
- </Cit-art_from_journal>
- </Cit-art_from>
- </Cit-art>
- </Pub_article>
- </Pub>
- </Pub-equiv>
- </Pubdesc_pub>
- </Pubdesc>
- </Seqdesc_pub>
- </Seqdesc>
- </Seq-descr>
- </Bioseq_descr>
- <Bioseq_inst>
- <Seq-inst>
- <Seq-inst_repr value="raw"/>
- <Seq-inst_mol value="dna"/>
- <Seq-inst_length>374</Seq-inst_length>
- <Seq-inst_strand value="ds"/>
- <Seq-inst_seq-data>
- <Seq-data>
- <Seq-data_iupacna>
- <IUPACna>GGATTTACTGCATTTGGCCATTTGACTATATTTGCTCTTAAGAGCAGTGTCACCTGCTCTATCATTGCGCAAATTTTTGAGATTTAGCGCAAACGTGGGCTACTCAGAATTCACCCAATAAATTGAACCATACGCAACCACGACCCAATGAGATTTCATTAAAAAGCACAAAAATTACGGGCATTCGACAATTAAACAATACGGGAAAGATTTTTGAATTTAAATAGGCATGTAATCATTCTAATCCTATCATAGAGGCCCAACACACATCACTAAGAGACAATCATTGTAAATGAGTACAAAAACATTCAAATGTAAAAGTGTGAAAAGGAAACCAACCTTCAATGTTGATTAAATTCGATTTGAAAATCTAG</IUPACna>
- </Seq-data_iupacna>
- </Seq-data>
- </Seq-inst_seq-data>
- </Seq-inst>
- </Bioseq_inst>
- </Bioseq>
- </Seq-entry_seq>
- </Seq-entry>
- <Seq-entry>
- <Seq-entry_seq>
- <Bioseq>
- <Bioseq_id>
- <Seq-id>
- <Seq-id_general>
- <Dbtag>
- <Dbtag_db>dbGSS</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>20893447</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Seq-id_general>
- </Seq-id>
- <Seq-id>
- <Seq-id_genbank>
- <Textseq-id>
- <Textseq-id_accession>ER870413</Textseq-id_accession>
- <Textseq-id_version>1</Textseq-id_version>
- </Textseq-id>
- </Seq-id_genbank>
- </Seq-id>
- <Seq-id>
- <Seq-id_gi>148466252</Seq-id_gi>
- </Seq-id>
- </Bioseq_id>
- <Bioseq_descr>
- <Seq-descr>
- <Seqdesc>
- <Seqdesc_molinfo>
- <MolInfo>
- <MolInfo_biomol value="genomic">1</MolInfo_biomol>
- <MolInfo_tech value="survey">4</MolInfo_tech>
- </MolInfo>
- </Seqdesc_molinfo>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_title>POTJR43TF Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY088_H14.</Seqdesc_title>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_create-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2007</Date-std_year>
- <Date-std_month>5</Date-std_month>
- <Date-std_day>30</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_create-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_update-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- <Date-std_month>6</Date-std_month>
- <Date-std_day>18</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_update-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_comment>Other_GSSs: POTJR43TR~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: TGTAAAACGACGGCCAGT~Class: BAC ends</Seqdesc_comment>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_source>
- <BioSource>
- <BioSource_org>
- <Org-ref>
- <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
- <Org-ref_common>potato</Org-ref_common>
- <Org-ref_db>
- <Dbtag>
- <Dbtag_db>taxon</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>4113</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Org-ref_db>
- <Org-ref_orgname>
- <OrgName>
- <OrgName_name>
- <OrgName_name_binomial>
- <BinomialOrgName>
- <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
- <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
- </BinomialOrgName>
- </OrgName_name_binomial>
- </OrgName_name>
- <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
- <OrgName_gcode>1</OrgName_gcode>
- <OrgName_mgcode>1</OrgName_mgcode>
- <OrgName_div>PLN</OrgName_div>
- </OrgName>
- </Org-ref_orgname>
- </Org-ref>
- </BioSource_org>
- <BioSource_subtype>
- <SubSource>
- <SubSource_subtype value="clone">3</SubSource_subtype>
- <SubSource_name>RHPOTKEY088_H14</SubSource_name>
- </SubSource>
- <SubSource>
- <SubSource_subtype value="clone-lib">11</SubSource_subtype>
- <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
- </SubSource>
- </BioSource_subtype>
- </BioSource>
- </Seqdesc_source>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_pub>
- <Pubdesc>
- <Pubdesc_pub>
- <Pub-equiv>
- <Pub>
- <Pub_pmid>
- <PubMedId>18554403</PubMedId>
- </Pub_pmid>
- </Pub>
- <Pub>
- <Pub_article>
- <Cit-art>
- <Cit-art_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-art_title>
- <Cit-art_authors>
- <Auth-list>
- <Auth-list_names>
- <Auth-list_names_std>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Zhu</Name-std_last>
- <Name-std_initials>W.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Ouyang</Name-std_last>
- <Name-std_initials>S.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Iovene</Name-std_last>
- <Name-std_initials>M.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>O'Brien</Name-std_last>
- <Name-std_initials>K.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Vuong</Name-std_last>
- <Name-std_initials>H.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Jiang</Name-std_last>
- <Name-std_initials>J.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Buell</Name-std_last>
- <Name-std_initials>C.R.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- </Auth-list_names_std>
- </Auth-list_names>
- </Auth-list>
- </Cit-art_authors>
- <Cit-art_from>
- <Cit-art_from_journal>
- <Cit-jour>
- <Cit-jour_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-jour_title>
- <Cit-jour_imp>
- <Imprint>
- <Imprint_date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- </Date-std>
- </Date_std>
- </Date>
- </Imprint_date>
- <Imprint_volume>9</Imprint_volume>
- <Imprint_issue>1</Imprint_issue>
- <Imprint_pages>286</Imprint_pages>
- </Imprint>
- </Cit-jour_imp>
- </Cit-jour>
- </Cit-art_from_journal>
- </Cit-art_from>
- </Cit-art>
- </Pub_article>
- </Pub>
- </Pub-equiv>
- </Pubdesc_pub>
- </Pubdesc>
- </Seqdesc_pub>
- </Seqdesc>
- </Seq-descr>
- </Bioseq_descr>
- <Bioseq_inst>
- <Seq-inst>
- <Seq-inst_repr value="raw"/>
- <Seq-inst_mol value="dna"/>
- <Seq-inst_length>192</Seq-inst_length>
- <Seq-inst_strand value="ds"/>
- <Seq-inst_seq-data>
- <Seq-data>
- <Seq-data_iupacna>
- <IUPACna>AAGGTGGTTGCTACATATGCGGCGGACCGCACGGCTATGCAAAGTGCCCTGAACTGAAGAGCCTTGGTGCTATCCTGCGAGAACGGAAGGAGAAAGACGCACAGGAGAAAGGACAAGGCGCAGAGACAACACAGTTGGGCTTGATAGGGCTATGCGGAGCAATCACCAAGCAGCCAGAGAAGCCAAGAGGAT</IUPACna>
- </Seq-data_iupacna>
- </Seq-data>
- </Seq-inst_seq-data>
- </Seq-inst>
- </Bioseq_inst>
- </Bioseq>
- </Seq-entry_seq>
- </Seq-entry>
- <Seq-entry>
- <Seq-entry_seq>
- <Bioseq>
- <Bioseq_id>
- <Seq-id>
- <Seq-id_general>
- <Dbtag>
- <Dbtag_db>dbGSS</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>20893446</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Seq-id_general>
