Guest User

Untitled

a guest
Feb 9th, 2021
5,407
0
Never
Not a member of Pastebin yet? Sign Up, it unlocks many cool features!
text 23.86 KB | None | 0 0
  1. Unofficial English translation of ‘Frauds and falsehoods in the medical field’
  2. https://www.dsalud.com/reportajes/fraudes-y-falsedades-en-el-ambito-medico/
  3.  
  4. The scam has been confirmed: PCR does not detect SARS-CoV-2
  5.  
  6. Number 242 - November 2020
  7. Reading time: 15 minutes
  8.  
  9. The genetic sequences used in PCRs to detect suspected SARS-CoV-2 and to diagnose
  10. cases of illness and death attributed to Covid-19 are present in dozens of sequences of the
  11. human genome itself and in those of about a hundred microbes. And that includes the
  12. initiators or primers, the most extensive fragments taken at random from their supposed
  13. "genome" and even the so-called "target genes" allegedly specific to the "new
  14. coronavirus". The test is worthless and all "positive" results obtained so far should be
  15. scientifically invalidated and communicated to those affected; and if they are deceased, to
  16. their relatives. Stephen Bustin, one of the world's leading experts on PCR, in fact says that
  17. under certain conditions anyone can test positive!
  18.  
  19.  
  20. We have been warning you since March: you cannot have specific tests for a virus without
  21. knowing the components of the virus you are trying to detect. And the components cannot be
  22. known without having previously isolated/purified that virus. Since then we continue to
  23. accumulate evidence that no one has isolated SARS-CoV-2 and, more importantly, that it can
  24. never be isolated for the reasons we explained last month (read the report "Can you prove that
  25.  
  26. there are pathogenic viruses?" on our website -www.dsalud.com-). And in the present report we
  27. are going to offer new data that show that RT-PCR does not detect the so called SARS-CoV-2 as
  28. it is known, but fragments of human RNA and those of numerous microbes.
  29.  
  30. We have already explained the numerous problems that RT-PCR poses, recognised by
  31. organisations or governments such as the WHO or the CDC and by prestigious international
  32. experts such as Dr. Stephen Bustin who considers both the arbitrariness of establishing criteria
  33. for results and the choice of the number of cycles to be nonsense because they can lead to
  34. anyone testing positive.
  35.  
  36. In this report we are going to add the results of a particular research we have done from the data
  37. published on the alleged SARS-CoV-2 and on the protocols endorsed by the WHO for the use of
  38. RT-PCR as well as the data corresponding to the rest of the "human coronaviruses". And the
  39. conclusions are extremely serious: none of the seven "human coronaviruses" have actually been
  40. isolated and all the sequences of the primers of their respective PCRs as well as those of a large
  41. number of fragments of their supposed genomes are found in different areas of the human
  42. genome and in genomes of bacteria and archaea, such as these: Shwanella marina JCM, Dialister
  43. succinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis,
  44. Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis,
  45. Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale,
  46. Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua
  47. panacisegetis, Ru bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator
  48. peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis and a long list of others.
  49.  
  50. We are going to explain step by step the research that has led us to such an unusual conclusion.
  51.  
  52. HAVE ANY HUMAN CORONAVIRUSES BEEN ISOLATED?
  53.  
  54. During the first half of April, when the first research we conducted indicated that SARS-CoV-2 had
  55. not been isolated and since those who claimed to have done so were relying on "isolates" of
  56. previous "human coronaviruses", we began to do a thorough review of those claimed isolates.
  57. Specifically, we reviewed the alleged isolation work of suspected human coronaviruses 229E (said
  58.  
  59. to have been isolated in 1965), OC43 (in 1967), SARS-CoV (in 2003), NL63 (in 2004), HKU1 (in
  60. 2005) and MERSCoV (in 2012). And these have been the results:
  61.  
  62. Coronavirus 229E.
  63.  
  64. Reference article: Dorothy Hamre and John Procknow. A new virus isolated from the human
  65. respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1:
  66. 190-193. January 1, 1966.
  67.  
  68. Since the authors refer to other articles to explain the method of isolation - which they call
  69. Complement Fixation - we consulted a reference article for that method: that of Janet W. Hartley
  70. et al. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5):
  71.  
  72. 931-938, May 1965. This is a procedure already in disuse that uses the antigen-antibody reaction
  73. to detect either one or the other. In the case we are dealing with, the aim was to detect the
  74. antigens of the supposed new virus but, as we have already explained, specific antibodies are
  75. needed which cannot be obtained the first time a virus is detected.
  76.  
