Volume 492, 1 June 2022, Pages 67-81
Neuroscience
Research Article
Restorative Action of Vitamin D3 on Motor Dysfunction Through Enhancement of Neurotrophins and Antioxidant Expression in the Striatum
Author links open overlay panelS.K.V. Manjari a, Shuvadeep Maity a, R. Poornima a, Suk-Yu Yau b, K. Vaishali a, David Stellwagen c, Pragya Komal a
Show more
Add to Mendeley
Share
Cite
https://doi.org/10.1016/j.neuroscience.2022.03.039
Get rights and content
Highlights
•
VD administration reversed motor impairment and locomotor dysfunction in HD.

•
VD supplementation enhances the mRNA expression of BDNF, NGF and VDR in the striatum of HD mice.

•
VD alleviates anti-oxidative markers (catalase and GpX4) in the striatal brain tissue of HD mice.


Abstract
A number of studies has explored a positive correlation between low levels of serum Vitamin D3 (VD; cholecalciferol) and development of neurodegenerative diseases including Huntington’s disease (HD). In the present study, the prophylactic effect of VD on motor dysfunction was studied in an experimental model of HD. An HD-like syndrome was induced in male C57BL/6 mice through an intraperitoneal injection (i.p) of 3-NP for 3 consecutive doses at 12 h interval of time as described previously (Amende et al. 2005). This study investigated the in-vivo therapeutic potential of VD (500 IU/kg/day) supplementation on movement, motor coordination, motor activity and biochemical changes in this HD model. Mice were divided into four groups: Group I: Control (saline); Group II: 3-NP induced HD (HD); Group III: Vitamin D3 (VD) and Group IV: 3-NP induced + post Vitamin D3 injection (HD + VD). All groups of mice were tested for locomotion, gait analysis and rotarod performances over a span of 30-days. VD administration rescued locomotor dysfunction and neuromuscular impairment in HD mice with no change in gait dynamics. In addition, administration of VD to 3-NP treated mice led to a significant enhancement in the expression of key neurotrophic factors including brain-derived neurotrophic factor (BDNF) and nerve-growth factor (NGF), the Vitamin D receptor (VDR), and antioxidant markers (catalases [Cat] and glutathione peroxidase [GpX4]) in the striatum, suggesting a detoxification effect of VD. Altogether, our results show that VD supplementation induces survival signals, diminishes oxidative stress, and reduces movement and motor dysfunction in HD.

Graphical abstract

Download : Download high-res image (69KB)
Download : Download full-size image

Previous article in issueNext article in issue
Abbreviations
25(OH)VD3Calcidiol3-NP3-nitropropionic acidADAlzheimer’s diseaseBDNFBrain-derived neurotrophic factorCatCatalasescDNAComplementary DNAGpX4Glutathione peroxidasesHDHuntington’s diseaseHRPHorseradish peroxidaseHttHuntingtin genei.pIntraperitonealmHTTmutant Huntingtin proteinMSNMedium spiny neuronsNGFNerve-growth factorPDParkinson’s diseaseROSReactive oxygen speciesRT-PCRReal-Time polymerase chain reactionSOD1Superoxide dismutase 1SOD2Superoxide dismutase 2VDVitamin D3VDRVitamin D receptorANOVAAnalysis of varianceSEMStandard error of the meanGSHGlutathione1-α-25-(OH)2-VD3Calcitriol
Key words
Huntington’s disease (HD)vitamin D3 (VD)3-nitropropionic acid (3-NP)cholecalciferolneurotrophic factorsantioxidants

Introduction
Huntington’s disease (HD) is a progressive neurodegenerative disorder with a prevalence in the range of 1/10,000–1/20,000 in the Caucasian population and 0.4/1,00,000 in Asian populations respectively (Pringsheim et al., 2012, Chel et al., 2013, Baig et al., 2016, Rawlins et al., 2016). Extensive efforts have been made to understand the molecular, cellular, and system-level changes which occur during the progression of disease and their contribution towards striatal atrophy. The selective loss of medium spiny neurons (MSN) is known to be the main causes for motor disorders associated with Huntington’s disease (HD) (Gil and Rego, 2008, Gil-Mohapel, 2012, Lewitus et al., 2014). The loss of γ-amino butyric acid (GABA) signaling from the MSNs causes circuit dysfunction, which results in involuntary movements, postural instability, lack of coordination, and cognitive and psychiatric impairments (Gil and Rego, 2008). HD is a monogenic, autosomal dominant disorder caused by expansion of a trinucleotide CAG sequence (encoding glutamine) in the first exon of the huntingtin (Htt) gene, located on chromosome 4, with an inverse correlation between repeat length and age of onset of symptoms (Gil and Rego, 2008, Gil-Mohapel, 2012, Blumenstock and Dudanova, 2020). The polyglutamine expansion in huntingtin protein (HTT) causes mitochondrial dysfunction, neuro-inflammation and oxidative stress which ultimately lead to the death of striatal neurons (Brouillet et al., 2005, Gil and Rego, 2008, Blumenstock and Dudanova, 2020). Mutant huntingtin protein aggregates in the striatum impairs cellular processes like mitochondrial function, initiates autophagy and proteostasis, and ultimately enhances oxidative stress in HD (Maity et al., 2022). Striatal damage is also known to be induced by the mitochondrial toxin, 3-nitropropionic acid (3-NP) which reproduces symptoms of HD in animals, including hypokinetic motor impairment which mimic some of the neuropathophysiological symptoms of HD (Beal et al., 1993, Brouillet et al., 2005, Kumar et al., 2009, Túnez et al., 2010, Brouillet, 2014). 3-NP is an irreversible inhibitor of mitochondrial succinate dehydrogenase in the tricarboxylic acid cycle (TCA) (Brouillet et al., 2005, Duran-Vilaregut et al., 2009, Túnez et al., 2010). The potential utility of the 3-NP model of striatal degeneration comes from studies that show mitochondrial impairment, energy depletion, and oxidative stress are the key players in HD pathogenesis (Beal et al., 1993, Vis et al., 1999, Kumar et al., 2009, Johri and Flint Beal, 2012). The high energy demand by neurons of the central nervous system makes them most vulnerable to the metabolic alterations observed in HD patients (Johri and Flint Beal, 2012, Paul and Snyder, 2019).

In the last decade, a potential link has been explored between Vitamin D3 (VD or cholecalciferol) deficiency and neurodegenerative disorders (Holick et al., 2011, Chel et al., 2013, Molnár et al., 2016, Koduah et al., 2017, Amrein et al., 2020). Vitamin D3 (VD) is a neurosteroid hormone that shows neuroprotection effects in animal and cell-culture models of Parkinson’s and Alzheimer’s disease (Kim et al., 2006, Sanchez et al., 2009, Nimitphong and Holick, 2011, Mohamed et al., 2015, Calvello et al., 2017, Koduah et al., 2017, Lima et al., 2018, AlJohri et al., 2019, Bivona et al., 2019, Rodrigues et al., 2019). Calcitriol, which is the active form of VD, exerts its neuroprotective role via Vitamin D receptor (VDR) (Taniura et al., 2006, Butler et al., 2011, Bankole et al., 2015, Ricca et al., 2018).

Evidence suggests that VD supplementation increases the release of neurotrophic factors like nerve growth factor (NGF) and brain derived neurotrophic factor (BDNF) in neurodegenerative diseases like Parkinson’s and Alzheimer’s disease to reduce neuronal death by apoptosis or necrosis (Kim et al., 2006, Allen et al., 2013, Baydyuk and Baoji, 2014, Mohamed et al., 2015). These neurotrophins also promote synaptic function and survival of several neuronal populations, including striatal neurons that are the primary affected cells in HD (Zuccato et al., 2001, Zuccato and Cattaneo, 2007). Oxidative stress markers are also observed as a hallmark of neurodegenerative disorders like HD (Johri and Flint Beal, 2012, Brouillet, 2014, Lima et al., 2018, Paul and Snyder, 2019). This can be identified by the effect of oxidative stress on certain antioxidants like superoxide dismutase (SOD), glutathione peroxidase (GpX), and catalase (Cat). Studies suggest that VD supplementation has a regulatory effect on oxidative stress which leads to the survival of neurons (Lima et al., 2018, Bakhtiari-Dovvombaygi et al., 2021, Latham et al., 2021). Though VD supplementation is readily available and affordable, little is known about its potential beneficial effects in HD. Limited evidence is available to correlate VD deficiency with HD and whether high Vitamin D supplementation affects motor function in HD has not been established (Chel et al., 2013). The cellular mechanism responsible for neuroprotection of Vitamin D supplementation also remains uncertain. Therefore, the present study was undertaken with the aim to explore the effect of 500 IU/kg of Vitamin D supplementation on motor dysfunction following administration of 3-nitropropionic acid (3-NP).