- </Seq-id>
- <Seq-id>
- <Seq-id_genbank>
- <Textseq-id>
- <Textseq-id_accession>ER870412</Textseq-id_accession>
- <Textseq-id_version>1</Textseq-id_version>
- </Textseq-id>
- </Seq-id_genbank>
- </Seq-id>
- <Seq-id>
- <Seq-id_gi>148466251</Seq-id_gi>
- </Seq-id>
- </Bioseq_id>
- <Bioseq_descr>
- <Seq-descr>
- <Seqdesc>
- <Seqdesc_molinfo>
- <MolInfo>
- <MolInfo_biomol value="genomic">1</MolInfo_biomol>
- <MolInfo_tech value="survey">4</MolInfo_tech>
- </MolInfo>
- </Seqdesc_molinfo>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_title>PPTH371TR Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY182_L22.</Seqdesc_title>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_create-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2007</Date-std_year>
- <Date-std_month>5</Date-std_month>
- <Date-std_day>30</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_create-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_update-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- <Date-std_month>6</Date-std_month>
- <Date-std_day>18</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_update-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_comment>Other_GSSs: PPTH371TF~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: CAGGAAACAGCTATGACC~Class: BAC ends</Seqdesc_comment>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_source>
- <BioSource>
- <BioSource_org>
- <Org-ref>
- <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
- <Org-ref_common>potato</Org-ref_common>
- <Org-ref_db>
- <Dbtag>
- <Dbtag_db>taxon</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>4113</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Org-ref_db>
- <Org-ref_orgname>
- <OrgName>
- <OrgName_name>
- <OrgName_name_binomial>
- <BinomialOrgName>
- <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
- <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
- </BinomialOrgName>
- </OrgName_name_binomial>
- </OrgName_name>
- <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
- <OrgName_gcode>1</OrgName_gcode>
- <OrgName_mgcode>1</OrgName_mgcode>
- <OrgName_div>PLN</OrgName_div>
- </OrgName>
- </Org-ref_orgname>
- </Org-ref>
- </BioSource_org>
- <BioSource_subtype>
- <SubSource>
- <SubSource_subtype value="clone">3</SubSource_subtype>
- <SubSource_name>RHPOTKEY182_L22</SubSource_name>
- </SubSource>
- <SubSource>
- <SubSource_subtype value="clone-lib">11</SubSource_subtype>
- <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
- </SubSource>
- </BioSource_subtype>
- </BioSource>
- </Seqdesc_source>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_pub>
- <Pubdesc>
- <Pubdesc_pub>
- <Pub-equiv>
- <Pub>
- <Pub_pmid>
- <PubMedId>18554403</PubMedId>
- </Pub_pmid>
- </Pub>
- <Pub>
- <Pub_article>
- <Cit-art>
- <Cit-art_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-art_title>
- <Cit-art_authors>
- <Auth-list>
- <Auth-list_names>
- <Auth-list_names_std>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Zhu</Name-std_last>
- <Name-std_initials>W.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Ouyang</Name-std_last>
- <Name-std_initials>S.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Iovene</Name-std_last>
- <Name-std_initials>M.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>O'Brien</Name-std_last>
- <Name-std_initials>K.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Vuong</Name-std_last>
- <Name-std_initials>H.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Jiang</Name-std_last>
- <Name-std_initials>J.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Buell</Name-std_last>
- <Name-std_initials>C.R.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- </Auth-list_names_std>
- </Auth-list_names>
- </Auth-list>
- </Cit-art_authors>
- <Cit-art_from>
- <Cit-art_from_journal>
- <Cit-jour>
- <Cit-jour_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-jour_title>
- <Cit-jour_imp>
- <Imprint>
- <Imprint_date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- </Date-std>
- </Date_std>
- </Date>
- </Imprint_date>
- <Imprint_volume>9</Imprint_volume>
- <Imprint_issue>1</Imprint_issue>
- <Imprint_pages>286</Imprint_pages>
- </Imprint>
- </Cit-jour_imp>
- </Cit-jour>
- </Cit-art_from_journal>
- </Cit-art_from>
- </Cit-art>
- </Pub_article>
- </Pub>
- </Pub-equiv>
- </Pubdesc_pub>
- </Pubdesc>
- </Seqdesc_pub>
- </Seqdesc>
- </Seq-descr>
- </Bioseq_descr>
- <Bioseq_inst>
- <Seq-inst>
- <Seq-inst_repr value="raw"/>
- <Seq-inst_mol value="dna"/>
- <Seq-inst_length>382</Seq-inst_length>
- <Seq-inst_strand value="ds"/>
- <Seq-inst_seq-data>
- <Seq-data>
- <Seq-data_iupacna>
- <IUPACna>TATTCCAGCTAAATTTCATGTTTTCAATGTCAACTTTCTATGTTTTATATGAGTAAACTCAAGTTGGTTTCATTATTTAGAGTTTAAGGGGATCACTCAGAATATCAAGAGAATATGTTTCTAGATTCATACACTGGTTAAAAATTATATGTTTAGATTCATATATGATACGTGTCTAGAGACTCATTATACTTGAAGATTTGAATAAGTAAAATCTTGTAGAACATTGTTATAGGAATAGAACATTTTCTTACTTCATTAGCATAAAAATTGATTACCTATCTAATCGTATGTACTTTAAGACTTTCTATATAAGGAACACCTCTTGTATATTGTTTCTTAATCAAGTCAATGAGAAGTTTTTCCTAATTTAACATGGCCT</IUPACna>
- </Seq-data_iupacna>
- </Seq-data>
- </Seq-inst_seq-data>
- </Seq-inst>
- </Bioseq_inst>
- </Bioseq>
- </Seq-entry_seq>
- </Seq-entry>
- <Seq-entry>
- <Seq-entry_seq>
- <Bioseq>
- <Bioseq_id>
- <Seq-id>
- <Seq-id_general>
- <Dbtag>
- <Dbtag_db>dbGSS</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>20893445</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Seq-id_general>
- </Seq-id>
- <Seq-id>
- <Seq-id_genbank>
- <Textseq-id>
- <Textseq-id_accession>ER870411</Textseq-id_accession>
- <Textseq-id_version>1</Textseq-id_version>
- </Textseq-id>
- </Seq-id_genbank>
- </Seq-id>
- <Seq-id>
- <Seq-id_gi>148466250</Seq-id_gi>
- </Seq-id>
- </Bioseq_id>
- <Bioseq_descr>
- <Seq-descr>
- <Seqdesc>
- <Seqdesc_molinfo>
- <MolInfo>
- <MolInfo_biomol value="genomic">1</MolInfo_biomol>
- <MolInfo_tech value="survey">4</MolInfo_tech>
- </MolInfo>
- </Seqdesc_molinfo>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_title>PPTHM74TF Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY187_N03.</Seqdesc_title>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_create-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2007</Date-std_year>
- <Date-std_month>5</Date-std_month>
- <Date-std_day>30</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_create-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_update-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- <Date-std_month>6</Date-std_month>
