5. String operations. This is a short DNA sequence:
ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT
- Write a program that will print out the AT content of this DNA sequence:
(#A+#T) / length.
- Write a program that will print the complement of this sequence. (A=>T;
T=>A, G=>C, C=>G)

8. Indexing and Slicing. This is a short DNA sequence:
ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT
The sequence contains a recognition site for the EcoRI restriction enzyme, which
cuts at the motif G*AATTC (the position of the cut is indicated by an asterisk).
Write a program which will print the two fragments that will be produced when the
DNA sequence is digested with EcoRI and calculate their length.