API tools faq
paste
Advertisement
Guest User

Bismark v0.14.2 log

a guest
Apr 16th, 2015
81
0
Never
Add comment
Not a member of Pastebin yet? Sign Up, it unlocks many cool features!
text 33.79 KB | None | 0 0
raw download clone embed print report
  1. Path to Bowtie 2 specified as: bowtie2
  2. Output format is BAM (default)
  3. Alignments will be written out in BAM format. Samtools found here: '/home/enrico16/bin/samtools'
  4. Reference genome folder provided is /home/enrico16/analysis/00genome/ (absolute path is '/home/enrico16/analysis/00genome/)'
  5. FastQ format assumed (by default)
  6. Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if needed!
  7. Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
  8. Output will be written into the directory: /home/enrico16/analysis/05alignment/SampleX/
  9.  
  10. Using temp directory: /home/enrico16/analysis/05alignment/SampleX
  11. Temporary files will be written into the directory: /home/enrico16/analysis/05alignment/SampleX/
  12. Running Bismark Parallel version. Number of parallel instances to be spawned: 2
  13.  
  14.  
  15. Paired-end alignments will be performed
  16. =======================================
  17.  
  18. The provided filenames for paired-end alignments are /home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz and /home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair2.fastq.gz
  19.  
  20. Paired-end alignments will be performed
  21. =======================================
  22.  
  23. The provided filenames for paired-end alignments are /home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz and /home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair2.fastq.gz
  24. Finished subdividing /home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz for PID: 8809 and offset 2
  25.  
  26. Using the subset file >/home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.2< as new in-file 1 (instead of >/home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz<)
  27. Finished subdividing /home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz for PID: 0 and offset 1
  28.  
  29. Using the subset file >/home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.1< as new in-file 1 (instead of >/home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz<)
  30. Finished subdividing /home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair2.fastq.gz for PID: 8809 and offset 2
  31.  
  32. Using the subset file >/home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.2< as new in-file 2 (instead of >/home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair2.fastq.gz<)
  33. Input files are in FastQ format
  34. Finished subdividing /home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair2.fastq.gz for PID: 0 and offset 1
  35.  
  36. Using the subset file >/home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.1< as new in-file 2 (instead of >/home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair2.fastq.gz<)
  37. Input files are in FastQ format
  38. Writing a C -> T converted version of the input file SampleX-trimmed-pair1.fastq.gz.temp.2 to /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.2_C_to_T.fastq
  39. Writing a C -> T converted version of the input file SampleX-trimmed-pair1.fastq.gz.temp.1 to /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.1_C_to_T.fastq
  40.  
  41. Created C -> T converted version of the FastQ file SampleX-trimmed-pair1.fastq.gz.temp.2 (45829608 sequences in total)
  42.  
  43.  
  44. Created C -> T converted version of the FastQ file SampleX-trimmed-pair1.fastq.gz.temp.1 (45829609 sequences in total)
  45.  
  46. Writing a G -> A converted version of the input file SampleX-trimmed-pair2.fastq.gz.temp.2 to /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.2_G_to_A.fastq
  47. Writing a G -> A converted version of the input file SampleX-trimmed-pair2.fastq.gz.temp.1 to /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.1_G_to_A.fastq
  48.  
  49. Created G -> A converted version of the FastQ file SampleX-trimmed-pair2.fastq.gz.temp.2 (45829608 sequences in total)
  50.  
  51. Input files are SampleX-trimmed-pair1.fastq.gz.temp.2_C_to_T.fastq and SampleX-trimmed-pair2.fastq.gz.temp.2_G_to_A.fastq (FastQ)
  52. Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/enrico16/analysis/00genome/ with the specified options: -q --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --maxins 500
  53.  
  54. Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.2_C_to_T.fastq and /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --maxins 500 --norc))
  55.  
  56. Created G -> A converted version of the FastQ file SampleX-trimmed-pair2.fastq.gz.temp.1 (45829609 sequences in total)
  57.  
  58. Input files are SampleX-trimmed-pair1.fastq.gz.temp.1_C_to_T.fastq and SampleX-trimmed-pair2.fastq.gz.temp.1_G_to_A.fastq (FastQ)
  59. Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/enrico16/analysis/00genome/ with the specified options: -q --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --maxins 500
  60.  