- <Date-std_day>18</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_update-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_comment>Other_GSSs: PPTHM74TR~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: TGTAAAACGACGGCCAGT~Class: BAC ends</Seqdesc_comment>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_source>
- <BioSource>
- <BioSource_org>
- <Org-ref>
- <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
- <Org-ref_common>potato</Org-ref_common>
- <Org-ref_db>
- <Dbtag>
- <Dbtag_db>taxon</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>4113</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Org-ref_db>
- <Org-ref_orgname>
- <OrgName>
- <OrgName_name>
- <OrgName_name_binomial>
- <BinomialOrgName>
- <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
- <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
- </BinomialOrgName>
- </OrgName_name_binomial>
- </OrgName_name>
- <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
- <OrgName_gcode>1</OrgName_gcode>
- <OrgName_mgcode>1</OrgName_mgcode>
- <OrgName_div>PLN</OrgName_div>
- </OrgName>
- </Org-ref_orgname>
- </Org-ref>
- </BioSource_org>
- <BioSource_subtype>
- <SubSource>
- <SubSource_subtype value="clone">3</SubSource_subtype>
- <SubSource_name>RHPOTKEY187_N03</SubSource_name>
- </SubSource>
- <SubSource>
- <SubSource_subtype value="clone-lib">11</SubSource_subtype>
- <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
- </SubSource>
- </BioSource_subtype>
- </BioSource>
- </Seqdesc_source>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_pub>
- <Pubdesc>
- <Pubdesc_pub>
- <Pub-equiv>
- <Pub>
- <Pub_pmid>
- <PubMedId>18554403</PubMedId>
- </Pub_pmid>
- </Pub>
- <Pub>
- <Pub_article>
- <Cit-art>
- <Cit-art_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-art_title>
- <Cit-art_authors>
- <Auth-list>
- <Auth-list_names>
- <Auth-list_names_std>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Zhu</Name-std_last>
- <Name-std_initials>W.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Ouyang</Name-std_last>
- <Name-std_initials>S.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Iovene</Name-std_last>
- <Name-std_initials>M.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>O'Brien</Name-std_last>
- <Name-std_initials>K.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Vuong</Name-std_last>
- <Name-std_initials>H.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Jiang</Name-std_last>
- <Name-std_initials>J.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Buell</Name-std_last>
- <Name-std_initials>C.R.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- </Auth-list_names_std>
- </Auth-list_names>
- </Auth-list>
- </Cit-art_authors>
- <Cit-art_from>
- <Cit-art_from_journal>
- <Cit-jour>
- <Cit-jour_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-jour_title>
- <Cit-jour_imp>
- <Imprint>
- <Imprint_date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- </Date-std>
- </Date_std>
- </Date>
- </Imprint_date>
- <Imprint_volume>9</Imprint_volume>
- <Imprint_issue>1</Imprint_issue>
- <Imprint_pages>286</Imprint_pages>
- </Imprint>
- </Cit-jour_imp>
- </Cit-jour>
- </Cit-art_from_journal>
- </Cit-art_from>
- </Cit-art>
- </Pub_article>
- </Pub>
- </Pub-equiv>
- </Pubdesc_pub>
- </Pubdesc>
- </Seqdesc_pub>
- </Seqdesc>
- </Seq-descr>
- </Bioseq_descr>
- <Bioseq_inst>
- <Seq-inst>
- <Seq-inst_repr value="raw"/>
- <Seq-inst_mol value="dna"/>
- <Seq-inst_length>227</Seq-inst_length>
- <Seq-inst_strand value="ds"/>
- <Seq-inst_seq-data>
- <Seq-data>
- <Seq-data_iupacna>
- <IUPACna>CCAGATATTTGAGATCTTTCTCTTTGAATAAGATCTCAATTCCAGCGACGGTTTCATTAGATATCTTACAACTAGAATCCCTCTTTTTTCCGATCCAGTTCCTCCACCAACGCGAACCCCAGTTAGATTCAGGCATGCTACACTTTTTAGTTATTGGGAGAACCCAAGTACTCTCTTTCGGATTCAGGAAACAACTCTCAGAGATCTTTTTTCCTTTGGGAAGATAC</IUPACna>
- </Seq-data_iupacna>
- </Seq-data>
- </Seq-inst_seq-data>
- </Seq-inst>
- </Bioseq_inst>
- </Bioseq>
- </Seq-entry_seq>
- </Seq-entry>
- <Seq-entry>
- <Seq-entry_seq>
- <Bioseq>
- <Bioseq_id>
- <Seq-id>
- <Seq-id_general>
- <Dbtag>
- <Dbtag_db>dbGSS</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>20893444</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Seq-id_general>
- </Seq-id>
- <Seq-id>
- <Seq-id_genbank>
- <Textseq-id>
- <Textseq-id_accession>ER870410</Textseq-id_accession>
- <Textseq-id_version>1</Textseq-id_version>
- </Textseq-id>
- </Seq-id_genbank>
- </Seq-id>
- <Seq-id>
- <Seq-id_gi>148466249</Seq-id_gi>
- </Seq-id>
- </Bioseq_id>
- <Bioseq_descr>
- <Seq-descr>
- <Seqdesc>
- <Seqdesc_molinfo>
- <MolInfo>
- <MolInfo_biomol value="genomic">1</MolInfo_biomol>
- <MolInfo_tech value="survey">4</MolInfo_tech>
- </MolInfo>
- </Seqdesc_molinfo>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_title>PPTHX08TR Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY190_A16.</Seqdesc_title>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_create-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2007</Date-std_year>
- <Date-std_month>5</Date-std_month>
- <Date-std_day>30</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_create-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_update-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- <Date-std_month>6</Date-std_month>
- <Date-std_day>18</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_update-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_comment>Other_GSSs: PPTHX08TF~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: CAGGAAACAGCTATGACC~Class: BAC ends</Seqdesc_comment>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_source>
- <BioSource>
- <BioSource_org>
- <Org-ref>
- <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
- <Org-ref_common>potato</Org-ref_common>
- <Org-ref_db>
- <Dbtag>
- <Dbtag_db>taxon</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>4113</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Org-ref_db>
- <Org-ref_orgname>
- <OrgName>
- <OrgName_name>
- <OrgName_name_binomial>
- <BinomialOrgName>
- <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
- <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
- </BinomialOrgName>
- </OrgName_name_binomial>
- </OrgName_name>
- <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
- <OrgName_gcode>1</OrgName_gcode>
