DNA Oligo Analyzer Calc

import pandas as pd
import math
import os
import numpy.random as rd

class DNA():
    '''This is a class for DNA sequences and their properties. All that you needed is pandas and an excel or csv sheet
    formatted such that the first column is the sequence name and the second column is the sequence.

    Ex:
    Sequence 1, ATGCGCGATCGATCGATGGACTTAGCAAATCGCT
    Sequence 2, ACTACTACTCGCATGCATACGGACGACTGACTG
    ...

    Calculations are taken from http://biotools.nubic.northwestern.edu/OligoCalc.html#helpbasic'''

    def __init__(self,name,sequence):
        #   Basic sequence information
        self.name = name
        self.sequence = sequence
        self.baselength = len(sequence)

        #   Count the number of the respective nucleotides
        self.num_As = sequence.count('A')
        self.num_Ts = sequence.count('T')
        self.num_Gs = sequence.count('G')
        self.num_Cs = sequence.count('C')

        #   Basic Salt information units = M
        self.sodium = 0.050
        self.magnesium = 0

    def GC_content(self):
        '''Simple percentage of G and C out of total sequence'''
        gc = ((self.num_Cs + self.num_Gs) / self.baselength)*100
        return int(gc)


    def AnHydro_MolWeight(self):
        '''Calculation: (Anhydrous Molecular Weight = (An x 313.21) + (Tn x 304.2) + (Cn x 289.18) + (Gn x 329.21) - 61.96)
        Taken from http://biotools.nubic.northwestern.edu/OligoCalc.html#helpbasic'''
        mol = (self.num_As * 313.21) + (self.num_Ts * 304.2) + (self.num_Cs * 289.18) + (self.num_Gs * 329.21) - 61.96
        return int(mol)

    def Melting_Temp(self):
        '''Calculation: (Tm= 100.5 + (41 * (yG+zC)/(wA+xT+yG+zC)) - (820/(wA+xT+yG+zC)) + 16.6*log10([Na+]))
        Taken from http://biotools.nubic.northwestern.edu/OligoCalc.html#helpbasic'''
        tm = Tm= 100.5 + (41 * (self.num_Gs+self.num_Cs)/(self.num_As+self.num_Ts+self.num_Gs+self.num_Cs)) - (820/(self.num_As+self.num_Ts+self.num_Gs+self.num_Cs)) + 16.6*math.log10(self.sodium)
        return int(tm)

    def Estimate_Ext_Coeff(self):
        '''Calculation: (E260 = ( (nA × 15.4) + (nC × 7.4) + (nG × 11.5) + (nT × 8.7) ) × 0.9 × 1000)
        Taken from https://www.atdbio.com/content/1/Ultraviolet-absorbance-of-oligonucleotides#Calculation-of-extinction-coefficient'''
        e = ((self.num_As * 15.4) + (self.num_Cs * 7.4) + (self.num_Gs * 11.5) + (self.num_Ts * 8.7)) * 0.9 * 1000
        return int(e)

class Optical():
    '''Next is a class made for calculating concentration from absorbance'''

    def __init__(self,absorbance, extinction):
        self.Abs = absorbance
        self.path = 1   #   path is either 1 or 0.3 cm from mm
        self.ext_coeff = extinction
        self.dilution =  100

    def Concentration(self):
        conc = ((((self.Abs)/(self.path*self.ext_coeff))*self.dilution)/1E-6)
        return conc

#   read the data into a DataFrame
file =  'dna_seq.csv' #input('Please enter sequence file name:')
df = pd.read_csv(str(file))

Info_Table = pd.DataFrame()

#   Loop through the given sequences
for i in range(0,len(df["Seq"])):

    #   add some random absorbance data
    df.loc[i,'Absorbance'] = rd.random()

    #    call the DNA class
    dna = DNA(df.loc[i,"Name"],df.loc[i,"Seq"])
    #   Once called the salts can be changed to adjust the melting temp
    dna.sodium = 0.050

    #   Here trying to calculate the concentration
    optics = Optical(df.loc[i,'Absorbance'],dna.Estimate_Ext_Coeff())

    #    print the whatever dna properties...
    Info_Table.loc[i,'Sequence Name'] = dna.name
    Info_Table.loc[i,'Sequence'] = dna.sequence
    Info_Table.loc[i, "Molecular Weight (g/mol)"] = dna.AnHydro_MolWeight()
    Info_Table.loc[i,"Melting Temp (C)"] = dna.Melting_Temp()
    Info_Table.loc[i,"GC Content (%)"] = dna.GC_content()
    Info_Table.loc[i,"Length"] = dna.baselength
    Info_Table.loc[i,'Estimate Exctinction (M-1 cm-1)'] = dna.Estimate_Ext_Coeff()
    Info_Table.loc[i,'Concentration (mM)'] = round(optics.Concentration(),3)
    Info_Table.loc[i,'Absorbance'] = round(optics.Abs,3)

#   pick an export file
export = 'data.csv'

#   Export to file, make sure the method and the filetype match
Info_Table.to_csv(export)

#   Print the file name and the PATH
print('--Results saved as:(' + export + ') --In path:' + os.getcwd())