  61. Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.1_C_to_T.fastq and /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --maxins 500 --norc))
  62. Found first alignment:
  63. HISEQ-MFG:108:HFC37ADXX:1:1101:1280:1985_1:N:0:TGGTGA/1 99 5_CT_converted 30762821 42 101M = 30762876 156 NTATAAATAAAAAAAAATATATAGGGTAGATAATAATTTAAATATATAATTAGTTTTTATAAATTAATATTTTATGAAGATATGTTAAAGTATTTTTTTAA #1=DDFFFHHHHHJJJIEEGDFFFIGDDFBBGGGIC>FHHGGEEGHGHAHE;FHIII?GHIE:CEHAE@CEFFDD;AAC>CEDCDDCDAC>CDEDEDDDBD AS:i:-1 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:0A100 YS:i:0 YT:Z:CP
  64. HISEQ-MFG:108:HFC37ADXX:1:1101:1280:1985_2:N:0:TGGTGA/2 147 5_CT_converted 30762876 42 101M = 30762821 -156 TTTATAAATTAATATTTTATGAAGATATGTTAAAGTATTTTTTTAAAATAAAATATATAAAGAGGATGAGAAGTTAATTTATATATTAAAAAAGTATAAAT DCACADDCCEEECEEECC?:?@D@>EHCECEHDCIHGHGFEGGGJIIJIJIJJJJJJJJJIIIHFFBGF@H@HIJIHIJIJJIJJJJIDFGGHFFFFF@B@ AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:-1 YT:Z:CP
  65. Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.2_C_to_T.fastq and /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.2_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --maxins 500 --nofw))
  66. Found first alignment:
  67. HISEQ-MFG:108:HFC37ADXX:1:1101:1102:1988_1:N:0:TGGTGA/1 77 * 0 0 * * 0 0 NTAGTGTAAATATTGGAAAATTAGATTTTTTTTTTATAATAATATTGTATGTTTAAATTTTTAAGATTTTTGTTAAAATTAATATTAGTGAATAAAATTTT #1:ABDFFHHHHHGJIGHIJHHIJHHIJJJJJJIJGIGFGHGIEIJI@DHIGIHJJHHHHHCD>D@EEEDCCCDDDDDEDDCDDFEDEACACCCDDDEDAC YT:Z:UP
  68. HISEQ-MFG:108:HFC37ADXX:1:1101:1102:1988_2:N:0:TGGTGA/2 141 * 0 0 * * 0 0 ATTAACATTTTTACTATATTAATTCTTCTTATCCAAAATCACAATATATTTTTCCATAATTCAAATATTATATTATATTCATCAATAAAATTTCTCAAACA CCCFFFFFHHHHHJGIJJJJJJJJIGJIJJJJJJJJIEIIJJGGIGIIHJJJJIFHGGJDHHCFCGFGIGIIIJJJIIJIGIJIEHIGHCGHHEHHEDCDD YT:Z:UP
  69. Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.1_C_to_T.fastq and /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.1_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --maxins 500 --nofw))
  70. Found first alignment:
  71. HISEQ-MFG:108:HFC37ADXX:1:1101:1280:1985_1:N:0:TGGTGA/1 77 * 0 0 * * 0 0 NTATAAATAAAAAAAAATATATAGGGTAGATAATAATTTAAATATATAATTAGTTTTTATAAATTAATATTTTATGAAGATATGTTAAAGTATTTTTTTAA #1=DDFFFHHHHHJJJIEEGDFFFIGDDFBBGGGIC>FHHGGEEGHGHAHE;FHIII?GHIE:CEHAE@CEFFDD;AAC>CEDCDDCDAC>CDEDEDDDBD YT:Z:UP
  72. HISEQ-MFG:108:HFC37ADXX:1:1101:1280:1985_2:N:0:TGGTGA/2 141 * 0 0 * * 0 0 ATTTATACTTTTTTAATATATAAATTAACTTCTCATCCTCTTTATATATTTTATTTTAAAAAAATACTTTAACATATCTTCATAAAATATTAATTTATAAA @B@FFFFFHGGFDIJJJJIJJIJIHIJIH@H@FGBFFHIIIJJJJJJJJJIJIJIIJGGGEFGHGHICDHECECHE>@D@?:?CCEEECEEECCDDACACD YT:Z:UP
  73.  
  74. >>> Writing bisulfite mapping results to SampleX-trimmed-pair1.fastq.gz.temp.2_bismark_bt2_pe.bam <<<
  75.  