- <OrgName_mgcode>1</OrgName_mgcode>
- <OrgName_div>PLN</OrgName_div>
- </OrgName>
- </Org-ref_orgname>
- </Org-ref>
- </BioSource_org>
- <BioSource_subtype>
- <SubSource>
- <SubSource_subtype value="clone">3</SubSource_subtype>
- <SubSource_name>RHPOTKEY190_A16</SubSource_name>
- </SubSource>
- <SubSource>
- <SubSource_subtype value="clone-lib">11</SubSource_subtype>
- <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
- </SubSource>
- </BioSource_subtype>
- </BioSource>
- </Seqdesc_source>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_pub>
- <Pubdesc>
- <Pubdesc_pub>
- <Pub-equiv>
- <Pub>
- <Pub_pmid>
- <PubMedId>18554403</PubMedId>
- </Pub_pmid>
- </Pub>
- <Pub>
- <Pub_article>
- <Cit-art>
- <Cit-art_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-art_title>
- <Cit-art_authors>
- <Auth-list>
- <Auth-list_names>
- <Auth-list_names_std>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Zhu</Name-std_last>
- <Name-std_initials>W.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Ouyang</Name-std_last>
- <Name-std_initials>S.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Iovene</Name-std_last>
- <Name-std_initials>M.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>O'Brien</Name-std_last>
- <Name-std_initials>K.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Vuong</Name-std_last>
- <Name-std_initials>H.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Jiang</Name-std_last>
- <Name-std_initials>J.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Buell</Name-std_last>
- <Name-std_initials>C.R.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- </Auth-list_names_std>
- </Auth-list_names>
- </Auth-list>
- </Cit-art_authors>
- <Cit-art_from>
- <Cit-art_from_journal>
- <Cit-jour>
- <Cit-jour_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-jour_title>
- <Cit-jour_imp>
- <Imprint>
- <Imprint_date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- </Date-std>
- </Date_std>
- </Date>
- </Imprint_date>
- <Imprint_volume>9</Imprint_volume>
- <Imprint_issue>1</Imprint_issue>
- <Imprint_pages>286</Imprint_pages>
- </Imprint>
- </Cit-jour_imp>
- </Cit-jour>
- </Cit-art_from_journal>
- </Cit-art_from>
- </Cit-art>
- </Pub_article>
- </Pub>
- </Pub-equiv>
- </Pubdesc_pub>
- </Pubdesc>
- </Seqdesc_pub>
- </Seqdesc>
- </Seq-descr>
- </Bioseq_descr>
- <Bioseq_inst>
- <Seq-inst>
- <Seq-inst_repr value="raw"/>
- <Seq-inst_mol value="dna"/>
- <Seq-inst_length>728</Seq-inst_length>
- <Seq-inst_strand value="ds"/>
- <Seq-inst_seq-data>
- <Seq-data>
- <Seq-data_iupacna>
- <IUPACna>TTATTTGATGTTATTTGGTAGTAACAATAAAATATATTTTTTGTAAAATATTTTTGCACCAAAAGGGAAAAAAACTTCATTCACTTGTGAGCAAAAAATATTTTCTTGCTGGTATTTAAGCTTTCTTGAATATTGATATCTTTTTATGAGGAAATGACTTTGATATTTTATTTTGTTTAATGTTTATAGACGGATCCGAAAAAGATAAAATTGTTAAGGAAGTGATTGAGGCAATTGATCCTGAGGAGAAATCGATCACTTGGAAGGTAATTGGAGGAGATTTGCTAGAGTTGTATGATTCTCTTACTATTATCACAGCATGCGAACATGAGTGGACTACATGTTCATTTATATATGAGAAAAAAACTGAAGACACCCCAGAACCTCTTGTTCCATTTGGTTTCCTCCTTAATTTGATCAAGGAAATGGAGGGTCATCTTCTCAAATAATACAAGATCAATCTGGTATCTGATAGTTCTTATCGTTACGTATTTGTGTATGTCTACGTGAACACGCGTGTGAATTTATGAATATATATATATATATATGTGTGTGTGTGAGAGAGAGAGAGAGAGAGAGTTTGTGTTACAAATATATACTATATATGTGTGTGTGTGTGTGAAGTTTGTGTTACAAATATATACTATATTTTGTAATATTGGCTAATTCTAGCTAGTGTGTCAAAATTAGTAATGTTGTGTTAAAAATAAAGAATATATCGGATGTAT</IUPACna>
- </Seq-data_iupacna>
- </Seq-data>
- </Seq-inst_seq-data>
- </Seq-inst>
- </Bioseq_inst>
- </Bioseq>
- </Seq-entry_seq>
- </Seq-entry>
- <Seq-entry>
- <Seq-entry_seq>
- <Bioseq>
- <Bioseq_id>
- <Seq-id>
- <Seq-id_general>
- <Dbtag>
- <Dbtag_db>dbGSS</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>20893443</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Seq-id_general>
- </Seq-id>
- <Seq-id>
- <Seq-id_genbank>
- <Textseq-id>
- <Textseq-id_accession>ER870409</Textseq-id_accession>
- <Textseq-id_version>1</Textseq-id_version>
- </Textseq-id>
- </Seq-id_genbank>
- </Seq-id>
- <Seq-id>
- <Seq-id_gi>148466248</Seq-id_gi>
- </Seq-id>
- </Bioseq_id>
- <Bioseq_descr>
- <Seq-descr>
- <Seqdesc>
- <Seqdesc_molinfo>
- <MolInfo>
- <MolInfo_biomol value="genomic">1</MolInfo_biomol>
- <MolInfo_tech value="survey">4</MolInfo_tech>
- </MolInfo>
- </Seqdesc_molinfo>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_title>PPTJ884TF Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY202_M23.</Seqdesc_title>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_create-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2007</Date-std_year>
- <Date-std_month>5</Date-std_month>
- <Date-std_day>30</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_create-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_update-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- <Date-std_month>6</Date-std_month>
- <Date-std_day>18</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_update-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_comment>Other_GSSs: PPTJ884TR~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: TGTAAAACGACGGCCAGT~Class: BAC ends</Seqdesc_comment>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_source>
- <BioSource>
- <BioSource_org>
- <Org-ref>
- <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
- <Org-ref_common>potato</Org-ref_common>
- <Org-ref_db>
- <Dbtag>
- <Dbtag_db>taxon</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>4113</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Org-ref_db>
- <Org-ref_orgname>
- <OrgName>
- <OrgName_name>
- <OrgName_name_binomial>
- <BinomialOrgName>
- <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
- <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
- </BinomialOrgName>
- </OrgName_name_binomial>
- </OrgName_name>
- <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
- <OrgName_gcode>1</OrgName_gcode>
- <OrgName_mgcode>1</OrgName_mgcode>
- <OrgName_div>PLN</OrgName_div>
- </OrgName>
- </Org-ref_orgname>
- </Org-ref>
- </BioSource_org>
- <BioSource_subtype>
- <SubSource>
- <SubSource_subtype value="clone">3</SubSource_subtype>
- <SubSource_name>RHPOTKEY202_M23</SubSource_name>
- </SubSource>
- <SubSource>
- <SubSource_subtype value="clone-lib">11</SubSource_subtype>
- <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
- </SubSource>
- </BioSource_subtype>
- </BioSource>
- </Seqdesc_source>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_pub>
- <Pubdesc>
- <Pubdesc_pub>
- <Pub-equiv>
- <Pub>
- <Pub_pmid>
