Objective: Luminescent plants


Methods:
1. First, the luxABCDE gene will be isolated from the plasmid pGEN-luxCDABE via restriction enzyme PmeI + SacI, which will cut at the beginning of the luxA gene, and end after the terminator at luxE.
2. The isolated lux genes will be amplified with PCR, the required primers (CATATGAAGCTTGGTACCGGGATC)5’ and (CTTTCGGGAAAGATTTCAACCTGG)3’ will be obtained and added to the master solution
3. After amplification, the DNA will then be inserted into another plasmid (pBabe puro H-Ras 12V (35S)). The 35S mutation was chosen as it is a very strong promoter, and the gene is more likely to be expressed. To insert, the DNA will be cut using the restriction enzyme EcoRI which will make a cut at the end of the promoter. The lux gene will then be inserted.
4. The promoter plasmid will be transformed into e. Coli and multiplied.  The Plasmid DNA will then be extracted using the protocol outlined here http://openwetware.org/wiki/Miniprep/Qiagen_kit
5. Agrobacterium tumefaciens will be used as the insertion vector for the lux gene into the plant.
6. The plasmid will be integrated with the Agrobacterium  using electroporation and the bacteria will be cultured on petridishes containing Puromycin, as it is the marker for our plasmid.
7. Using the protocol outlined here: http://www.plantpath.wisc.edu /fac/afb/protocols arobitosis will be grown and infected by the agrobacterium.


https://www.addgene.org/12588/
https://www.addgene.org/44918/