  76. Found first alignment:
  77. HISEQ-MFG:108:HFC37ADXX:1:1101:1102:1988_1:N:0:TGGTGA/1 83 7_GA_converted 16039576 42 101M = 16039304 -373 AAAATTTTATTCACTAATATTAATTTTAACAAAAATCTTAAAAATTTAAACATACAATATTATTATAAAAAAAAAATCTAATTTTCCAATATTTACACTAN CADEDDDCCCACAEDEFDDCDDEDDDDDCCCDEEE@D>DCHHHHHJJHIGIHD@IJIEIGHGFGIGJIJJJJJJIHHJIHHJIHGIJGHHHHHFFDBA:1# AS:i:-1 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:100A0 YS:i:0 YT:Z:CP
  78. HISEQ-MFG:108:HFC37ADXX:1:1101:1102:1988_2:N:0:TGGTGA/2 163 7_GA_converted 16039304 42 101M = 16039576 373 ATTAACATTTTTACTATATTAATTCTTCTTATCCAAAATCACAATATATTTTTCCATAATTCAAATATTATATTATATTCATCAATAAAATTTCTCAAACA CCCFFFFFHHHHHJGIJJJJJJJJIGJIJJJJJJJJIEIIJJGGIGIIHJJJJIFHGGJDHHCFCGFGIGIIIJJJIIJIGIJIEHIGHCGHHEHHEDCDD AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:-1 YT:Z:CP
  79.  
  80. >>> Writing bisulfite mapping results to SampleX-trimmed-pair1.fastq.gz.temp.1_bismark_bt2_pe.bam <<<
  81.  
  82. Current working directory is: /home/enrico16/analysis/02trimming
  83.  
  84. Now reading in and storing sequence information of the genome specified in: /home/enrico16/analysis/00genome/
  85.  
  86. Current working directory is: /home/enrico16/analysis/02trimming
  87.  
  88. Now reading in and storing sequence information of the genome specified in: /home/enrico16/analysis/00genome/
  89.  
  90. chr 1 (248956422 bp)
  91. chr 1 (248956422 bp)
  92. chr 10 (133797422 bp)
  93. chr 10 (133797422 bp)
  94. chr 11 (135086622 bp)
  95. chr 11 (135086622 bp)
  96. chr 12 (133275309 bp)
  97. chr 12 (133275309 bp)
  98. chr 13 (114364328 bp)
  99. chr 13 (114364328 bp)
  100. chr 14 (107043718 bp)
  101. chr 14 (107043718 bp)
  102. chr 15 (101991189 bp)
  103. chr 15 (101991189 bp)
  104. chr 16 (90338345 bp)
  105. chr 16 (90338345 bp)
  106. chr 17 (83257441 bp)
  107. chr 17 (83257441 bp)
  108. chr 18 (80373285 bp)
  109. chr 18 (80373285 bp)
  110. chr 19 (58617616 bp)
  111. chr 19 (58617616 bp)
  112. chr 2 (242193529 bp)
  113. chr 2 (242193529 bp)
  114. chr 20 (64444167 bp)
  115. chr 20 (64444167 bp)
  116. chr 21 (46709983 bp)
  117. chr 21 (46709983 bp)
  118. chr 22 (50818468 bp)
  119. chr 22 (50818468 bp)
  120. chr 3 (198295559 bp)
  121. chr 3 (198295559 bp)
  122. chr 4 (190214555 bp)
  123. chr 4 (190214555 bp)
  124. chr 5 (181538259 bp)
  125. chr 5 (181538259 bp)
  126. chr 6 (170805979 bp)
  127. chr 6 (170805979 bp)
  128. chr 7 (159345973 bp)
  129. chr 7 (159345973 bp)
  130. chr 8 (145138636 bp)
  131. chr 8 (145138636 bp)
  132. chr 9 (138394717 bp)
  133. chr 9 (138394717 bp)
  134. chr MT (16569 bp)
  135. chr MT (16569 bp)
  136. chr X (156040895 bp)
  137. chr X (156040895 bp)
  138. chr Y (57227415 bp)
  139. chr Y (57227415 bp)
  140. chr KI270728.1 (1872759 bp)
  141. chr KI270728.1 (1872759 bp)
  142. chr KI270727.1 (448248 bp)
  143. chr KI270727.1 (448248 bp)
  144. chr KI270442.1 (392061 bp)
  145. chr KI270729.1 (280839 bp)
