Not a member of Pastebin yet?
Sign Up,
it unlocks many cool features!
- from Bio.Blast import NCBIWWW
- from Bio.Blast import NCBIXML
- import mysql.connector
- sequence = "CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGGAATAAA"
- print("BLAST")
- result_handle = NCBIWWW.qblast("blastn","nr",sequence)
- print ("geBLAST")
- blast_record = NCBIXML.read(result_handle)
- print (blast_record)
- cnx = mysql.connector.connect(user='owe4_bi1_3',password="blaat1234", host='127.0.0.1', database='owe4_bi1_3')
- cursor = cnx.cursor()
- for alignment in blast_record.alignments:
- for hsp in alignment.hsps:
- print ("Alignment")
- print ("Sequence:", alignment.title)
- print ("Length :", alignment.length)
- print ("e value :", hsp.expect)
- print (hsp.query[0:75])
- print (hsp.match[0:75])
- print (hsp.sbjct[0:75])
- query_insert = "insert into blast_results values ('"+hsp.query[0:75]+"','"+hsp.match[0:75]+"','"+hsp.sbjct+"')"
- print (query_insert)
- cursor.execute (query_insert)
- cursor.execute ("commit")
Advertisement
Add Comment
Please, Sign In to add comment