Experimental procedures
Animal procurement
Ten to twelve weeks old male C57BL/6 mice (average weight; 26 ± 3 g) were acquired from Sainath Agencies, Hyderabad, India. Animals were group housed (2 mice per cage) with ad libitum access to food and water. They were kept in a 12 h light/12 h dark cycle at 25 ± 2 °C. All the animal experiments were carried out with the approval of the Institutional Animal Ethics Committee (IAEC), BITS – Pilani, Hyderabad, India. All efforts were made to minimize the number of animals used and their suffering.

Study design
All the animals were acclimatized for 5 days and then received behavioral training for 7 days prior to treatment. Animals were then randomly divided into four experimental groups (Group I to Group IV; Table 1) and given injections of 3-nitropropionic acid (3-NP) and/or Vitamin D3 (VD or cholecalciferol) (Fig. 1). 3-NP was given by three intraperitoneal injections (i.p) of 25 mg/kg, every 12 h, for a cumulative dose of 75 mg/kg as described previously with minimal modification (Fernagut et al., 2002, Amende et al., 2005). VD was given i.p. daily for 15 days at 500 IU/kg/day.

Table 1. The four different experimental groups of C57BL/6 male mice (3–4 months old)

Animal	Groups
	Control (1× saline) (Group I)
	3-NP (75 mg/kg) (Group II)
	Vitamin D (500 IU/kg) (Group III)
	3-NP (75 mg/kg) + Vitamin D (500 IU/kg) (Group IV)

Download : Download high-res image (118KB)
Download : Download full-size image
Fig. 1. Timeline and design for the behavioral study. C57BL/6 male mice (3–4 months) were trained for 7 days in the behavioral tasks and thereafter injected (i.p) with 3-nitropropionic acid (3-NP) in 3 doses of 25 mg/kg at 12 h intervals (cumulative dose of 75 mg/kg; Group II and IV). VD (500 IU/kg/day) supplementation was given to Group III (only VD) and Group IV mice after post-injection with 3-NP (HD + VD -) for 15 days (Day 1–Day 15). Behaviors analysis was conducted from Day 1 to Day 30. On the 30th day, mice were sacrificed and the striatal brain tissues were extracted for gene and protein expression analysis.

Experimental design
The mice were randomly divided into four experimental groups for behavior and biochemical assay. (Table 1)
i.
Group I: Control group mice (C57BL/6) injected with saline.

ii.
Group II: 3-NP induced mice by i.p. injection (3-NP; 75 mg/kg) without VD-treatment (HD).

iii.
Group III: Mice injected solely with 500 IU/kg/day Vitamin D3 (VD) for 15 days.

iv.
Group IV: Post-intraperitoneal injection of 500 IU/kg/day of VD to 3-NP (75 mg/kg) pre-injected mice for 15 days (HD + VD).


Drugs and reagents
i)
Cholecalciferol (Vitamin D3; VD) was purchased from Sigma-Aldrich, India (Cat No: C9756) and dissolved in 1% ethanol (diluted with sterile saline) on the day of injection (Mohamed et al., 2015). Mice were administered with 500 IU/kg (12.5 μg/kg/day) i.p. of VD as reported previously (Chabas et al., 2013, Gueye et al., 2015, Kolla and Majagi, 2019). Briefly, VD was administered to the Group III (only VD) mice and to Group IV (HD + VD) mice. Group IV mice (HD + VD) were given 24 h recovery time from previous 3-NP induction. Then the VD injections were carried out 24 h after the last dose of 3-NP daily for 15 days to Group IV mice (from 0 to 15th day, Fig. 1 and Table 1).

ii)
3-nitropropionic acid (3-NP) was purchased from Sigma-Aldrich, India (Cat No.: N22908). Stock solutions of 3-NP (3 mg/ml) were prepared in 0.1 M phosphate buffered saline solution and were injected intraperitoneally at 25 mg/kg (3-NP; cumulative dose of 75 mg/kg) thrice at 12 h intervals to respective groups of mice as described previously (Fig. 1 and Table 1). Controls were treated with three doses of saline at 12 h intervals. In this study, we used a subacute dose of 3-nitropropionic acid dose as reported previously by Amenda et al., 2005 with minimal modification. This protocol is based on previous published studies who used 50 mg/kg i.p. injection of 3-NP for 5 days (Kim and Chan, 2001, Fernagut et al., 2002). To model a subacute exposure to 3-NP, a cumulative dose of 75 mg/kg dose of 3-NP was undertaken (Kim and Chan, 2001, Fernagut et al., 2002).


Behavioral evaluations
A total of 80 mice were used for behavioral experiments. Mice were initially assessed for locomotion and gait as previously reported by Amende et al., 2005, Fernagut et al., 2002. A separate cohort was used to evaluate the effects on locomotion and rotarod performance. Only two behavioral tests were done on a given set of animals. Protocols for behavioral tests were:
i)
Assessment of locomotor activity


The locomotor activity was monitored using an actophotometer as described previously (Digital Photoactometer cage; Dolphin, 2009), using the number of beam breaks as the measure of movement for each animal (Kumar et al., 2009). Locomotion was measured over a 5 min period, and baseline readings were taken before the respective drug injections (Fig. 2).
ii)
Estimation of gait by stride length analysis



Download : Download high-res image (80KB)
Download : Download full-size image
Fig. 2. VD supplementation rescues locomotor performance in HD mice. (A) Vitamin D supplementation (VD; cholecalciferol; 500 IU/kg/day) significantly reversed the loss of locomotor activity due to 3-NP treatment in HD mice (HD + VD vs HD; n = 8–10; p < 0.001, two-way repeated measures ANOVA). All data are normalized values against the initial day for each group and is represented as mean ± SEM. (B) On 30th day, a significant decrease in locomotion activity in HD mice (Group II) was observed as compared to Control mice (Group I), which was reversed significantly upon VD supplementation (HD vs Control; n = 10, p < 0.001, Tukey’s post-hoc analysis). Data is represented as box-and-whisker plots depicting median with first and third quartiles; shaded square is the mean for each group and whiskers represents 5th and 95th percentile values.

Stride length analysis was done to determine the choreatic movement in mice by marking the animals’ forepaws and hind paws with ink (red for forelimbs and blue for hind limbs; Fig. 3). The animals were allowed to move on a strip of paper (4 cm wide and 56 cm long) placed on a brightly lit runway leading to a darkened box. Stride length was measured manually as the distance between two paw prints as described previously (Fernagut et al., 2002). Forelimb stride length measurement was first measured for all mice followed by hind limb stride length on a new strip of paper.
iii)
Assessment of motor coordination by rotarod analysis



Download : Download high-res image (137KB)
Download : Download full-size image
Fig. 3. 3-NP or VD administration have no effect in gait dynamics. (A) Schematic representation of paw prints, with gait assessed by stride length analysis. Left and right paws of individual mice were coated with non-toxic ink and mice were allowed to walk on a sheet of oriental white paper. Overall stride of the mice is represented as the average stride of forelimbs and hind limbs. Stride length was determined as the distance between two consecutive paw prints. (B) 3-NP (i.p; 75 mg/kg) induction produced no change in forelimb and hind limb performance in HD mice (Group II) as compared with Group I (Control) mice across a span of 30 days (n = 4–10, p = 0.4, two-way ANOVA). VD supplementation also showed no significant effect on gait dynamics in 3-NP induced HD mice (n = 4–10, p = 0.4, two-way ANOVA). All data are normalized value against initial day for each group and is represented as mean ± SEM. (C) On 30th day, no effect of VD was observed on the stride length performance of 3-NP pre-treated mice (Group IV; HD + VD) as compared to HD (Group II) mice (n = 10, p = 0.70, Tukey’s post-hoc analysis). Data is represented as box-and-whisker plots depicting median with first and third quartiles; shaded square is the mean for each group and whiskers represents 5th and 95th percentile values.