  146. chr KI270442.1 (392061 bp)
  147. chr GL000225.1 (211173 bp)
  148. chr KI270729.1 (280839 bp)
  149. chr KI270743.1 (210658 bp)
  150. chr GL000225.1 (211173 bp)
  151. chr GL000008.2 (209709 bp)
  152. chr KI270743.1 (210658 bp)
  153. chr GL000009.2 (201709 bp)
  154. chr GL000008.2 (209709 bp)
  155. chr KI270747.1 (198735 bp)
  156. chr GL000009.2 (201709 bp)
  157. chr KI270722.1 (194050 bp)
  158. chr KI270747.1 (198735 bp)
  159. chr GL000194.1 (191469 bp)
  160. chr KI270722.1 (194050 bp)
  161. chr KI270742.1 (186739 bp)
  162. chr GL000194.1 (191469 bp)
  163. chr GL000205.2 (185591 bp)
  164. chr KI270742.1 (186739 bp)
  165. chr GL000195.1 (182896 bp)
  166. chr GL000205.2 (185591 bp)
  167. chr KI270736.1 (181920 bp)
  168. chr GL000195.1 (182896 bp)
  169. chr KI270733.1 (179772 bp)
  170. chr KI270736.1 (181920 bp)
  171. chr GL000224.1 (179693 bp)
  172. chr KI270733.1 (179772 bp)
  173. chr GL000219.1 (179198 bp)
  174. chr GL000224.1 (179693 bp)
  175. chr KI270719.1 (176845 bp)
  176. chr GL000219.1 (179198 bp)
  177. chr GL000216.2 (176608 bp)
  178. chr KI270719.1 (176845 bp)
  179. chr KI270712.1 (176043 bp)
  180. chr GL000216.2 (176608 bp)
  181. chr KI270706.1 (175055 bp)
  182. chr KI270712.1 (176043 bp)
  183. chr KI270725.1 (172810 bp)
  184. chr KI270706.1 (175055 bp)
  185. chr KI270744.1 (168472 bp)
  186. chr KI270725.1 (172810 bp)
  187. chr KI270734.1 (165050 bp)
  188. chr KI270744.1 (168472 bp)
  189. chr GL000213.1 (164239 bp)
  190. chr KI270734.1 (165050 bp)
  191. chr GL000220.1 (161802 bp)
  192. chr GL000213.1 (164239 bp)
  193. chr KI270715.1 (161471 bp)
  194. chr GL000220.1 (161802 bp)
  195. chr GL000218.1 (161147 bp)
  196. chr KI270715.1 (161471 bp)
  197. chr KI270749.1 (158759 bp)
  198. chr KI270741.1 (157432 bp)
  199. chr GL000218.1 (161147 bp)
  200. chr GL000221.1 (155397 bp)
  201. chr KI270749.1 (158759 bp)
  202. chr KI270716.1 (153799 bp)
  203. chr KI270741.1 (157432 bp)
  204. chr GL000221.1 (155397 bp)
  205. chr KI270731.1 (150754 bp)
  206. chr KI270716.1 (153799 bp)
  207. chr KI270751.1 (150742 bp)
  208. chr KI270731.1 (150754 bp)
  209. chr KI270750.1 (148850 bp)
  210. chr KI270519.1 (138126 bp)
  211. chr KI270751.1 (150742 bp)
  212. chr GL000214.1 (137718 bp)
  213. chr KI270750.1 (148850 bp)
  214. chr KI270708.1 (127682 bp)
  215. chr KI270519.1 (138126 bp)
  216. chr KI270730.1 (112551 bp)
  217. chr GL000214.1 (137718 bp)
  218. chr KI270438.1 (112505 bp)
  219. chr KI270708.1 (127682 bp)
  220. chr KI270737.1 (103838 bp)
  221. chr KI270730.1 (112551 bp)
  222. chr KI270721.1 (100316 bp)
  223. chr KI270438.1 (112505 bp)
  224. chr KI270738.1 (99375 bp)
  225. chr KI270737.1 (103838 bp)
  226. chr KI270748.1 (93321 bp)
  227. chr KI270721.1 (100316 bp)
  228. chr KI270435.1 (92983 bp)
  229. chr GL000208.1 (92689 bp)
  230. chr KI270738.1 (99375 bp)
  231. chr KI270748.1 (93321 bp)