- <PubMedId>18554403</PubMedId>
- </Pub_pmid>
- </Pub>
- <Pub>
- <Pub_article>
- <Cit-art>
- <Cit-art_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-art_title>
- <Cit-art_authors>
- <Auth-list>
- <Auth-list_names>
- <Auth-list_names_std>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Zhu</Name-std_last>
- <Name-std_initials>W.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Ouyang</Name-std_last>
- <Name-std_initials>S.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Iovene</Name-std_last>
- <Name-std_initials>M.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>O'Brien</Name-std_last>
- <Name-std_initials>K.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Vuong</Name-std_last>
- <Name-std_initials>H.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Jiang</Name-std_last>
- <Name-std_initials>J.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Buell</Name-std_last>
- <Name-std_initials>C.R.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- </Auth-list_names_std>
- </Auth-list_names>
- </Auth-list>
- </Cit-art_authors>
- <Cit-art_from>
- <Cit-art_from_journal>
- <Cit-jour>
- <Cit-jour_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-jour_title>
- <Cit-jour_imp>
- <Imprint>
- <Imprint_date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- </Date-std>
- </Date_std>
- </Date>
- </Imprint_date>
- <Imprint_volume>9</Imprint_volume>
- <Imprint_issue>1</Imprint_issue>
- <Imprint_pages>286</Imprint_pages>
- </Imprint>
- </Cit-jour_imp>
- </Cit-jour>
- </Cit-art_from_journal>
- </Cit-art_from>
- </Cit-art>
- </Pub_article>
- </Pub>
- </Pub-equiv>
- </Pubdesc_pub>
- </Pubdesc>
- </Seqdesc_pub>
- </Seqdesc>
- </Seq-descr>
- </Bioseq_descr>
- <Bioseq_inst>
- <Seq-inst>
- <Seq-inst_repr value="raw"/>
- <Seq-inst_mol value="dna"/>
- <Seq-inst_length>286</Seq-inst_length>
- <Seq-inst_strand value="ds"/>
- <Seq-inst_seq-data>
- <Seq-data>
- <Seq-data_iupacna>
- <IUPACna>TTGAAGAAGTAAGGTTCTTGAAGAACAAATTGTAGAATTCTTGTTGGTTGAGTTGTTGATGCTTGGGGGTGAGTTGATTCATGTTTTCGAGTTGCTTTTCGTGTTAGATTGGTTGTATATTGAGGGTACAATTGATCCTAAGTGTTTGGGGAAGGAACTATGGAAGTTAGGGAGGTTTAGAGAGGAAGAACGGAAGAGAAAAGTCAGAAGTCGCTGGGCAAAAGGGCTGGGGCTCCGCGCCTGCCACAACGCCACAAAAACTTCTCTGAAGTTTGGCCTTTGGCGT</IUPACna>
- </Seq-data_iupacna>
- </Seq-data>
- </Seq-inst_seq-data>
- </Seq-inst>
- </Bioseq_inst>
- </Bioseq>
- </Seq-entry_seq>
- </Seq-entry>
- <Seq-entry>
- <Seq-entry_seq>
- <Bioseq>
- <Bioseq_id>
- <Seq-id>
- <Seq-id_general>
- <Dbtag>
- <Dbtag_db>dbGSS</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>20893442</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Seq-id_general>
- </Seq-id>
- <Seq-id>
- <Seq-id_genbank>
- <Textseq-id>
- <Textseq-id_accession>ER870408</Textseq-id_accession>
- <Textseq-id_version>1</Textseq-id_version>
- </Textseq-id>
- </Seq-id_genbank>
- </Seq-id>
- <Seq-id>
- <Seq-id_gi>148466247</Seq-id_gi>
- </Seq-id>
- </Bioseq_id>
- <Bioseq_descr>
- <Seq-descr>
- <Seqdesc>
- <Seqdesc_molinfo>
- <MolInfo>
- <MolInfo_biomol value="genomic">1</MolInfo_biomol>
- <MolInfo_tech value="survey">4</MolInfo_tech>
- </MolInfo>
- </Seqdesc_molinfo>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_title>POTN776TF Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY119_N08.</Seqdesc_title>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_create-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2007</Date-std_year>
- <Date-std_month>5</Date-std_month>
- <Date-std_day>30</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_create-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_update-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- <Date-std_month>6</Date-std_month>
- <Date-std_day>18</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_update-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_comment>Other_GSSs: POTN776TR~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: TGTAAAACGACGGCCAGT~Class: BAC ends</Seqdesc_comment>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_source>
- <BioSource>
- <BioSource_org>
- <Org-ref>
- <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
- <Org-ref_common>potato</Org-ref_common>
- <Org-ref_db>
- <Dbtag>
- <Dbtag_db>taxon</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>4113</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Org-ref_db>
- <Org-ref_orgname>
- <OrgName>
- <OrgName_name>
- <OrgName_name_binomial>
- <BinomialOrgName>
- <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
- <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
- </BinomialOrgName>
- </OrgName_name_binomial>
- </OrgName_name>
- <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
- <OrgName_gcode>1</OrgName_gcode>
- <OrgName_mgcode>1</OrgName_mgcode>
- <OrgName_div>PLN</OrgName_div>
- </OrgName>
- </Org-ref_orgname>
- </Org-ref>
- </BioSource_org>
- <BioSource_subtype>
- <SubSource>
- <SubSource_subtype value="clone">3</SubSource_subtype>
- <SubSource_name>RHPOTKEY119_N08</SubSource_name>
- </SubSource>
- <SubSource>
- <SubSource_subtype value="clone-lib">11</SubSource_subtype>
- <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
- </SubSource>
- </BioSource_subtype>
- </BioSource>
- </Seqdesc_source>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_pub>
- <Pubdesc>
- <Pubdesc_pub>
- <Pub-equiv>
- <Pub>
- <Pub_pmid>
- <PubMedId>18554403</PubMedId>
- </Pub_pmid>
- </Pub>
- <Pub>
- <Pub_article>
- <Cit-art>
- <Cit-art_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-art_title>
- <Cit-art_authors>
- <Auth-list>
- <Auth-list_names>
- <Auth-list_names_std>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Zhu</Name-std_last>
- <Name-std_initials>W.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Ouyang</Name-std_last>
- <Name-std_initials>S.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Iovene</Name-std_last>
- <Name-std_initials>M.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>O'Brien</Name-std_last>
- <Name-std_initials>K.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Vuong</Name-std_last>
- <Name-std_initials>H.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Jiang</Name-std_last>
- <Name-std_initials>J.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Buell</Name-std_last>
- <Name-std_initials>C.R.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- </Auth-list_names_std>
- </Auth-list_names>
- </Auth-list>
- </Cit-art_authors>
- <Cit-art_from>