The integrity of motor coordination was measured using the rotarod as described previously (Kumar et al., 2009). Briefly, the rotarod apparatus consists of a long rotating rod of 90 cm long and 3 cm in diameter. The apparatus was divided into three different compartments by a glass partition (Rota rod 3 compartments, Dolphin, 2019). The rod rotation speed was set initially at 35 rotations per minute (RPM). Mice received training on the accelerating rod prior to treatment. After achieving criterion (no falls from the rotarod within 180 sec, mice were injected with either saline (Group I; Control), 3-NP (Group II; HD) or VD (Group III) or both (Group IV; HD + VD). After the respective injections, the treated mice were re-tested for 180 sec and the latency to fall was recorded and analyzed.

RNA isolation and cDNA preparation

On the 30th day, mice from respective groups were anesthetized using isoflurane (Rx, NoB506) and immediately decapitated for the extraction of striatal brain samples. Brain tissue was placed into 1 ml of RNAiso PLUS (Takara Bio) and sonicated on ice. 200 μl of chloroform was added and samples were centrifuged for 30 min at 12,000g at 4 °C (Eppendorf Refrigerated centrifuge, 542R). After isolation of the aqueous phase, an equal volume of isopropanol (Hi-Media Laboratories, Molecular biology grade, India) was added, incubated overnight at −20 °C and again centrifuged at 12,000g for 30 min at 4 °C. Samples were washed with 70% ice-cold ethanol and the obtained pellet was resuspended in nuclease-free water. DNase I (EN052, Thermo Scientific™, USA) treatment was performed to remove any DNA contamination. DNase-treated samples were made up to 400 μl using nuclease-free water. It was followed by sample purification using 1/10th volume of 3 M sodium acetate and 2× volume of phenol: chloroform: isoamyl alcohol (Sisco Research Laboratories Pvt. Ltd., India) and centrifuged for 2 min at maximum speed at 4 °C. The aqueous phase was isolated with addition of an equal volume of ice-cold 100% ethanol, followed by overnight incubation at −20 °C. The samples were again centrifuged at maximum speed for 15 min at 4 °C, then washed with 70% ice-cold ethanol and the obtained pellet was resuspended in nuclease-free water. The total concentration of purified RNA was estimated by the Nanodrop spectrophotometer (Nanodrop, Thermo Fisher Scientific, USA). An equal amount of RNA from each group was used to reverse transcribe complementary DNA (cDNA) with the help of the Verso cDNA synthesis kit (Cat No: AB1453A, Thermo ScientificTM, USA) as per manufacturer's instruction. Briefly, 500 ng of purified RNA was taken from each group for cDNA synthesis with the following reaction conditions: 42 °C for 1 h followed by 95 °C for 2 min. The obtained cDNA was used for semiquantitative PCR and real-time PCR (RT-PCR) (Fig. 5).

Analysis of mRNA expression for nerve growth factor (NGF), brain derived neurotrophic factor (BDNF), and antioxidant marker genes
The sequences of neurotrophic genes (NGF and BDNF) of the mouse genome were obtained from NCBI. The sequences were deposited in the IDT primer quest tool to get the most suitable primer for gene analysis. For antioxidant marker genes, we analyzed superoxide dismutase 1 (SOD1), superoxide dismutase 2 (SOD2), catalase (Cat) and glutathione peroxidase 4 (GpX4). All the genes, primer sequences and amplicon sizes are listed in Table 2. Semiquantitative-PCR was performed using respective cDNA with gene specific primers to estimate the relative quantification of target genes. We used the following PCR condition to amplify NGF using 2X PCR master mix (Takara Bio) and 0.5 μM of each primer: 95 °C for 2 min; 35 cycles of 95 °C for 30 s, 62 °C for 30 s, 72 °C for 30 s; and a final step of extension of 72 °C for 5 min. For antioxidant markers the PCR condition: 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 60 °C for 45 s, 72 °C for 45 s; and a final step of extension at 72 °C for 10 min for SOD1, SOD2, and GpX4 whereas Cat amplification was carried out at 56 °C for 45 s. The PCR products were checked by electrophoresis on 1.5% agarose gel, visualized and quantified using Image software by keeping 18 s rRNA as a Control (housekeeping gene).

Table 2. Sequence of Primers used in PCR studies

Gene	Orientation	Sequence of primers (5′–3′)	Amplicon size
18s	Forward	ACGGAAGGGCACCACCAGGA	127
Reverse	CACCACCACCCACGGAATCG

NGF	Forward	GGCAGAACCGTACACAGATAG	88
Reverse	TGTGTCAAGGGAATGCTGAA

BDNF	Forward	TCCTAGAGAAAGTCCCGGTATC	94
Reverse	GCAGCCTTCCTTGGTGTAA

SOD1	Forward	CAGAAGGCAAGCGGTGAAC	107
Reverse	CAGCCTTGTGTATTGTCCCCATA

SOD2	Forward	TCCTAGAGAAAGTCCCGGTATC	112
Reverse	GCAGCCTTCCTTGGTGTAA

GPx4	Forward	GCCCAATACCACAACAGTAGA	108
Reverse	CCTGAACCACAGCGATGAA

Cat	Forward	AATTGCCTCCACACCTTCAC	107
Reverse	TCACCAAGCTGCTCATCAAC
Quantitative expression analysis for BDNF by Real-Time PCR (RT-PCR)
The expression of BDNF among the four groups of mice was assessed by RT-PCR in a CFX96 Touch Real-time PCR system (BioRad) using the GoTaq qPCR SYBR master mix (Cat No #A6001, Promega Corporation). The reaction mixture was prepared according to the manufacturer’s protocol using ∼12 ng of the cDNA template. Relative gene expression was quantified using the ΔCT method with respective primers (BDNF forward 5′-TCCTAGAGAAAGTCCCGGTATC-3′; reverse 5′-GCAGCCTTCCTTGGTGTAA-3′) and normalized to 18s (forward 5′-ACGGAAGGGCACCACCAGGA-3′; reverse 5′-CACCACCACCCACGGAATCG-3′). We used the ΔΔCT method to determine the fold changes in the expression of BDNF (Livak and Schmittgen, 2001). Briefly, the threshold cycle (Ct) was extracted using Bio-Rad CFX Manager 3.1 software and relative gene expression was calculated as follows: fold change = 2^−ΔΔCt, where ΔCt (cycle difference) = Ct (target gene) – Ct (Control gene) and ΔΔCt = ΔCt (treated condition) – ΔCt (Control condition) (Livak and Schmittgen, 2001).

Protein expression analysis for Vitamin D3 receptor by western blot
On the 30th day, striatal brain tissue was extracted from all four groups of mice. The tissue was homogenized in the lysis buffer (150 mM sodium chloride, 1.0% TritonX-100, 0.5% sodium dodecyl sulfate and 50 mM Tris, pH 8.0). The protein concentration was determined using a Bradford protein assay kit (Bio-Rad, USA). We loaded equal amounts of protein (25 μg) run in a 12% gel, and then transferred to PVDF (Pall Corporation) membrane through a trans blot wet transfer system (Bio-Rad). The membrane was blocked using 5% BSA and incubated with respective primary and secondary antibodies for β-Actin Rabbit mAb (1:3000, CST#4970, Cell Signaling Technology); Vitamin D3 Receptor Rabbit mAb (1:1500, CST#12550, Cell Signaling Technology); Anti-rabbit IgG-HRP-linked antibody (1:5000, CST#7074, Cell Signaling Technology). β-Actin served as a loading control. The signal intensities of the bands were captured using the fusion pulse gel documentation system (Eppendorf, USA). ImageJ software was used to quantify the band intensities.

Statistical analysis
Experimental data is represented as normalized values w.r.t to zero day for the respective groups of mice. Data in the figures are represented as box and whisker plots depicting the median with interquartile range; (central line: median; 25th and 75th quartiles; box: central shaded square: mean; whiskers: 5th–95th percentile values) to illustrate the distribution of normalized values for each respective group of mice (Group I to Group IV). Group data in the text and in the Supplementary tables are presented as mean ± standard error of the mean (SEM). Statistical analysis was conducted using two-way repeated measures ANOVA, two-way ANOVA and one-way repeated measures ANOVA followed by either post hoc multiple pairwise analysis using Tukey's HSD tests or paired sample t-test. For non-parametric measurements, a Kruskal–Wallis test followed by an unpaired sample t-test was performed. p < 0.05 was set as threshold of significance (*p < 0.05, **p < 0.005, and ***p < 0.001). All the data is displayed using Origin 8.1.