  232. chr KI270538.1 (91309 bp)
  233. chr KI270435.1 (92983 bp)
  234. chr KI270756.1 (79590 bp)
  235. chr GL000208.1 (92689 bp)
  236. chr KI270739.1 (73985 bp)
  237. chr KI270757.1 (71251 bp)
  238. chr KI270538.1 (91309 bp)
  239. chr KI270709.1 (66860 bp)
  240. chr KI270756.1 (79590 bp)
  241. chr KI270746.1 (66486 bp)
  242. chr KI270739.1 (73985 bp)
  243. chr KI270753.1 (62944 bp)
  244. chr KI270757.1 (71251 bp)
  245. chr KI270589.1 (44474 bp)
  246. chr KI270726.1 (43739 bp)
  247. chr KI270709.1 (66860 bp)
  248. chr KI270735.1 (42811 bp)
  249. chr KI270746.1 (66486 bp)
  250. chr KI270711.1 (42210 bp)
  251. chr KI270745.1 (41891 bp)
  252. chr KI270753.1 (62944 bp)
  253. chr KI270714.1 (41717 bp)
  254. chr KI270589.1 (44474 bp)
  255. chr KI270732.1 (41543 bp)
  256. chr KI270726.1 (43739 bp)
  257. chr KI270713.1 (40745 bp)
  258. chr KI270735.1 (42811 bp)
  259. chr KI270754.1 (40191 bp)
  260. chr KI270711.1 (42210 bp)
  261. chr KI270710.1 (40176 bp)
  262. chr KI270745.1 (41891 bp)
  263. chr KI270717.1 (40062 bp)
  264. chr KI270714.1 (41717 bp)
  265. chr KI270724.1 (39555 bp)
  266. chr KI270732.1 (41543 bp)
  267. chr KI270720.1 (39050 bp)
  268. chr KI270713.1 (40745 bp)
  269. chr KI270723.1 (38115 bp)
  270. chr KI270754.1 (40191 bp)
  271. chr KI270718.1 (38054 bp)
  272. chr KI270710.1 (40176 bp)
  273. chr KI270317.1 (37690 bp)
  274. chr KI270717.1 (40062 bp)
  275. chr KI270740.1 (37240 bp)
  276. chr KI270724.1 (39555 bp)
  277. chr KI270755.1 (36723 bp)
  278. chr KI270707.1 (32032 bp)
  279. chr KI270720.1 (39050 bp)
  280. chr KI270579.1 (31033 bp)
  281. chr KI270723.1 (38115 bp)
  282. chr KI270752.1 (27745 bp)
  283. chr KI270718.1 (38054 bp)
  284. chr KI270512.1 (22689 bp)
  285. chr KI270322.1 (21476 bp)
  286. chr KI270317.1 (37690 bp)
  287. chr GL000226.1 (15008 bp)
  288. chr KI270311.1 (12399 bp)
  289. chr KI270366.1 (8320 bp)
  290. chr KI270740.1 (37240 bp)
  291. chr KI270511.1 (8127 bp)
  292. chr KI270448.1 (7992 bp)
  293. chr KI270521.1 (7642 bp)
  294. chr KI270581.1 (7046 bp)
  295. chr KI270755.1 (36723 bp)
  296. chr KI270582.1 (6504 bp)
  297. chr KI270515.1 (6361 bp)
  298. chr KI270588.1 (6158 bp)
  299. chr KI270591.1 (5796 bp)
  300. chr KI270707.1 (32032 bp)
  301. chr KI270522.1 (5674 bp)
  302. chr KI270507.1 (5353 bp)
  303. chr KI270590.1 (4685 bp)
  304. chr KI270584.1 (4513 bp)
  305. chr KI270579.1 (31033 bp)
  306. chr KI270320.1 (4416 bp)
  307. chr KI270382.1 (4215 bp)
  308. chr KI270468.1 (4055 bp)
  309. chr KI270467.1 (3920 bp)
  310. chr KI270362.1 (3530 bp)
  311. chr KI270752.1 (27745 bp)
  312. chr KI270517.1 (3253 bp)
  313. chr KI270593.1 (3041 bp)
  314. chr KI270528.1 (2983 bp)
  315. chr KI270587.1 (2969 bp)
  316. chr KI270364.1 (2855 bp)
  317. chr KI270371.1 (2805 bp)
  318. chr KI270512.1 (22689 bp)
  319. chr KI270333.1 (2699 bp)
  320. chr KI270374.1 (2656 bp)
  321. chr KI270411.1 (2646 bp)