- <Cit-art_from_journal>
- <Cit-jour>
- <Cit-jour_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-jour_title>
- <Cit-jour_imp>
- <Imprint>
- <Imprint_date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- </Date-std>
- </Date_std>
- </Date>
- </Imprint_date>
- <Imprint_volume>9</Imprint_volume>
- <Imprint_issue>1</Imprint_issue>
- <Imprint_pages>286</Imprint_pages>
- </Imprint>
- </Cit-jour_imp>
- </Cit-jour>
- </Cit-art_from_journal>
- </Cit-art_from>
- </Cit-art>
- </Pub_article>
- </Pub>
- </Pub-equiv>
- </Pubdesc_pub>
- </Pubdesc>
- </Seqdesc_pub>
- </Seqdesc>
- </Seq-descr>
- </Bioseq_descr>
- <Bioseq_inst>
- <Seq-inst>
- <Seq-inst_repr value="raw"/>
- <Seq-inst_mol value="dna"/>
- <Seq-inst_length>798</Seq-inst_length>
- <Seq-inst_strand value="ds"/>
- <Seq-inst_seq-data>
- <Seq-data>
- <Seq-data_iupacna>
- <IUPACna>AATTTCCTATATAAAGTGTTGCATGACCATGCCCGGTCCGGGGGAAAAGAACCGGACAACCATGTGAGAGGTTTATATCTCACCACCTAGGATGCTTGGGGTGTGACCAACATCAACCATGTGAGAGGTTTATATCTCACCACCTAGGATGCTTGGGGTGTGACCAACATCAACCATGTGAGAGGTTTATATCTCACCACCTAGGATGCTTGGGGTGTGACCAACATCAACCATGTGAGAGGTTTATATCTCACCACCTAGGATGCTTGGGGTGTGACCAACATCAACCATGTGAGGGGTTTATACCTTGCCACCAGGGTGTCCGGGTGTGAACGGCATCCCCCATCCTAAGTTGGGGTTATAGATTGGTTGGATCATGCATACACATATGATATCTACTATTAGTATAAAGTTACTTAAACATGTTTTGACTTCACTTTGATCATGCATCCTCATATTGTTATTCATAATGCCTATGAAACTATTTCTTGTATTTCGATTGTGTCCTTGTCTATTGTTGTGTTGCACCCCGCATACTTAGTACATTCCAAGTACTAACGCATATTTTGCCTACATGATGTCACCATGTAGGGACCGGAGTTACTCTTGATCCTTCTCTTCATTCACGTGGCTAGTACGGTGCTTATCCGAGTTGTTGGTGAGTCCTCAATGATTCGAGGGCAATGTTATGTTTCCTACTCCTATGTTTTGAGACTTTAGCTTGCAATTGTATTTTGACTATGAGGGGAGCCGGTAGAATGTCATGGCCCCGTCCTATCTATGTATGTAGAGGTGTGC</IUPACna>
- </Seq-data_iupacna>
- </Seq-data>
- </Seq-inst_seq-data>
- </Seq-inst>
- </Bioseq_inst>
- </Bioseq>
- </Seq-entry_seq>
- </Seq-entry>
- <Seq-entry>
- <Seq-entry_seq>
- <Bioseq>
- <Bioseq_id>
- <Seq-id>
- <Seq-id_general>
- <Dbtag>
- <Dbtag_db>dbGSS</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>20893441</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Seq-id_general>
- </Seq-id>
- <Seq-id>
- <Seq-id_genbank>
- <Textseq-id>
- <Textseq-id_accession>ER870407</Textseq-id_accession>
- <Textseq-id_version>1</Textseq-id_version>
- </Textseq-id>
- </Seq-id_genbank>
- </Seq-id>
- <Seq-id>
- <Seq-id_gi>148466246</Seq-id_gi>
- </Seq-id>
- </Bioseq_id>
- <Bioseq_descr>
- <Seq-descr>
- <Seqdesc>
- <Seqdesc_molinfo>
- <MolInfo>
- <MolInfo_biomol value="genomic">1</MolInfo_biomol>
- <MolInfo_tech value="survey">4</MolInfo_tech>
- </MolInfo>
- </Seqdesc_molinfo>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_title>PPTFO31TR Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY170_E13.</Seqdesc_title>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_create-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2007</Date-std_year>
- <Date-std_month>5</Date-std_month>
- <Date-std_day>30</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_create-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_update-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- <Date-std_month>6</Date-std_month>
- <Date-std_day>18</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_update-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_comment>Other_GSSs: PPTFO31TF~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: CAGGAAACAGCTATGACC~Class: BAC ends</Seqdesc_comment>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_source>
- <BioSource>
- <BioSource_org>
- <Org-ref>
- <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
- <Org-ref_common>potato</Org-ref_common>
- <Org-ref_db>
- <Dbtag>
- <Dbtag_db>taxon</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>4113</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Org-ref_db>
- <Org-ref_orgname>
- <OrgName>
- <OrgName_name>
- <OrgName_name_binomial>
- <BinomialOrgName>
- <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
- <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
- </BinomialOrgName>
- </OrgName_name_binomial>
- </OrgName_name>
- <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
- <OrgName_gcode>1</OrgName_gcode>
- <OrgName_mgcode>1</OrgName_mgcode>
- <OrgName_div>PLN</OrgName_div>
- </OrgName>
- </Org-ref_orgname>
- </Org-ref>
- </BioSource_org>
- <BioSource_subtype>
- <SubSource>
- <SubSource_subtype value="clone">3</SubSource_subtype>
- <SubSource_name>RHPOTKEY170_E13</SubSource_name>
- </SubSource>
- <SubSource>
- <SubSource_subtype value="clone-lib">11</SubSource_subtype>
- <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
- </SubSource>
- </BioSource_subtype>
- </BioSource>
- </Seqdesc_source>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_pub>
- <Pubdesc>
- <Pubdesc_pub>
- <Pub-equiv>
- <Pub>
- <Pub_pmid>
- <PubMedId>18554403</PubMedId>
- </Pub_pmid>
- </Pub>
- <Pub>
- <Pub_article>
- <Cit-art>
- <Cit-art_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-art_title>
- <Cit-art_authors>
- <Auth-list>
- <Auth-list_names>
- <Auth-list_names_std>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Zhu</Name-std_last>
- <Name-std_initials>W.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Ouyang</Name-std_last>
- <Name-std_initials>S.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Iovene</Name-std_last>
- <Name-std_initials>M.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>O'Brien</Name-std_last>
- <Name-std_initials>K.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Vuong</Name-std_last>
- <Name-std_initials>H.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Jiang</Name-std_last>
- <Name-std_initials>J.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Buell</Name-std_last>
- <Name-std_initials>C.R.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- </Auth-list_names_std>
- </Auth-list_names>
- </Auth-list>
- </Cit-art_authors>
- <Cit-art_from>
- <Cit-art_from_journal>
- <Cit-jour>
- <Cit-jour_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-jour_title>
- <Cit-jour_imp>
- <Imprint>
- <Imprint_date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- </Date-std>
- </Date_std>
- </Date>
- </Imprint_date>
- <Imprint_volume>9</Imprint_volume>
- <Imprint_issue>1</Imprint_issue>
- <Imprint_pages>286</Imprint_pages>
- </Imprint>
- </Cit-jour_imp>
- </Cit-jour>
- </Cit-art_from_journal>
- </Cit-art_from>
- </Cit-art>
- </Pub_article>
- </Pub>
- </Pub-equiv>
- </Pubdesc_pub>
- </Pubdesc>