Results
VD supplementation improves locomotor activity in a mouse model of HD
The impact of chronic supplementation of 500 IU/kg/day of VD on the locomotor activity in HD model mice was tested over a period of 30 consecutive days. An actophotometer was used to determine the total number of beam crossings for the evaluation of bradykinesia (Fig. 2) (Kumar et al., 2009). A repeated measures two-way ANOVA with power analysis showed a significant day effect (F (3) = 9.12, p < 0.001, Fig. 2) and significant interaction between the groups and days (F (3) = 9.12, p < 0.001, power value = 0.8). On the 7th day, there were no differences in the movement among the four experimental groups of mice. However, a consistent decrease of roughly 30% in the locomotory activity was observed on the 14th and 21st days in 3-NP injected HD mice (Group II) as compared to Control (Group I) mice; (14th day, 0.76 ± 0.08 vs 1.01 ± 0.11; 21st day 0.66 ± 0.07 vs 1.03 ± 0.05, n = 8–10, p < 0.001, Tukey’s post-hoc analysis). On the 30th day it further deteriorated to 40% of Control values (Group II vs Group I; 0.40 ± 0.02 vs 1.03 ± 0.06, n = 10, p < 0.001, Tukey’s post-hoc analysis). However, on the 14th and 21st days, Group IV mice supplemented with VD and pre-injected with 75 mg/kg of 3-NP showed a rescue in the locomotor activity near control levels and significantly above Group II mice (3-NP treated HD mice) (Group IV vs Group II; 14th day, 0.92 ± 0.09 vs 0.76 ± 0.08; 21st day, 0.83 ± 0.07 vs 0.66 ± 0.07, n = 10, p < 0.001, Tukey’s post-hoc analysis). On the 30th day, Group IV mice on VD supplementation showed a robust enhancement by 1.2-fold in the locomotion performance as compared to HD mice (0.86 ± 0.07 vs 0.40 ± 0.02, n = 10, p < 0.001, Tukey’s post-hoc analysis). To check the possibility that VD supplementation alone showed any improvement on the movement of the animals, VD injections solely were carried out in a Control group of mice (Group III). Interestingly, we found no significant difference between locomotion activity of VD administered mice as compared to Control mice for the entire timeline of 30 days (Group III vs Group I; 7th day, 0.87 ± 0.23 vs 0.87 ± 0.12; 14th day, 0.93 ± 0.09 vs 1.01 ± 0.11; 21st day 0.96 ± 0.1 vs 1.03 ± 0.05; 30th day, 0.91 ± 0.12 vs 1.03 ± 0.06, n = 8–10, p = 0.7, Tukey’s post-hoc analysis, Fig. 2A, B). Further, no significant change in locomotion was observed between Group III (VD) and Group IV (HD + VD) mice nullifying the possibility of any chronic toxic side effect by 500 IU/kg/day of VD in Group III mice (Group III vs Group IV; 7th day, 0.87 ± 0.23 vs 0.88 ± 0.20; 14th day, 0.93 ± 0.09 vs 0.92 ± 0.09; 21st day 0.96 ± 0.10 vs 0.83 ± 0.07; 30th day, 0.91 ± 0.12 vs 0.86 ± 0.07, n = 10, p = 0.9, Tukey’s post-hoc analysis, Fig. 2A, B). These results suggest the therapeutic potential of VD supplementation in rescuing locomotor dysfunction in HD mice. VD mediated a beneficial effect on movement occurred only when striatal neurons were subjected to neurodegeneration on 3-NP induction. Our results validate the in-vivo findings of Gueye et al. (2015) where a similar dose of Vitamin D3 (VD, 500 IU/kg/day) resulted in a dramatic recovery in locomotor performance of animals subjected to spinal cord injury (Gueye et al., 2015).

Gait was unaltered in 3-NP induced HD mice
To determine the potential neuroprotective role of VD supplementation (500 IU/kg/day) on gait of 3-NP treated mice, we measured the distance between two successive paw prints (Fig. 3) for four weeks. No change in the stride length was observed across all the four groups of the mice respectively (Fig. 3). In comparison with Controls (Group I), HD mice (Group II) gait dynamics remained unchanged for all the respective timepoints (Group II vs Group I; 7th day, 0.90 ± 0.03 vs 0.98 ± 0.04; 14th day, 1.00 ± 0.07 vs 1.02 ± 0.06; 21st day, 0.88 ± 0.11 vs 1.09 ± 0.09; 30th day, 1.06 ± 0.05 vs 1.03 ± 0.05, n = 4–10, p = 0.7, Tukey’s post-hoc analysis, Fig. 3A, B). Even on the 30th day, where we found a highly significant 60% decrease in the locomotion in HD mice (Fig. 2B) the gait dynamics remained unaltered between Control and HD mice (Group II vs Group I; 1.06 ± 0.05 vs 1.03 ± 0.05, p = 0.7; n = 10 each, Tukey’s post-hoc analysis, Fig. 3B). Similarly, no effect of VD supplementation was seen in forelimb and hind-limb stride length in 3-NP treated mice (Group IV) as compared with HD mice (Group II) for entire timeline of the study (Group IV vs Group II; 7th day, 0.88 ± 0.09 vs 0.90 ± 0.03; 14th day, 0.79 ± 0.03 vs 1.00 ± 0.07; 21st day 0.88 ± 0.02 vs 0.88 ± 0.11; 30th day, 1.03 ± 0.04 vs 1.06 ± 0.05, n = 4–10, p = 0.70, Tukey’s post-hoc analysis, Fig. 3A, B). A one-way balanced repeated measures ANOVA was conducted for the 30th day timepoint to cross check whether VD supplementation modulated gait dynamics in HD mice. No significant change in gait dynamics was observed with VD administration across all groups of mice (F (3) = 0.53, p = 0.66, Fig. 3B). A power analysis done only for the 30th day gave a value of 1. This time point was chosen primarily because we found a robust effect of VD at this time point in other behavior tests (Fig. 2 and Fig. 4). Consequently, VD supplementation (either alone or in conjunction with 3-NP treatment) also did not impact the stride length performance of the mice across all time points of the present study. Our results agree with the findings of Fernaugut et al. (2002) where even a much higher cumulative dose of 3-NP (340 mg/kg) resulted in no differences in stride length for either forelimbs and hind limbs in mice. The data suggest that since the postural gait control is regulated through reciprocal connections between the brainstem and cerebellar cortex, the obtained result may reflect that the dose of 3-NP (75 mg/kg) used in the present study did not possibly produce a significant neuronal loss in the cerebellum (Takakusaki 2017).


Download : Download high-res image (77KB)
Download : Download full-size image
Fig. 4. Rotarod performance data depicting the beneficial effect of VD administration in HD mice. (A) Grip-strength of 3-NP induced HD mice (HD + VD) was significantly improved on VD supplementation (p < 0.001, n = 8–9, two-way ANOVA). All data are normalized values against the initial day for each group and is represented as mean ± SEM. (B) On 30th day, HD mice supplemented with VD (HD + VD) showed no latency in fall for the entire 180 s from the rotating rod, as compared HD mice (n = 8, p < 0.001, Tukey’s post-hoc analysis). HD mice induced with 3-NP showed a significant decrease in fall latency as compared to Control (Group I) (n = 8–9, p < 0.001, Tukey’s post-hoc analysis). Data is represented as box-and-whisker plots depicting median with first and third quartiles; shaded square is the mean for each group and whiskers represents 5th and 95th percentile values.