  77. Coronavirus OC43.
  78.  
  79. Reference article: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong.
  80. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU
  81. Scholars Hub.
  82.  
  83. What was considered to be viral RNA was extracted from cultures without any proof that the
  84. RNA belongs to a virus. The tool used - a QIAamp kit - removes reagents, inhibitors and
  85. contaminants but what it cannot do is determine where the extracted RNA comes from. And
  86. there are no controls. It is then amplified by PCR and sequenced assuming (!) that it is genetic
  87.  
  88. information of a virus. Finally, the author speculates about mutations, recombinations, genotypes,
  89. molecular evolution, strains and other jargon that conveys the idea -unproven- that a "virus" is
  90. being worked with.
  91.  
  92. SARS-CoV Coronavirus.
  93.  
  94. Reference article: J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet
  95. 361: 1319-25, April 2003.
  96.  
  97. There is no mention of purification in the article. There is not even any mention of filtration or
  98. centrifugation. It is only stated that "the viruses were isolated in fetal monkey liver cells from
  99. nasopharyngeal aspirates and lung biopsies of two patients". There are no controls. The only
  100. mention is of a "cytopathic effect" that is attributed to a virus and that PCR was done for known
  101.  
  102. viruses and retroviruses without obtaining results. Finally, RT-PCR was done with "random
  103. initiators" and a sequence "of unknown origin" is detected to which "a weak homology with the
  104. coronaviridiae family" is found. Then they designed primers for that sequence and when testing 44
  105. samples from SARS patients only 22 were positive.
  106.  
  107. Coronavirus NL63.
  108.  
  109. Reference article: Lia van der Hock and others. Identification of a new human coronavirus.
  110. Nature Medicine, 10, 4 April 2004.
  111.  
  112. The authors state that "the identification of unknown pathogens using molecular biology tools is
  113. difficult because the target sequence is not known so that PCR-specific initiators cannot be
  114. designed".
  115.  
  116. What they used is a tool they developed themselves called VIDISCA which, they claim, does not
  117. require prior knowledge of the sequence! Is that possible? Let's see how it works: first the culture
  118. is prepared and it is assumed that a virus is present due to the evidence of "cytopathic effect".
  119. The novelty introduced by this method is that "restriction enzymes" are added, enzymes that cut
  120. the nucleic acid molecules at certain locations and always by the same length. In this way, if after
  121. the action of these enzymes they observe many fragments of DNA or RNA that are the same or
  122. very similar, they deduce that it comes from a virus, since the host genome would present random
  123. cuts, while the virus genome presents a large number of copies that are the same due to the
  124.  
  125. replication of the virus. And is such a deduction correct? Of course not! This assumption (which
  126. adds to the previous assumption that there is a virus) does not take into account that there are
  127. "virus-like particles", "retrovirus-like particles", "endogenous retroviruses", "exosomes",
  128. "extracellular" particles and even mitochondrial DNA. In denial, there are a multitude of particles
  129. that possess the same reproductive characteristics in large quantities as "viruses" and therefore
  130. can falsify results by producing large numbers of identical copies when cut by enzymes as
  131. recognised in an article on the VIDISCA technique entitled Enhanced bioinformatic proSling of
  132. VIDISCA libraries for virus detection and Discovery. It was published in volume 263 of Virus
  133. Research on April 2, 2019, and its authors-Cormac M. Kinsella et al.-recognise that "no
  134. redundancy is expected in the VIDISCA insert from the host background nucleic acid except in
  135. the case of 'virus-like' characteristics, i.e., high copy numbers as in mitochondrial DNA.
  136.  
  137. Coronavirus HKU1.
  138.  
  139. Reference article: Patrick C. Y. Woo and others. Characterisation and Complete Genome
  140. Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of
  141. Virology, 79, 2, January 2005.
  142.  
  143. The article, incredibly, begins with these words: "Despite extensive research in patients with
  144. respiratory tract infections, no microbiological cause has been identified in a significant
  145. proportion of patients. RNA is extracted from non-purified cultures.” And a PCR with coronavirus
  146. genes is used. For the sequencing they use two protein databases organised in families, domains
  147.  
  148. and functional sites -PFAM and INterProScan- combined with two computer programs that carry
  149. out "predictions" on how nucleotides should be combined. The text adds: "The sequences were
  150. manually assembled and edited to produce a final sequence of the viral genome". And once
  151. again there are no controls.
  152.  
  153. MERS-CoV Coronavirus.
  154.  
  155. Reference article: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man with
  156. Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012.
  157.  