- </Seqdesc_pub>
- </Seqdesc>
- </Seq-descr>
- </Bioseq_descr>
- <Bioseq_inst>
- <Seq-inst>
- <Seq-inst_repr value="raw"/>
- <Seq-inst_mol value="dna"/>
- <Seq-inst_length>742</Seq-inst_length>
- <Seq-inst_strand value="ds"/>
- <Seq-inst_seq-data>
- <Seq-data>
- <Seq-data_iupacna>
- <IUPACna>ATACATGAGAGTAACATACCCCGGTGTTAAAGATGCAAGAGATGAGAGAATTTGAGAGAAAATAAGCCATAGGTCGTACAAGATGAATTTTATATTGACCCATCGTCTTAACTTAATAAATAGAGAATTTTAAAATCTAGACTCTTAAAAAATTTCTTGGCGCGGTGCGCCCATGCTACAGGCTACTAAAAAAATAGCCTAGCGTGGTGCGCCCATGCTACCAGGCACGCAGAGCAAACGGTCAATTTGACATCTCTCTAGTAAAATGCAGATAACTTTTTACTCAAGAGTTGGGTAGATGAGCGATCAGTGACATTGGAAGGAACAAATGTAGACCTTTAATTTGATAAGTCACGGGTCATCTAAATTTTACTACTCTAAGAGGCATGATCGGTTGAAGTTGACCCTTGTATGAACTCATGTGAAAATATAGCTGATAGAAATGCTTTGAACTTGGTTTGGTGTTTAAGGTTCCTTACGACCCTAAACCATATATGATATACTTACTATAGTTTGTAAAGGACCTTAACATATATGCACAACTTAGTACTATTCATCGGGTTCGGACCTATACACATACAGAGGATGATTTGAATCTTTGCTTAGAAGTTTTTGGACGTTACGTAGATTGTCCCACATTTTTTTGGGTACTCAAAGAATTGTGACAGAAAATGGAAAACACTTCAATTATTGGCCGAAAGCAAATGAAGAGTCCTTTGACATTTCTTGATGTTACACATGT</IUPACna>
- </Seq-data_iupacna>
- </Seq-data>
- </Seq-inst_seq-data>
- </Seq-inst>
- </Bioseq_inst>
- </Bioseq>
- </Seq-entry_seq>
- </Seq-entry>
- <Seq-entry>
- <Seq-entry_seq>
- <Bioseq>
- <Bioseq_id>
- <Seq-id>
- <Seq-id_general>
- <Dbtag>
- <Dbtag_db>dbGSS</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>20893440</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Seq-id_general>
- </Seq-id>
- <Seq-id>
- <Seq-id_genbank>
- <Textseq-id>
- <Textseq-id_accession>ER870406</Textseq-id_accession>
- <Textseq-id_version>1</Textseq-id_version>
- </Textseq-id>
- </Seq-id_genbank>
- </Seq-id>
- <Seq-id>
- <Seq-id_gi>148466245</Seq-id_gi>
- </Seq-id>
- </Bioseq_id>
- <Bioseq_descr>
- <Seq-descr>
- <Seqdesc>
- <Seqdesc_molinfo>
- <MolInfo>
- <MolInfo_biomol value="genomic">1</MolInfo_biomol>
- <MolInfo_tech value="survey">4</MolInfo_tech>
- </MolInfo>
- </Seqdesc_molinfo>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_title>PPTGD37TR Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY176_G02.</Seqdesc_title>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_create-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2007</Date-std_year>
- <Date-std_month>5</Date-std_month>
- <Date-std_day>30</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_create-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_update-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- <Date-std_month>6</Date-std_month>
- <Date-std_day>18</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_update-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_comment>Other_GSSs: PPTGD37TF~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: CAGGAAACAGCTATGACC~Class: BAC ends</Seqdesc_comment>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_source>
- <BioSource>
- <BioSource_org>
- <Org-ref>
- <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
- <Org-ref_common>potato</Org-ref_common>
- <Org-ref_db>
- <Dbtag>
- <Dbtag_db>taxon</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>4113</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Org-ref_db>
- <Org-ref_orgname>
- <OrgName>
- <OrgName_name>
- <OrgName_name_binomial>
- <BinomialOrgName>
- <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
- <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
- </BinomialOrgName>
- </OrgName_name_binomial>
- </OrgName_name>
- <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
- <OrgName_gcode>1</OrgName_gcode>
- <OrgName_mgcode>1</OrgName_mgcode>
- <OrgName_div>PLN</OrgName_div>
- </OrgName>
- </Org-ref_orgname>
- </Org-ref>
- </BioSource_org>
- <BioSource_subtype>
- <SubSource>
- <SubSource_subtype value="clone">3</SubSource_subtype>
- <SubSource_name>RHPOTKEY176_G02</SubSource_name>
- </SubSource>
- <SubSource>
- <SubSource_subtype value="clone-lib">11</SubSource_subtype>
- <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
- </SubSource>
- </BioSource_subtype>
- </BioSource>
- </Seqdesc_source>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_pub>
- <Pubdesc>
- <Pubdesc_pub>
- <Pub-equiv>
- <Pub>
- <Pub_pmid>
- <PubMedId>18554403</PubMedId>
- </Pub_pmid>
- </Pub>
- <Pub>
- <Pub_article>
- <Cit-art>
- <Cit-art_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-art_title>
- <Cit-art_authors>
- <Auth-list>
- <Auth-list_names>
- <Auth-list_names_std>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Zhu</Name-std_last>
- <Name-std_initials>W.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Ouyang</Name-std_last>
- <Name-std_initials>S.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Iovene</Name-std_last>
- <Name-std_initials>M.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>O'Brien</Name-std_last>
- <Name-std_initials>K.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Vuong</Name-std_last>
- <Name-std_initials>H.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Jiang</Name-std_last>
- <Name-std_initials>J.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Buell</Name-std_last>
- <Name-std_initials>C.R.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- </Auth-list_names_std>
- </Auth-list_names>
- </Auth-list>
- </Cit-art_authors>
- <Cit-art_from>
- <Cit-art_from_journal>
- <Cit-jour>
- <Cit-jour_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-jour_title>
- <Cit-jour_imp>
- <Imprint>
- <Imprint_date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- </Date-std>
- </Date_std>
- </Date>
- </Imprint_date>
- <Imprint_volume>9</Imprint_volume>
- <Imprint_issue>1</Imprint_issue>
- <Imprint_pages>286</Imprint_pages>
- </Imprint>
- </Cit-jour_imp>
- </Cit-jour>
- </Cit-art_from_journal>
- </Cit-art_from>
- </Cit-art>
- </Pub_article>
- </Pub>
- </Pub-equiv>
- </Pubdesc_pub>
- </Pubdesc>
- </Seqdesc_pub>
- </Seqdesc>
- </Seq-descr>
- </Bioseq_descr>
- <Bioseq_inst>
- <Seq-inst>
- <Seq-inst_repr value="raw"/>
- <Seq-inst_mol value="dna"/>
- <Seq-inst_length>723</Seq-inst_length>
- <Seq-inst_strand value="ds"/>
- <Seq-inst_seq-data>
- <Seq-data>
- <Seq-data_iupacna>