  322. chr KI270414.1 (2489 bp)
  323. chr KI270322.1 (21476 bp)
  324. chr KI270510.1 (2415 bp)
  325. chr KI270390.1 (2387 bp)
  326. chr KI270375.1 (2378 bp)
  327. chr KI270420.1 (2321 bp)
  328. chr GL000226.1 (15008 bp)
  329. chr KI270509.1 (2318 bp)
  330. chr KI270315.1 (2276 bp)
  331. chr KI270302.1 (2274 bp)
  332. chr KI270311.1 (12399 bp)
  333. chr KI270518.1 (2186 bp)
  334. chr KI270530.1 (2168 bp)
  335. chr KI270304.1 (2165 bp)
  336. chr KI270366.1 (8320 bp)
  337. chr KI270418.1 (2145 bp)
  338. chr KI270424.1 (2140 bp)
  339. chr KI270417.1 (2043 bp)
  340. chr KI270511.1 (8127 bp)
  341. chr KI270508.1 (1951 bp)
  342. chr KI270303.1 (1942 bp)
  343. chr KI270448.1 (7992 bp)
  344. chr KI270381.1 (1930 bp)
  345. chr KI270529.1 (1899 bp)
  346. chr KI270521.1 (7642 bp)
  347. chr KI270425.1 (1884 bp)
  348. chr KI270396.1 (1880 bp)
  349. chr KI270363.1 (1803 bp)
  350. chr KI270581.1 (7046 bp)
  351. chr KI270386.1 (1788 bp)
  352. chr KI270465.1 (1774 bp)
  353. chr KI270582.1 (6504 bp)
  354. chr KI270383.1 (1750 bp)
  355. chr KI270384.1 (1658 bp)
  356. chr KI270515.1 (6361 bp)
  357. chr KI270330.1 (1652 bp)
  358. chr KI270372.1 (1650 bp)
  359. chr KI270548.1 (1599 bp)
  360. chr KI270588.1 (6158 bp)
  361. chr KI270580.1 (1553 bp)
  362. chr KI270387.1 (1537 bp)
  363. chr KI270591.1 (5796 bp)
  364. chr KI270391.1 (1484 bp)
  365. chr KI270305.1 (1472 bp)
  366. chr KI270373.1 (1451 bp)
  367. chr KI270522.1 (5674 bp)
  368. chr KI270422.1 (1445 bp)
  369. chr KI270316.1 (1444 bp)
  370. chr KI270507.1 (5353 bp)
  371. chr KI270340.1 (1428 bp)
  372. chr KI270338.1 (1428 bp)
  373. chr KI270590.1 (4685 bp)
  374. chr KI270583.1 (1400 bp)
  375. chr KI270334.1 (1368 bp)
  376. chr KI270584.1 (4513 bp)
  377. chr KI270429.1 (1361 bp)
  378. chr KI270393.1 (1308 bp)
  379. chr KI270320.1 (4416 bp)
  380. chr KI270516.1 (1300 bp)
  381. chr KI270389.1 (1298 bp)
  382. chr KI270382.1 (4215 bp)
  383. chr KI270466.1 (1233 bp)
  384. chr KI270388.1 (1216 bp)
  385. chr KI270468.1 (4055 bp)
  386. chr KI270544.1 (1202 bp)
  387. chr KI270310.1 (1201 bp)
  388. chr KI270467.1 (3920 bp)
  389. chr KI270412.1 (1179 bp)
  390. chr KI270395.1 (1143 bp)
  391. chr KI270362.1 (3530 bp)
  392. chr KI270376.1 (1136 bp)
  393. chr KI270337.1 (1121 bp)
  394. chr KI270517.1 (3253 bp)
  395. chr KI270335.1 (1048 bp)
  396. chr KI270593.1 (3041 bp)
  397. chr KI270378.1 (1048 bp)
  398. chr KI270528.1 (2983 bp)
  399. chr KI270379.1 (1045 bp)
  400. chr KI270329.1 (1040 bp)
  401. chr KI270587.1 (2969 bp)
  402. chr KI270419.1 (1029 bp)
  403. chr KI270336.1 (1026 bp)
  404. chr KI270312.1 (998 bp)
  405. chr KI270364.1 (2855 bp)
  406. chr KI270539.1 (993 bp)
  407. chr KI270371.1 (2805 bp)
  408. chr KI270385.1 (990 bp)
  409. chr KI270423.1 (981 bp)
  410. chr KI270333.1 (2699 bp)
  411. chr KI270392.1 (971 bp)
  412. chr KI270394.1 (970 bp)
  413. chr KI270374.1 (2656 bp)
  414.  