VD supplementation improves rotarod performance of HD mice
To test the potential effect of VD supplementation to rescue grip strength in 3-NP induced HD mice, we used the rotarod to determine the latency of first fall for the evaluation of motor coordination for four weeks (Amende et al., 2005, Rodrigues et al., 2019). We found that on the 7th day as well as on the 14th day, 3-NP injected HD mice consistently showed around a 50% reduction in fall latency when compared with the aged-matched Control animals (Group II vs Group I; 7th day; 0.63 ± 0.22 vs 1.40 ± 0.15; 14th day, 0.58 ± 0.19 vs 1.33 ± 0.08, n = 8–9, p < 0.001, two-way ANOVA followed by Tukey’s post-hoc analysis, Fig. 4). On the 21st and 30th days, 3-NP treated mice still had a roughly 35% decrease in the latency to fall as compared to Control mice (Group II vs Group I; 21st day, 0.92 ± 0.22 vs 1.40 ± 0.05; 30th day, 0.90 ± 0.22 vs 1.45 ± 0.001, n = 8–9, p < 0.001, two-way ANOVA followed by Tukey’s post-hoc analysis). A significant improvement in the neuromuscular coordination was observed between Group IV mice (HD + VD) and Group II mice (HD) from the 7th day onwards and continued through the 30th day (Fig. 4). Astonishingly, Group IV (HD + VD) mice showed a highly significant effect of VD supplementation on rotarod performance on the 14th day by 1.4 fold (1.37 ± 0.13), on the 21st day by 0.6-fold (1.44 ± 0.1) and on the 30th day by 0.74 fold (1.57 ± 0.001) as compared to Group II mice (HD) for the same time points (14th day, 0.58 ± 0.19; 21st day, 0.92 ± 0.22; 30th day, 0.90 ± 0.22, n = 8–9, p < 0.001, Tukey’s post-hoc analysis, Fig. 4A, B). To our surprise VD treatment to pre-3-NP injected mice (Group IV; HD + VD) recorded no latency to fall within a total time duration of 180 s and rescued the neuromuscular coordination by 100% when compared with 3-NP induced HD mice. To rule out the possibility that VD supplementation alone showed any effect on the grip strength of mice, VD injections were carried out in a Control group (Group III). Interestingly, we found no significant difference in the latency to first fall between the Group I (Control) and the VD supplemented mice (Group III) for all time points (p = 0.9; Tukey’s post-hoc analysis). Overall, two-way ANOVA showed a significant difference in the mean among all groups of mice with no interaction between the groups and day (F (5) = 4.06, p < 0.001, Fig. 4), reflecting the effects of VD and 3-NP in Group II and Group IV mice. These result support our hypothesis that the VD supplementation has a robust rescue effect on neuromuscular coordination, which is sustained throughout the timeline of the study. Neuromuscular coordination is impaired in patients with Huntington's disease but how VD might affect the HD associated behavioral performance is not well described in the mouse model (Chel et al., 2013). Our data parallels the findings of Sakai et al. (2015) who showed that an oral supplementation of the VD analogue eldecalcitol (ED‐71, ELD), a derivative of 1,25 (OH)2D3, for 14 days significantly improved the locomotor performance of mice. Here we used a similar dose of VD (500 IU/kg/day; 12.5 µg/kg/day) for a similar about of time (here 15 days) to explore the motor benefits of VD (cholecalciferol) in HD mice. Our findings collectively suggest that motor performance deficits observed in the 3-NP mouse model of HD get significantly reversed by VD supplementation, suggesting a neuroprotective function of VD in the striatum.

VD supplementation increases neurotrophin expression in the striatum of 3-NP induced HD mice
Alterations in the mRNA expression of the neurotrophins were analyzed in striatal tissues from all the four groups of mice, with NGF analyzed by semiquantitative PCR and BDNF by RT-PCR. RT-PCR results for BDNF expression in the striatum showed a significant change in the gene expression induced by Vitamin D3 supplementation in HD mice (n = 3, p = 0.04, Kruskal–Wallis test, Fig. 5A). HD mice showed a significant decrease in the gene expression of BDNF as compared to Controls (Group II vs Group I; 0.53 ± 0.06 vs 1.00 ± 0.00, n = 3, p = 0.001, unpaired sample t-test). VD administration after 3-NP injection robustly increased the BDNF expression in Group IV mice (3.10 ± 0.57) when compared with HD mice (Group II mice; 0.53 ± 0.06, n = 3, p = 0.01, unpaired sample t-test, Fig. 5A, Supplementary Table 5) reflecting that the biological effect of VD was not compromised by 3-NP induction. In addition, no significant difference in the BDNF expression was observed in the striatal tissues of Group III with respect to Group I mice (VD vs Control; 1.41 ± 0.40 vs 1.00 ± 0.00, n = 3, p = 0.35, unpaired sample t-test, Fig. 5A, Supplementary Table 5).


Download : Download high-res image (93KB)
Download : Download full-size image
Fig. 5. mRNA expression of BDNF and NGF from the striatal tissues of mice depicting the neuroprotective effect of 500 IU/kg of VD. (A) Real Time – PCR results depicting robust enhancement in the mRNA expression of BDNF in the striatum of HD mice upon VD administration (HD + VD vs HD; n = 3, p = 0.01, unpaired sample t-test). Striatal tissue of HD mice showed a significant decrease in the gene expression of BDNF (HD vs Control; n = 3, p = 0.001, unpaired sample t-test). (B) Semiquantitative PCR results depicting VD administration rescued the mRNA expression of NGF in the striatum of 3-NP induced HD mice (HD + VD vs HD; n = 4, p = 0.001, paired sample t-test). NGF expression was significantly downregulated in HD mice as compared to Control (HD vs Control; n = 4, p = 0.006, paired sample t-test) (C) Representative gel images of PCR results for NGF. Data is represented as box-and-whisker plots depicting median with first and third quartiles; shaded square is the mean for each group and whiskers represents 5th and 95th percentile values.

Similarly, semiquantitative PCR results showed an overall difference in the mRNA expression of NGF in all the four groups of mice (F (3) = 4.01, p = 0.03, one-way ANOVA). In HD mice (Group II) the expression of NGF was downregulated by ∼0.34-fold (3-NP; 0.66 ± 0.04, n = 4) when compared to Group I animals (Control; 1.00 ± 0.00, n = 4, p = 0.001, paired sample t-test, Fig. 5B). VD supplementation significantly rescued the expression of NGF in the striatum by ∼0.7 fold in Group IV mice as compared with HD mice (HD + VD vs HD; 1.14 ± 0.12 vs 0.66 ± 0.04, n = 4, p = 0.006, paired sample t-test, Fig. 5B, C). Treatment of VD alone enhanced NGF expression by ∼0.8 fold in Group III mice as compared to HD mice (VD vs HD; 1.19 ± 0.21 vs 0.66 ± 0.04, n = 4, p = 0.03, paired sample t-test, Fig. 5B, C) but did not significantly change NGF relative to Group I mice. These data indicate that HD mice have reduced neurotrophin expression and this is rescued by VD supplementation. The enhanced neurotrophin expression could underlie the neuroprotective effect of VD in HD mice. Our results parallel the findings of Mohamed et al. (2015) where VD treatment significantly alleviated beta-amyloid plaque expression with a concomitant elevation in the expression of neurotrophins in a rat model of Alzheimer’s disease.

VD supplementation attenuates oxidative stress as reflected by the decrease in the antioxidant enzyme expression in HD mice
To observe the effect of VD supplementation on the gene expressions of antioxidant markers, we performed semiquantitative PCR in all the four groups of mice (Group I to Group IV). mRNA expressions of superoxide dismutase 1 (SOD1), superoxide dismutase 2 (SOD2), glutathione peroxidase 4 (GpX4), and catalase (Cat) were subsequently analyzed.
(i)
Superoxide dismutase1 (SOD1) and superoxide dismutase 2 (SOD2):


The effect of VD supplementation did not significantly change the gene expression of SOD1 among the four groups of mice (F (4) = 0.54, p = 0.71, one-way ANOVA, Supplementary Table 6). Striatal tissue from HD mice showed no change in SOD1 mRNA expression (0.86 ± 0.42, n = 4) when compared with Group I (Control; 1.00 ± 0.00, n = 4, p = 0.38, paired sample t-test, Fig. 6A). VD administration in HD mice also showed no significant change in SOD1 expression in the striatal samples of Group IV mice (HD + VD; 1.57 ± 0.45) when compared with Group II animals (HD; 0.86 ± 0.42, n = 4, p = 0.99, paired sample t-test), Fig. 6A, Supplementary Table 6). VD supplementation alone did not affect SOD1 mRNA expression in Group III mice when compared with Group I (VD vs Control; 1.41 ± 0.43 vs 1.00 ± 0.00, n = 4, p = 0.79, paired sample t-test, Fig. 6A).