  158. The genetic material is extracted directly from the culture supernatant and sputum sample with
  159. a tool called High Puré Viral Nucleic Acid Kit and then tested with different PCRs for various
  160. known microorganisms. There is no mention of purification and there are no controls.
  161.  
  162. In short, what had been done with the first coronaviruses -and with many other supposed
  163. viruses- is to cultivate supposedly infected tissues - any "cytopathic effect” was attributed to
  164. the presence of a virus only - and then either some proteins are obtained which without any
  165. test are considered "virus antigens" and when these "antigens" are detected in cultures it is
  166. interpreted as "isolation", or fragments of nucleic acids are extracted assuming that they
  167. belong to a virus.
  168.  
  169. We already explained in the article published in the previous issue of the magazine that according
  170. to Dr. Stefan Lanka the so-called "cytopathic effect" is actually an effect caused by the
  171. conditions of the culture itself. This is recognised for example in the article Antibiotic-induced
  172. release of small extracellular vesicles (exosomes) with surface-associated DNA published on
  173. August 15, 2017 on the website of Nature and signed by Andrea Németh and others
  174. (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdf
  175. It explains that certain substances -such as antibiotics- added to in vitro experiments can stress
  176. the cell cultures so that they generate new sequences that had not been previously detected. This
  177. had already been noticed by none other than Dr. Barbara McClintock in 1983 during her Nobel
  178. Prize lecture, as can be seen at https://www.nobelprize.org/uploads/2018/06/mcclintocklecture.
  179. pdf
  180.  
  181. In essence, NOT ONE OF THE SEVEN SUPPOSED HUMAN CORONAVIRUS HAS REALLY
  182. BEEN ISOLATED. The only thing that has been different between them are the laboratory
  183. procedures and techniques that were becoming progressively more sophisticated which, in this
  184. case, has implied not a greater accuracy but a greater capacity for deception and self-deception
  185. that has culminated in the virtual manufacture of the SARS-CoV-2.
  186.  
  187. And the obvious consequence of the lack of evidence of its isolation is that such "coronaviruses"
  188. cannot be held responsible for any disease. Moreover, all tests - of whatever kind - based on
  189. the presumed components of these "viruses" (nucleic acids or proteins) are completely
  190. disqualified as "infection tests" and even more as "diagnostics" of diseases.
  191.  
  192. MORE UNANSWERED REQUESTS
  193.  
  194. In the previous issue we already collected the answers given by the authors of several articles that
  195. supposedly described the isolation of SARS-CoV-2 in which they acknowledged that they had not
  196. "purified" which implicitly means acknowledging that the virus was not isolated. And now we are
  197. going to add one more piece of evidence: the responses given by different authorities - political
  198. and health - from various countries about the purification and isolation of SARS-CoV-2.
  199.  
  200. James McCumiskey -author of the book The Latest Conspiracy: The Biomedical Paradigm- tells
  201. us that the National Virus Reference Laboratory of Ireland requested information about it from the
  202. University of Dublin and the latter responded that "it has no records that could provide an
  203. answer to their request". The director of legal services of the laboratory insisted on his request
  204. to the university and the university responded as follows: "The position of the university is that
  205. material of academic debate cannot be subject to the Freedom of Information Act". It follows from
  206. the NVR's request that they have not cultivated SARS-CoV-2 or purified it. They only
  207. acknowledge having "detected SARS-CoV-2 RNA in diagnostic samples.”
  208.  
  209. On June 22, a group of experts sent a consultation in similar terms to British Prime Minister Boris
  210. Johnson. The letter was signed by Dr. Kevin Corbett, Piers Corbyn - professor at Imperial
  211. College London -, the engineer and independent researcher - who we interviewed in the journal at
  212. the time -David Crowe, Dr. Andrew Kaufman, the Edinburgh professor of biology Roger
  213. Watson and the biologist and chemist David Rasnick - and to this day they still have not
  214. received a reply!
  215.  
  216. Another similar request - in this case to the National Research Council of Canada - received the
  217. following response: "We have not been able to carry out a complete search of the NRC's records
  218. so we regret to inform you that no records have been identified that respond to your request.”
  219.  
  220. We will add that two journalists have been sending similar requests - under the Freedom of
  221. Information Act - to various institutions in Canada, New Zealand, Australia, Germany, the United
  222. Kingdom and the United States, and as of September 5, twelve institutions have responded, all
  223.  
  224. indicating the same thing: that they have no record of work describing the isolation of the
  225. virus that is supposed to cause Covid-19. The details and the answers can be seen at
  226.  
  227. https://www.fluoridefreepeel.ca/u-k-dept-of-health-and-social-care-has-no-record-ofcovid-
  228. 19-virus-isolation/
  229.  