- <IUPACna>TTATGTAATTATCCGCTCAATATAAGATTTAATACTTCTCATTTTATCTTAAAGATCATAAATTTTAAAAGTAAAAAACTTTTGTTTTAAACTCATGCCTAATTAAAATGCATCACATAAATTAGGATGGAAGAAATCATTTTGAATTTGTTCATTAAAGAAAACGTAGAATTTTAAAACGGAAAAAGACCTAAAATACCCTCGAAGTATTGGAAATTGTACAAAACTATCCTCCATCCATCTATTGGCTCCAAAATGCCCTTGTCATCCACCTTTGGGTCCAAAATTGACAACTTTTTTAACGGTTTTAAATTTAAACTATTTAATTATTTTTTAAATACGTGGCGCTCAACTATTGGTTATAATTTAATTAATTAATATAATTTATAAACCCACAATATTGTTACTCCCCTCCTCTATTTTTCTTTTCTCGACCTACAATTTTATTGTCTTAAAAAAAAAGGTCATGGCGTTGAAAATTTGAAAAACATGTCTTAGATGCCTAAATAGGAGCTGAGAAAATAAGGCATAAAACGCATTCGGCGTAGTGCGATTTATGTATAAATTTCAGTCTCTTCTTATTTATTGTTGAAATTACATTATTACCCCTTCCGTTTAAGTTAAAATTTAACTTTATCGGTGAATTTTCGATTCACCACATTGTTAATCCCCTCCTCTATTTTTCTTTTCTCGACCCACAATTTTATTTTTTGTCTTTTTAAA</IUPACna>
- </Seq-data_iupacna>
- </Seq-data>
- </Seq-inst_seq-data>
- </Seq-inst>
- </Bioseq_inst>
- </Bioseq>
- </Seq-entry_seq>
- </Seq-entry>
- <Seq-entry>
- <Seq-entry_seq>
- <Bioseq>
- <Bioseq_id>
- <Seq-id>
- <Seq-id_general>
- <Dbtag>
- <Dbtag_db>dbGSS</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>20893439</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Seq-id_general>
- </Seq-id>
- <Seq-id>
- <Seq-id_genbank>
- <Textseq-id>
- <Textseq-id_accession>ER870405</Textseq-id_accession>
- <Textseq-id_version>1</Textseq-id_version>
- </Textseq-id>
- </Seq-id_genbank>
- </Seq-id>
- <Seq-id>
- <Seq-id_gi>148466244</Seq-id_gi>
- </Seq-id>
- </Bioseq_id>
- <Bioseq_descr>
- <Seq-descr>
- <Seqdesc>
- <Seqdesc_molinfo>
- <MolInfo>
- <MolInfo_biomol value="genomic">1</MolInfo_biomol>
- <MolInfo_tech value="survey">4</MolInfo_tech>
- </MolInfo>
- </Seqdesc_molinfo>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_title>PPTI520TF Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY192_C16.</Seqdesc_title>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_create-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2007</Date-std_year>
- <Date-std_month>5</Date-std_month>
- <Date-std_day>30</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_create-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_update-date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- <Date-std_month>6</Date-std_month>
- <Date-std_day>18</Date-std_day>
- </Date-std>
- </Date_std>
- </Date>
- </Seqdesc_update-date>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_comment>Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: TGTAAAACGACGGCCAGT~Class: BAC ends</Seqdesc_comment>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_source>
- <BioSource>
- <BioSource_org>
- <Org-ref>
- <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
- <Org-ref_common>potato</Org-ref_common>
- <Org-ref_db>
- <Dbtag>
- <Dbtag_db>taxon</Dbtag_db>
- <Dbtag_tag>
- <Object-id>
- <Object-id_id>4113</Object-id_id>
- </Object-id>
- </Dbtag_tag>
- </Dbtag>
- </Org-ref_db>
- <Org-ref_orgname>
- <OrgName>
- <OrgName_name>
- <OrgName_name_binomial>
- <BinomialOrgName>
- <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
- <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
- </BinomialOrgName>
- </OrgName_name_binomial>
- </OrgName_name>
- <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
- <OrgName_gcode>1</OrgName_gcode>
- <OrgName_mgcode>1</OrgName_mgcode>
- <OrgName_div>PLN</OrgName_div>
- </OrgName>
- </Org-ref_orgname>
- </Org-ref>
- </BioSource_org>
- <BioSource_subtype>
- <SubSource>
- <SubSource_subtype value="clone">3</SubSource_subtype>
- <SubSource_name>RHPOTKEY192_C16</SubSource_name>
- </SubSource>
- <SubSource>
- <SubSource_subtype value="clone-lib">11</SubSource_subtype>
- <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
- </SubSource>
- </BioSource_subtype>
- </BioSource>
- </Seqdesc_source>
- </Seqdesc>
- <Seqdesc>
- <Seqdesc_pub>
- <Pubdesc>
- <Pubdesc_pub>
- <Pub-equiv>
- <Pub>
- <Pub_pmid>
- <PubMedId>18554403</PubMedId>
- </Pub_pmid>
- </Pub>
- <Pub>
- <Pub_article>
- <Cit-art>
- <Cit-art_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-art_title>
- <Cit-art_authors>
- <Auth-list>
- <Auth-list_names>
- <Auth-list_names_std>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Zhu</Name-std_last>
- <Name-std_initials>W.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Ouyang</Name-std_last>
- <Name-std_initials>S.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Iovene</Name-std_last>
- <Name-std_initials>M.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>O'Brien</Name-std_last>
- <Name-std_initials>K.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Vuong</Name-std_last>
- <Name-std_initials>H.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Jiang</Name-std_last>
- <Name-std_initials>J.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- <Author>
- <Author_name>
- <Person-id>
- <Person-id_name>
- <Name-std>
- <Name-std_last>Buell</Name-std_last>
- <Name-std_initials>C.R.</Name-std_initials>
- </Name-std>
- </Person-id_name>
- </Person-id>
- </Author_name>
- </Author>
- </Auth-list_names_std>
- </Auth-list_names>
- </Auth-list>
- </Cit-art_authors>
- <Cit-art_from>
- <Cit-art_from_journal>
- <Cit-jour>
- <Cit-jour_title>
- <Title>
- <Title_E>
- <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
- </Title_E>
- </Title>
- </Cit-jour_title>
- <Cit-jour_imp>
- <Imprint>
- <Imprint_date>
- <Date>
- <Date_std>
- <Date-std>
- <Date-std_year>2008</Date-std_year>
- </Date-std>
- </Date_std>
- </Date>
- </Imprint_date>
- <Imprint_volume>9</Imprint_volume>
- <Imprint_issue>1</Imprint_issue>
- <Imprint_pages>286</Imprint_pages>
- </Imprint>
- </Cit-jour_imp>
- </Cit-jour>
- </Cit-art_from_journal>
- </Cit-art_from>
- </Cit-art>
- </Pub_article>
- </Pub>
- </Pub-equiv>
- </Pubdesc_pub>
- </Pubdesc>
- </Seqdesc_pub>
- </Seqdesc>
- </Seq-descr>
- </Bioseq_descr>
- <Bioseq_inst>
- <Seq-inst>
- <Seq-inst_repr value="raw"/>
- <Seq-inst_mol value="dna"/>
- <Seq-inst_length>479</Seq-inst_length>
- <Seq-inst_strand value="ds"/>
- <Seq-inst_seq-data>
- <Seq-data>
- <Seq-data_iupacna>
- <IUPACna>ATATTTTTTAAAAAAAGATAATTTAATAATAAAGATAATGACTTTTCTTGAAAAATAAAAAATAAATAAAATGATTTTCAAAAAAATAAAAATTTCGGAAGTTATGTTTCAGTCCGTCATCCAACACACTCTATCCCACCCTCACACCCACACCTTTCATATTATTTGCATATATAATTTTATGTAAATATTTTTTACCTATGTACTAAATACTAATAACTAAACCTTAAAATAAATCATTTATTTCTCATCATATCAAACATACCATTAGTTTATATTTCCTTTCATCAGAATTGGGGGATCTTAGTTTGTACACTTTCCAAATCACGTAATTAATTATAGACGATGACATTTCACCATTATTTTAAAGAGTTAATACCTTAAAAAATGGGGAAAGTACACAAATTACTATTCATAAAATTAAATTAATTATCCTGTTTCATCCTTCTTTTTTCAAGCATGAATCAGTATGGCATCAG</IUPACna>
- </Seq-data_iupacna>
- </Seq-data>
- </Seq-inst_seq-data>
- </Seq-inst>
- </Bioseq_inst>
- </Bioseq>
- </Seq-entry_seq>
- </Seq-entry>
- </Bioseq-set_seq-set>
- </Bioseq-set>
Advertisement
Add Comment
Please, Sign In to add comment
Advertisement