Download : Download high-res image (109KB)
Download : Download full-size image
Fig. 6. mRNA expression of antioxidants from the striatal tissues of mice depicting reduced oxidative stress after VD administration in HD mice. (A) On 30th day, no significant change in the mRNA expression of superoxide dismutase1 (SOD1) were observed across all groups of mice (n = 4, p = 0.71, one-way ANOVA). VD induction produced no change in the striatal expression of SOD1 in Group IV mice (HD + VD) as compared to HD mice (n = 4, p = 0.99, paired sample t-test). (B) No significant change in the mRNA expression of superoxide dismutase 2 (SOD2) were observed across all groups of mice (n = 4, p = 0.47, one-way ANOVA). Vitamin D supplementation did not significantly change the expression of SOD2 in Group IV mice (HD + VD) as compared to HD mice (n = 4, p = 0.99, paired sample t-test). (C) Box and whisker plot depicting enhanced expression of glutathione peroxidase 4 (GpX4) following 3-NP injection in HD mice (HD vs Control; n = 4, p = 0.008, paired sample t-test). GpX4 expression significantly subsided upon VD administration in Group IV mice (HD + VD) as compared to HD mice (n = 4, p = 0.007, paired sample t-test). (D) Box and whisker plot depicting VD administration leading to decrease in catalase expression in Group IV mice (HD + VD) as compared to Group II (HD) (n = 4, p = 0.02, paired sample t-test). Striatal expression of catalases was enhanced in HD mice when compared to Control mice (n = 4, p = 0.005, paired sample t-test). (E) Representative gel images of PCR results for SOD1, SOD2, GPX4 and Cat in the striatum of Control, HD, VD and HD + VD mice. Data are represented as box-and-whisker plots indicating median, first and third quartile, and 5th and 95th percentile values.

SOD2 mRNA expression also remained unchanged among all the four groups of mice either on 3-NP treatment or VD supplementation (F (3) = 0.91, p = 0.47, one-way ANOVA, Fig. 6B). SOD2 mRNA expression in HD mice was modulated by ∼0.6 fold as compared to Control but did not reach significance (1.57 ± 0.35, n = 4, p = 0.90, paired sample t-test, Fig. 6B). Striatal samples from Group IV mice showed an insignificant change in SOD2 mRNA expression when compared with Group II mice (HD + VD vs HD; 0.99 ± 0.27 vs 1.57 ± 0.35, n = 4, p = 0.99, paired sample t-test, Fig. 6B, Supplementary Table 6). Also, no change in the expression of SOD2 was observe in Group III mice supplemented with only VD when compared with Group I mice (VD vs Control; 1.25 ± 0.37 vs 0.99 ± 0.01, n = 4, p = 0.54, paired sample t-test, Fig. 6B).
(ii)
Glutathione peroxidase (GpX4):


On the 30th day after 3-NP induction in HD mice, an overall change in the gene expression of GpX4 in the striatal tissue was observed (F (3) = 14.06, p < 0.001, one-way ANOVA, Fig. 6C, Supplementary Table 6). PCR data for GpX4 revealed that 3-NP treatment caused a significant increase in the expression of GpX4 in the striatum of HD mice as compared with Group I mice (Group II vs Group I; 2.09 ± 0.22 vs 1.00 ± 0.00, n = 4, p = 0.008, paired sample t-test, Fig. 6C). mRNA expression of GpX4 in Group IV mice (HD + VD) decreased with VD administration as compared to the HD mice (Group IV vs Group II; 1.19 ± 0.11 vs 2.09 ± 0.18, n = 4, p = 0.007, paired sample t-test, Fig. 6C), to roughly control levels. Similarly, VD supplementation alone in Group III mice did not change GpX4 expression relative to Group I (VD vs Control; 1.08 ± 0.05 vs 1.00 ± 0.00, p = 0.99, paired sample t-test, Fig. 6C, Supplementary Table 6).
(iii)
Catalase (Cat):


Similar results were seen with expression of the antioxidant enzyme catalase. PCR data from the 30th day post-HD induction revealed an overall change in catalase expression across all the four treatment groups (F (3) = 23.27, p < 0.001, one-way ANOVA, Fig. 6D, Supplementary Table 6). 3-NP injected HD mice showed a significant increase in the enzyme expression as compared with Group I mice (Group II vs Group I; 2.02 ± 0.18 vs 1.00 ± 0.00, n = 4, p = 0.005, paired sample t-test, Fig. 6D). Vitamin D3 administration appears to reduce the oxidative stress in HD mice as seen by the decrease in catalase expression in Group IV mice (HD + VD) (Group IV vs Group II; 1.38 ± 0.03 vs 2.02 ± 0.18, n = 4, p = 0.02, paired sample t-test, Fig. 6D). VD supplementation alone in Group III mice also showed a decrease in the mRNA expression of catalases when compared to HD mice but was not significant (VD vs HD; 1.72 ± 0.03 vs 2.02 ± 0.18, p = 0.08, paired sample t-test, Fig. 6D, Supplementary Table 6). VD supplementation in Group IV mice (HD + VD) showed a decrease in the expression of antioxidants markers with a subsequent partial rescue in the body weight (Supplementary Fig. 1). An overall significant difference in mean body weight was observed among all the groups of mice (F (3) = 5.40, p = 0.002, two-way ANOVA, Supplementary Fig. 1, Supplementary Table 4). A 30% decrease in the body weight was observed by 30th day in Group II mice when compared with Group I mice (HD vs Control; 0.87 ± 0.01 vs 1.23 ± 0.05, n = 8–10, p < 0.001, paired sample t-test Supplementary Fig. 1). The body weight was significantly rescued on Vitamin D3 supplementation in HD mice (HD + VD vs HD; 1.10 ± 0.05 vs 0.87 ± 0.01, n = 8–10, p < 0.001, paired sample t-test, Supplementary Fig. 1), possibly reflecting the effect of VD in fixing oxidative stress, mitochondrial function, and muscle heath (Latham et al., 2021; G. W. Kim and Chan, 2001, Chabas et al., 2013, Gueye et al., 2015).

VD supplementation increases the expression of VDR in striatum of 3-NP induced HD mice
The effect of Vitamin D supplementation on expression of the Vitamin D receptor (VDR) in the striatum was elucidated by western blot analysis (F (3) = 5.48, p = 0.01, one-way ANOVA, Fig. 7, Supplementary Table 7). 3-NP mediated neurodegeneration caused a significant decrease in VDR expression by ∼0.54 fold in HD mice (Group II) as compared to the Control (Group II vs Group I, 0.46 ± 0.15 vs 1.00 ± 0.00, n = 4, p = 0.02, paired sample t-test, Fig. 7A). VD supplementation rescues this effect as Group IV mice (HD + VD) showed a significant increase in the expression of VDR by ∼2-fold as compared to Group II (HD) mice (1.28 ± 0.26 vs 0.46 ± 0.15, n = 4; p = 0.04, paired sample t-test). An enhancement in the protein expression of VDR was observed in Group III mice, supplemented with only VD as compared to Group I mice but did not reached significance (VD vs Control; 1.52 ± 0.25 vs 1.00 ± 0.00, n = 4; p = 0.13, paired sample t-test). Our results parallel the finding of Lima et al., 2018 where VD administration enhanced the expression of VDR in the hippocampus.


Download : Download high-res image (43KB)
Download : Download full-size image
Fig. 7. Enhanced protein expression of the Vitamin D receptor (VDR) in the striatum of HD mice. (A) Box and whisker plot depicting the effect of VD supplementation on VDR expression in HD mice. The protein expression of VDR was significantly compromised in HD mice and reversed substantially upon VD administration (HD vs Control, n = 4, p = 0.02; HD + VD vs HD, n = 4, p = 0.04, paired sample t-test). Data are normalized against Control Data; plots indicating median, first and third quartile, and 5th and 95th percentile values. (B) Representative protein expression levels of VDR in the striatum of Control, HD, VD and HD + VD mice.