  415. chr KI270411.1 (2646 bp)
  416. chr KI270414.1 (2489 bp)
  417. chr KI270510.1 (2415 bp)
  418. chr KI270390.1 (2387 bp)
  419. chr KI270375.1 (2378 bp)
  420. chr KI270420.1 (2321 bp)
  421. chr KI270509.1 (2318 bp)
  422. chr KI270315.1 (2276 bp)
  423. chr KI270302.1 (2274 bp)
  424. chr KI270518.1 (2186 bp)
  425. chr KI270530.1 (2168 bp)
  426. chr KI270304.1 (2165 bp)
  427. chr KI270418.1 (2145 bp)
  428. chr KI270424.1 (2140 bp)
  429. chr KI270417.1 (2043 bp)
  430. chr KI270508.1 (1951 bp)
  431. chr KI270303.1 (1942 bp)
  432. chr KI270381.1 (1930 bp)
  433. chr KI270529.1 (1899 bp)
  434. chr KI270425.1 (1884 bp)
  435. chr KI270396.1 (1880 bp)
  436. chr KI270363.1 (1803 bp)
  437. chr KI270386.1 (1788 bp)
  438. chr KI270465.1 (1774 bp)
  439. chr KI270383.1 (1750 bp)
  440. chr KI270384.1 (1658 bp)
  441. chr KI270330.1 (1652 bp)
  442. chr KI270372.1 (1650 bp)
  443. chr KI270548.1 (1599 bp)
  444. chr KI270580.1 (1553 bp)
  445. chr KI270387.1 (1537 bp)
  446. chr KI270391.1 (1484 bp)
  447. chr KI270305.1 (1472 bp)
  448. chr KI270373.1 (1451 bp)
  449. chr KI270422.1 (1445 bp)
  450. chr KI270316.1 (1444 bp)
  451. chr KI270340.1 (1428 bp)
  452. chr KI270338.1 (1428 bp)
  453. chr KI270583.1 (1400 bp)
  454. chr KI270334.1 (1368 bp)
  455. chr KI270429.1 (1361 bp)
  456. chr KI270393.1 (1308 bp)
  457. chr KI270516.1 (1300 bp)
  458. chr KI270389.1 (1298 bp)
  459. chr KI270466.1 (1233 bp)
  460. chr KI270388.1 (1216 bp)
  461. chr KI270544.1 (1202 bp)
  462. chr KI270310.1 (1201 bp)
  463. chr KI270412.1 (1179 bp)
  464. chr KI270395.1 (1143 bp)
  465. chr KI270376.1 (1136 bp)
  466. chr KI270337.1 (1121 bp)
  467. chr KI270335.1 (1048 bp)
  468. chr KI270378.1 (1048 bp)
  469. chr KI270379.1 (1045 bp)
  470. chr KI270329.1 (1040 bp)
  471. chr KI270419.1 (1029 bp)
  472. chr KI270336.1 (1026 bp)
  473. chr KI270312.1 (998 bp)
  474. chr KI270539.1 (993 bp)
  475. chr KI270385.1 (990 bp)
  476. chr KI270423.1 (981 bp)
  477. chr KI270392.1 (971 bp)
  478. chr KI270394.1 (970 bp)
  479.  
  480.  
  481. Reading in the sequence files /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.1 and /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.1
  482.  
  483. Reading in the sequence files /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.2 and /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.2
  484. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:1:1103:7037:86167_1:N:0:TGGTGA KI270467.1 3819
  485. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:1:1104:11259:2224_1:N:0:TGGTGA KI270337.1 2
  486. Processed 1000000 sequence pairs so far
  487. Processed 1000000 sequence pairs so far
  488. Processed 2000000 sequence pairs so far
  489. Processed 2000000 sequence pairs so far
  490. Processed 3000000 sequence pairs so far
  491. Processed 3000000 sequence pairs so far
  492. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:1:1111:12667:101169_1:N:0:TGGTGA KI270738.1 1
  493. Processed 4000000 sequence pairs so far
  494. Processed 4000000 sequence pairs so far
  495. Processed 5000000 sequence pairs so far
  496. Processed 5000000 sequence pairs so far
  497. Processed 6000000 sequence pairs so far
  498. Processed 6000000 sequence pairs so far
  499. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:1:1201:8205:62303_1:N:0:TGGTGA KI270584.1 4414
  500. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:1:1204:2112:18281_1:N:0:TGGTGA KI270709.1 2
  501. Processed 7000000 sequence pairs so far
  502. Processed 7000000 sequence pairs so far
  503. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:1:1205:2516:26717_1:N:0:TGGTGA KI270466.1 1133
  504. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:1:1206:6007:67535_1:N:0:TGGTGA MT 1
  505. Processed 8000000 sequence pairs so far
  506. Processed 8000000 sequence pairs so far
  507. Processed 9000000 sequence pairs so far
  508. Processed 9000000 sequence pairs so far
  509. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:1:1211:3180:52060_1:N:0:TGGTGA KI270709.1 2
  510. Processed 10000000 sequence pairs so far
  511. Processed 10000000 sequence pairs so far