  230. LOOKING FOR THE ORIGIN OF THE FALSE GENOME
  231.  
  232. The question we asked ourselves then was: if the sequences that have been published do not
  233. belong - as claimed- to new viruses, where do they come from? And to try to answer that
  234. question we decided to carry out a search with a computer program called Basic Local Alignment
  235.  
  236. Search Tool (BLAST), a sequence alignment search tool that allows us to compare a given
  237. sequence with all the sequences stored in the National Institutes of Health of the United States (it
  238. is public and can be consulted at https://blast.ncbi.nlm.nih.gov/Blast.cgi. We explain step by
  239. step what we did so that our readers can repeat the search for themselves and check the results.
  240.  
  241. First we collected all the initiators of the PCRs described in the protocols hosted on the WHO
  242. website at the time which were these:
  243.  
  244. -China CDC protocol: uses ORF1ab and N genes as target.
  245. - Protocol of the Pasteur Institute (France): uses two fragments of the RdRP (which is supposed to
  246. be SARS.CoV-2 specific).
  247. -United States CDC protocol: uses three fragments of the N gene.
  248. - Protocol of the National Institute of Infectious Diseases of Japan: it is the only one that has as
  249. target the S gene together with other genes supposedly shared with other coronaviruses.
  250. - Charite Protocol (Germany): uses the E, N and RdRP genes.
  251. -Hong Kong University Protocol: uses ORF1b-nsp14 and N gene.
  252. -National Institute of Health Thailand protocol: uses the N gene.
  253. We then introduced the sequence of the primers - the one that indicates the beginning of the
  254. sequence to be detected (forward) and the one that indicates the final (reverse) - into the BLAST
  255. so that it could search for them in two databases: a collection of microbe genomes and the one
  256. corresponding to the human genome.
  257.  
  258. THE SEQUENCES OF THE SO-CALLED SARS-COV-2 ARE FOUND BOTH IN
  259. HUMANS AND IN NUMEROUS MICROBES!
  260.  
  261. Let's see in detail the procedure taking as an example the initiators of the French protocol. Once
  262. on the BLAST website, we chose Microbes to search the microbial genome databases and moved
  263. to the next page. Then a form appeared in which we entered the sequence of the forward initiator
  264. of the French protocol -that is ATGAGCTTAGTCCTGTG-, we selected the option Highly similar
  265. sequences and pressed the BLAST key. Just a few seconds later the results appeared -we took a
  266. screenshot (image 1)- and we were shown 100 sequences of microbes -particularly bacteria and
  267. archaea- with a coincidence of between 77% and 100% with an identity percentage of 100%.
  268.  
  269. We then returned to the home page and that second time we chose Human to search the human
  270.  
  271. genome, we repeated the same operation and after a few seconds the result appeared which we
  272. screen captured again (image 2). And it turns out that the sequence entered coincides with 74
  273. sequences of the human genome, with a coincidence of between 66% and 100% and a
  274. percentage of identity of 100%.
  275.  
  276. And that indicates that the sequence of that initial PCR primer that is supposed to be specific
  277. to SARS-CoV-2 actually corresponds to 74 fragments of the human genome and a hundred
  278. microbial fragments as well!
  279.  
  280. We then decided to repeat the operation but with the final or reverse primer - which is
  281. CTCCCTTTGTGTGTGT - and the results were similar.
  282.  
  283. Since these were very short sequences -about twenty genetic letters or nucleotides- we decided
  284. to try again but with the target sequence defined by these two primers, i.e. the sequence of the
  285. supposed SARS-CoV-2 genome that is between the initial primer and the final primer. Obviously,
  286. for this we needed the sequence that is officially claimed to be the "SARS-CoV-2 genome" and
  287. although thousands of laboratories claim to have isolated and sequenced it -a false claim as we
  288. have explained in previous reports- we decided to go to the National Centre for Biotechnology
  289.  
  290. Information website: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?
  291. report=genbank&to=29903. Once there, we located the "target sequence", a fragment of 108
  292. nucleotides located between positions 12,690 and 12,797 of the "genome", which is this one:
  293.  
  294. ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT
  295.  
  296. GACAATGCGTTAGCTTACAACAACAAAGGGAG.
  297.  
  298. With this we repeated the steps previously described and the results were again surprising since
  299. there appeared again a hundred microbe sequences with a percentage of a match of 100%
  300. and four sequences of the human genome with an identity percentage between 83% and
  301. 95%. The matches were therefore lower but the important thing is that we continue to find
  302. fragments of the supposed "target sequence" of SARS-CoV-2 both in microbes and in our
  303. own genome.