Discussion
In the last decade, Vitamin D3 (1α,25-dihydroxyvitamin D3) and its analogues have been explored for their usefulness in brain disorders. A number of studies have reported a link between low serum level of VD in patients affected by neurodegenerative and neuropsychiatric disorders like Alzheimer’s Disease (AD), Parkinson’s Disease (PD), Huntington’s disease (HD), Schizophrenia, sleep disorders, autism, and depression (Kim et al., 2006, Chabas et al., 2013, Gueye et al., 2015, Mohamed et al., 2015, Sakai et al., 2015, Koduah et al., 2017, Morello et al., 2018, Bivona et al., 2019, Bakhtiari-Dovvombaygi et al., 2021). Under a number of neuropathological conditions, Vitamin D supplementation has shown to have a myriad of biological functions including reducing the expression of oxidative stress markers and neuro-inflammatory markers and increasing the expression of neurotrophins (Mohamed et al., 2015, Lima et al., 2018, Rodrigues et al., 2019, Bakhtiari-Dovvombaygi et al., 2021, Latham et al., 2021). Though some of the results remain inconclusive, the limited information available suggests a neuroprotective function of VD in the context of the motor dysfunction observed in Huntington’s disease (HD). The goal of the present study was to explore the therapeutic potential of Vitamin D3 (VD) in an animal model of HD induced by intraperitoneal injection of 3-nitropropionic acid (3-NP). 3-NP is a well-established toxic model causing mitochondrial dysfunction and selective loss of striatal neurons (Túnez et al., 2010, Brouillet, 2014). In this study, we used a subacute dose of 3-nitropropionic acid, a slight modification from the protocol of Amende et al. (2005). The protocol is derived from earlier studies by Fernagut et al., 2002, Kim and Chan, 2001, where 50 mg/kg of 3-NP was given for 5 days. As described by Nishino et al. (1997), a single low dose injection of 3-NP (20 mg/kg) was insufficient to induce behavioral and biochemical abnormalities in the striatum but subsequent injections caused significant striatal lesions and motor deficits. Our data show that treating 3-NP HD model mice with 500 IU/kg/day of Vitamin D3 produces significant improvements in movement and motor performance (Fig. 2 and Fig. 4). The dose of VD was chosen based on prior studies of its neuroprotective, antidepressant, and antioxidant effect in rodent model (Chabas et al., 2013, Gueye et al., 2015, Kolla and Majagi, 2019, Rodrigues et al., 2019). These studies suggested that a dose of 500 IU/kg/day (12.5 µg/kg) of VD improved myelination and accelerated functional recovery of nerve post injury (Chabas et al., 2013). In another study, 500 IU/kg/day of VD significantly improved the locomotion performance of rodents in a spinal cord injury model that was not observed with a dose of 200 IU/kg/day (Gueye et al., 2015). Further, Rodrigues et al. (2019) demonstrated that in rodent model of sporadic dementia of Alzheimer’s type, 500 IU/kg/day of VD was enough to reduce oxidative stress markers and restore cholinergic function by decreasing acetylcholine esterase activity in synaptosomes. Based on these findings, we utilized the chronic administration of 500 IU/kg/day for 15 days in order to explore its effect on motor disabilities in the 3-NP induced mouse model of HD. We also tested if any benefits were maintained over the next 15 days in the absence of continued VD administration, and our data supported that this is the case.

A study undertaken by Chel et al. (2013) suggested for the first time the importance of VD in HD by providing a link between VD deficiency and HD. In the same study, the author showed a positive correlation between high serum levels of 25-hydroxycholecalciferol (25(OH)VD3 or calcidiol) levels and improvement in motor capabilities in HD patients. This was supported by the study by Xue et al. (2015), which showed that the serum concentration of Vitamin D3 (VD) metabolite strongly influences the bioavailability of Vitamin D3 metabolites in the brain. To produce the metabolically active form of VD (1α,25-dihydroxycholecalciferol; 1α,25-(OH)2-VD3 or calcitriol), Vitamin D3 (VD or cholecalciferol) undergoes two hydroxylation step reactions. The first hydroxylation reaction occurs in the liver to produce 25-hydroxycholecalciferol (25(OH)VD3 or calcidiol) and then a second hydroxylation occurs in the kidney to produce the metabolic active form of Vitamin D3 (1α,25-dihydroxycholecalciferol; 1α,25-(OH)2-VD3 or calcitriol) (Xue et al., 2015, Bivona et al., 2019). The serum half-life of the active metabolic form of Vitamin D3 is reported to be approximately 4–6 h while the serum half-life of calcidiol is approximately 10–21 days. The serum level of calcidiol is the most accurate and accepted method to depict VD status of an organism (Xue et al., 2015). Our results demonstrate that even in absence of systemic injection of VD (from the 15th to 30th day; Fig. 2 and Fig. 4), significant improvement was observed in locomotion and rotarod performance of animals over this span, especially on the 30th day. These data corroborate the findings of Xue et al. (2015), suggesting that the serum levels of VD influence brain VD metabolite levels and impact the motor capabilities of HD model animals, neurotrophin levels and oxidative stress.

The rescue effect of VD administration in 3-NP induced HD mice were tested on movement impairment, stride length and grip strength to evaluate the motor coordination of the animals (Beal et al., 1993, Baydyuk and Baoji, 2014). Group II mice (3-NP induced) showed a reduction in their latency of fall on the rotarod, whereas on 30th day, Group IV mice (HD + VD) rescued neuromuscular coordination and showed no latency of first fall within a total time duration of 180 seconds as shown in Fig. 4. Neuromuscular coordination is known to be impaired in patients with Huntington's disease but how VD affects this behavior performance in HD have not been described in mouse model (Chel et al., 2013). The findings of the present study suggest that the motor performance deficits observed in the 3-NP model of HD were significantly reversed by VD supplementation, suggesting a neuroprotective function of VD in the striatum. We observed no variability in the gait dynamics across all the four groups (Group I-IV) over a month's time as shown in Fig. 3, possibly reflecting that the dose of 3-NP (75 mg/kg) used in the present study did not produce neuronal loss in the cerebellum (Takakusaki, 2017). Hence, no rescue effect of VD was observed in 3-NP injected HD mice (Fig. 3). Changes in gait or postural control could occur with different doses or schedules of neurotoxin (3-NP) injection than those undertaken in the present study.

The enhancement in locomotory and rotarod performances of HD mice post injected with VD (Group IV; HD + VD) was accompanied with an increase in the expression of brain derived neurotrophic factor (BDNF), nerve-growth factor (NGF), and the Vitamin D receptor (VDR) (Fig. 5 and Fig. 7). Previous studies have found that VD mediates an increase in the expression of Vitamin D receptor (VDR), tyrosine hydroxylase (TH), the dopamine transporter (DAT), and brain derived neurotrophic factors (BDNF) (Nimitphong and Holick, 2011). VD mediates its biological effect via VDR by acting as transcriptional regulator for some important neurotrophins in the brain like NGF and BDNF (Johri and Beal, 2012; Taniura et al., 2006, Allen et al., 2013, Zuccato and Cattaneo, 2007, Silva et al., 2015, Bayo-Olugbami et al., 2020, Nadimi et al., 2020). To test some of these previously reported targets, semi-quantitative PCR and RT-PCR was carried out to explore VD-induced gene expression of neurotrophins in Control and 3-NP treated group of mice. In agreement with earlier literature reports, we found a significantly decreased expression of BDNF and NGF in 3-NP injected HD mice, but this profoundly augmented in the Group IV mice (HD + VD) with supplementation of VD (500 IU/kg) (Fig. 5A, B) (Saporito et al., 1994, Pérez-Navarro et al., 2000, Chabas et al., 2013, Gueye et al., 2015, Silva et al., 2015, Bayo-Olugbami et al., 2020, Nadimi et al., 2020). Numerous studies have highlighted the importance of neurotrophic factors like BDNF and NGF as potential therapeutics for neurodegenerative diseases such as Parkinson’s, Alzheimer’s, and Huntington’s diseases (Kim et al., 2006, Sanchez et al., 2009, Mohamed et al., 2015, Lima et al., 2018, AlJohri et al., 2019, Rodrigues et al., 2019). In particular, in-vivo and in-vitro findings from Zuccato et al. (2001) suggest that restoring BDNF production in cortical neurons during HD could restore the survival signal required by the dying striatal neurons (Zuccato and Cattaneo, 2007). The same study also provided evidence using genetic models of HD that mutant huntingtin profoundly diminished the cortical production of BDNF. Further, the work conducted by Pérez-Navarro et al. (2000) suggests BDNF to be the most effective factor in preventing the loss of striatal neurons in HD. Our data demonstrate that the gene expression of BDNF and NGF was significantly compromised in 3-NP induced HD mice (Group II) and was substantially reversed upon VD administration in Group IV mice. This result suggests a direct therapeutic benefit of VD in combating 3-NP induced striatal neurodegeneration via BDNF and NGF in the striatum (Fig. 5). NGF and BDNF are established candidates for combating the death of neurons observed in a range of neurodegenerative disorders (Zuccato and Cattaneo, 2007, Gil-Mohapel, 2012, Allen et al., 2013). VD supplementation possibly enhances the survival signals from neurotrophins to reduce neurodegeneration and combat striatal neuronal loss as observed in the rat model of AD (Mohamed et al., 2015). These results indicate that VD could alleviate behavior deficits in 3-NP induced HD mice via enhancement in neurotrophins expression in the striatum.

The enhancement in the production of neurotrophins like BDNF could act to reduce oxidative stress in neurodegenerative diseases including HD (Taniura et al., 2006, Allen et al., 2013, Takakusaki, 2017, Paul and Snyder, 2019, Bakhtiari-Dovvombaygi et al., 2021). Oxidative stress markers allow assessment of the status of the biological samples where it measures the capacity of the system to scavenge free radicals. To control the intracellular redox balance, cells have evolved a highly complex ROS scavenging network. Previous studies on the antioxidant role of VD have been controversial as some studies did not support an antioxidant function for VD and other studies observed an up-regulation of the antioxidant markers (Loscalzo, 2008, Seiler et al., 2008, Tagliaferri et al., 2019). To determine whether, in our model, similar pathways are activated we checked different antioxidant enzymes marker genes. The glutathione (GSH)-dependent enzymatic system is one of most important ROS balancing units that regulates cell survival against oxidative damage. GSH contributes to the maintenance of the intracellular redox environment either by disulfide-exchange reactions with oxidized proteins or by acting as a reducing agent for glutathione peroxidases. Out of seven Glutathione peroxidases of mammals, GpX4 is particularly important due to its critical role in determining the cell membrane redox state. Increased expression of GpX4 indicates lipid based oxidative stress (Tagliaferri et al., 2019). In Group II (HD animals) we found a significant increase in expression of GpX4 indicating higher oxidative stress and this was attenuated upon supplementation with VD (Group IV, See Fig. 6). Catalase is one of the crucial antioxidant enzymes that mitigates oxidative stress by destroying cellular hydrogen peroxide to produce water and oxygen (Loscalzo, 2008, Seiler et al., 2008, Tagliaferri et al., 2019). Supporting the GpX4 expression data which indicates higher oxidative stress, HD (Group II) animals showed increased expression of catalase, which was again diminished by VD supplementation. This suggests that VD supplementation reduces oxidative stress and leading to the subsequent downregulation of antioxidant enzymes. We could not find the significant differences in SOD1 and SOD2 expression possibly because its activation depends on very specific ROS species.

The antioxidant effect of VD supplementation in HD mice was accompanied by enhancement in the protein expression of Vitamin D receptor (VDR) in the striatum (Fig. 7). Previous studies have reported that the biological activity of VD happens via upregulation of VDR in other neurodegenerative diseases like AD and PD (Mohamed et al., 2015, Lima et al., 2018). Therefore, the protein expression of VDR was analyzed in Group IV mice (HD + VD) pre-injected with 3-NP. On the 30th day, a robust expression of VDR by ∼2 fold was observed in HD mice supplemented with VD (Fig. 7). HD mice (Group II) showed a significant decrease by ∼0.54 fold in the VDR expression as compared to Control (Group I). This enhanced VDR expression could help in attenuating the toxic effect of 3-NP thereby reducing antioxidant stress markers and increasing neurotrophins expression in Group IV mice. The improvement in motor performance observed in HD mice could also occur due to increased Vitamin D receptor signaling at the neuromuscular junction as seen previously (Sakai et al., 2015). Additional contribution of VD supplementation to the neuroprotective role of the cholinergic system may also be a factor, as has been seen in AD (Rodrigues et al., 2019). A reduction in cholinergic signaling may occur in HD due to aberrant kinase signaling as studies have shown that protein kinases are known modulators of cholinergic receptors expression and function (Komal et al., 2014, Komal et al., 2015). Previous studies have demonstrated that Vitamin D receptor (VDR) signaling alleviates oxidative stress and increases production of neurotrophins like BDNF (Bakhtiari-Dovvombaygi et al., 2021, Xu and Liang, 2021). It is likely that in our study, the rescue effect of VD observed in behavior tasks involves the VD-VDR signal transduction pathway, potentiating survival signals via neurotrophins and decreasing oxidative stress, which in turn downregulates antioxidant stress markers (Fig. 8). It is known that VDR signaling is vital for mitochondrial integrity, combats ER stress and strengthens skeletal muscle activity at neuromuscular junction (Baydyuk and Baoji, 2014, Sakai et al., 2015, Bakhtiari-Dovvombaygi et al., 2021, Xu and Liang, 2021, Maity et al., 2022). In summary, our data suggests that Vitamin D3 mediates a neuroprotective effect in the striatum via enhancement in the expression of Vitamin D receptor (VDR) and vital neurotrophins, like BDNF and NGF, crucial for survival signals in HD.


Download : Download high-res image (187KB)
Download : Download full-size image
Fig. 8. Restorative effects of Vitamin D3 (VD) in Huntington’s disease (HD). VD supplementation enhances Vitamin D receptor (VDR) in the striatum with concomitant increase in the expression of neurotrophins namely, brain derived neurotrophic factor (BDNF) and nerve growth factor (NGF) in the striatum of HD mice (Group IV). The increased gene expression of neurotrophins is proposed to occur through biological effects of VD on Vitamin D receptor (VDR), potentiating antioxidant and neuroprotective benefits of VD on motor activity.

3-NP induction also significantly decreased the body weight of HD mice (Group II) by ∼0.3-fold as previously reported by Kumar et al. (2009), which was reversed upon VD supplementation by the end of 30 days (HD + VD; Group IV, Supplementary Fig. 1). 3-NP is known to cause mitochondrial dysfunction similar to what is demonstrated in a genetic model of HD (Brouillet et al., 2005, She et al., 2011). Our gene expression and protein expression data reflect that at this time point (30th day) there is a significant enhancement in the Vitamin D receptor expression (VDR) in the striatum with a concomitant increase in expression of BDNF and NGF. The therapeutic action of VD possibly involves an increase in the expression of VDR in the skeletal muscles and increasing muscle mass, and increasing body weight. This also suggests that VD may be rescuing energy impairments and mitochondrial dysfunction through upregulation of VDR and possibly could be one of the reasons why we see an enhancement in the weight in Group IV mice (Wong et al., 2009, Latham et al., 2021). Overall, our results are novel in determining the long-lasting effect of VD on striatal functions in HD, and reflecting the strong effect of this neurosteroid in combating motor dysfunction via enhancement in survival signal by BDNF and NGF (Fig. 5).

It must be noted that our study had some limitations in that we did not perform histopathological studies to determine the effect of VD on cell death in striatal neurons. Further, the 3-NP cytotoxic model is useful model for mimicking the pathophysiological symptoms of HD, but does not involve mHTT itself. In our study, HD mice showed a significant molecular change in VDR levels, antioxidant stress markers and neurotrophin expression, which are known to underlie HD pathogenesis and have been observed in transgenic models of the disorder (Vis et al., 1999, Zuccato et al., 2001, Brouillet et al., 2005, Gil and Rego, 2008, Gil-Mohapel, 2012, Brouillet, 2014). Our findings showed that VD is a promising agent for delaying or even restoring motor dysfunction. It is evident from our study and others that VD supplementation possibly involves a diversity of mechanisms for its beneficial effect in HD (Taniura et al., 2006, Bankole et al., 2015, Sakai et al., 2015, Xu and Liang, 2021). VD supplementation has proved to be effective in reversing motor deficits and neurotrophins levels in the 3-NP induced mouse model of HD. It could be considered as promising agents for the development of new therapeutics for neurodegenerative disorders including HD. However, it will remain critical to replicate our findings on neuroprotective role of VD supplementation in transgenic animal models.