  304.  
  305. Truly astonished we took a further step and tested with the gene considered at that time as the
  306. most specific of SARS-CoV-2, the E gene that is supposed to generate the envelope proteins and
  307. is located between positions 26,245 and 26,472:
  308.  
  309. ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCT
  310. TTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTG
  311. TTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG
  312. ATTCTGGTCTAA.
  313.  
  314. We repeated with it the steps already described and the result was even more surprising because
  315. despite its length another hundred microbe sequences appeared with a percentage of
  316. identity of 100% and 10 sequences of the human genome with a percentage of identity
  317. between 80% and 100%. And similar results were obtained with a fragment chosen at
  318. random and with the N gene which they say corresponds to the proteins of the SARS-CoV-2
  319. nucleocapsid.
  320.  
  321. We finally decided to test with the S gene which is said to generate the structural "spike" proteins
  322. that are key to entry into the cell and was subsequently considered to be the most specific SARSCoV-
  323. 2 gene. Since it is a gene whose sequence is much longer - 3821 nucleotides between
  324. positions 21,563 and 25,384 - we tested with two fragments chosen at random within that gene
  325. and the first -TTGGCAAAATTCAAGACTCACTTTC - resulted in another hundred microbe
  326. sequences and 93 sequences of the human genome and the second -
  327. CTTGCTGCTACTAAATGCAGAGTGT - a hundred microbial sequences and 90 of the human
  328. genome.
  329.  
  330. Finally we decided to test with the initiators of the Japan Protocol, the only one that includes
  331. target sequences of the S gene and, the reader will have already guessed, the results were once
  332.  
  333. again similar: a hundred microbe sequences and 93 sequences of the human genome with
  334. an identity percentage between 94.12% and 100%!
  335.  
  336. CONCLUSIONS
  337.  
  338. The consequence of all that we have just explained is clear and immediate: THERE IS NO VALID
  339. TEST TO DETECT SARS-COV-2, neither antibody or antigen tests nor RT-PCR. And we included
  340. those based on the supposed gene that codes for the S1 or spike protein. And that means that
  341.  
  342. ALL THE NUMBERS OF "CASES", "INFECTED", “SICK", "Asymptomatic" OR "DEAD DUE
  343. TO COVID-19" LACK A SCIENTIFIC BASE AND ALL “POSITIVES” ARE FALSE POSITIVES,
  344.  
  345. something that should be communicated immediately to those affected and those responsible
  346. should be held accountable.
  347.  
  348. We end by adding that even the WHO itself does not really believe in these tests. Just read the
  349. document published last September 11 as a laboratory guide for SARS-CoV-2 entitled Diagnostic
  350. tests for SARS-CoV-2 - it is available at https://apps.who.int/iris/rest/bitstreams/1302661/
  351. retrieve - and it literally says on page 5: "Whenever possible, suspected active infection should
  352. be tested with a nucleic acid amplification test (NAAT) such as RT-PCR. NAAT tests should target
  353. the SARS-CoV-2 genome but since there is no known global circulation of SARS-CoV-1 a
  354. Sarbecovirus sequence (presumed to include at least five human and animal coronaviruses
  355. including SARS-CoV-1 and SARS-Cov-2) is also a reasonable target". That is, WHO agrees to
  356. use non-specific sequences to detect SARS-CoV-2.
  357.  
  358. That is not all because the manual later states, "An optimal diagnosis consists of a NAAT test with
  359. at least two genome-independent targets of the SARS-CoV-2; however, in areas where
  360. transmission is widespread, a simple single-target algorithm can be used.”
  361.  
  362. The WHO manual states, "One or more negative results do not necessarily rule out SARSCoV-
  363. 2 infection. There are a number of factors that can produce a negative result in an infected
  364. individual including poor quality of the sample, late collection of the sample, inadequate handling,
  365. or technical reasons inherent in the test, such as mutation of the virus or inhibition of PCR.”
  366.  
  367. What are the judges waiting for to act on their own initiative?
  368.  
  369. Jesus Garcia Blanca
  370.  
  371. Note: the author publicly thanks Juan Pedro Aparicio Alcaraz for his patient and meticulous
  372. collaborative work in the search for scientific articles and for his tedious work with the BLAST.
  373.  
  374. THIS REPORT APPEARS IN (https://www.dsalud.com/revistas/numero-242-noviembre-2020/)
  375.  
  376.  
  377.  
  378.  
Advertisement
Add Comment
Please, Sign In to add comment