  512. Processed 11000000 sequence pairs so far
  513. Processed 11000000 sequence pairs so far
  514. Processed 12000000 sequence pairs so far
  515. Processed 12000000 sequence pairs so far
  516. Processed 13000000 sequence pairs so far
  517. Processed 13000000 sequence pairs so far
  518. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:1:2107:2805:52591_1:N:0:TGGTGA KI270738.1 1
  519. Processed 14000000 sequence pairs so far
  520. Processed 14000000 sequence pairs so far
  521. Processed 15000000 sequence pairs so far
  522. Processed 15000000 sequence pairs so far
  523. Processed 16000000 sequence pairs so far
  524. Processed 16000000 sequence pairs so far
  525. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:1:2115:14930:32016_1:N:0:TGGTGA KI270738.1 1
  526. Processed 17000000 sequence pairs so far
  527. Processed 17000000 sequence pairs so far
  528. Processed 18000000 sequence pairs so far
  529. Processed 18000000 sequence pairs so far
  530. Processed 19000000 sequence pairs so far
  531. Processed 19000000 sequence pairs so far
  532. Processed 20000000 sequence pairs so far
  533. Processed 20000000 sequence pairs so far
  534. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:1:2209:17422:84192_1:N:0:TGGTGA KI270735.1 2
  535. Processed 21000000 sequence pairs so far
  536. Processed 21000000 sequence pairs so far
  537. Processed 22000000 sequence pairs so far
  538. Processed 22000000 sequence pairs so far
  539. Processed 23000000 sequence pairs so far
  540. Processed 23000000 sequence pairs so far
  541. Processed 24000000 sequence pairs so far
  542. Processed 24000000 sequence pairs so far
  543. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:2:1106:3802:49999_1:N:0:TGGTGA MT 2
  544. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:2:1106:12497:100353_1:N:0:TGGTGA KI270736.1 181820
  545. Processed 25000000 sequence pairs so far
  546. Processed 25000000 sequence pairs so far
  547. Processed 26000000 sequence pairs so far
  548. Processed 26000000 sequence pairs so far
  549. Processed 27000000 sequence pairs so far
  550. Processed 27000000 sequence pairs so far
  551. Processed 28000000 sequence pairs so far
  552. Processed 28000000 sequence pairs so far
  553. Processed 29000000 sequence pairs so far
  554. Processed 29000000 sequence pairs so far
  555. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:2:1204:9213:71254_1:N:0:TGGTGA KI270709.1 2
  556. Processed 30000000 sequence pairs so far
  557. Processed 30000000 sequence pairs so far
  558. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:2:1205:19968:55797_1:N:0:TGGTGA KI270467.1 3818
  559. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:2:1207:11346:89023_1:N:0:TGGTGA KI270589.1 2
  560. Processed 31000000 sequence pairs so far
  561. Processed 31000000 sequence pairs so far
  562. Processed 32000000 sequence pairs so far
  563. Processed 32000000 sequence pairs so far
  564. Processed 33000000 sequence pairs so far
  565. Processed 33000000 sequence pairs so far
  566. Processed 34000000 sequence pairs so far
  567. Processed 34000000 sequence pairs so far
  568. Processed 35000000 sequence pairs so far
  569. Processed 35000000 sequence pairs so far
  570. Processed 36000000 sequence pairs so far
  571. Processed 36000000 sequence pairs so far
  572. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:2:2107:12713:58820_1:N:0:TGGTGA KI270467.1 3819
  573. Processed 37000000 sequence pairs so far
  574. Processed 37000000 sequence pairs so far
  575. Processed 38000000 sequence pairs so far
  576. Processed 38000000 sequence pairs so far
  577. Processed 39000000 sequence pairs so far
  578. Processed 39000000 sequence pairs so far
  579. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:2:2115:17081:9319_1:N:0:TGGTGA KI270466.1 1133
  580. Processed 40000000 sequence pairs so far
  581. Processed 40000000 sequence pairs so far
  582. Processed 41000000 sequence pairs so far
  583. Processed 41000000 sequence pairs so far
  584. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:2:2205:17864:60244_1:N:0:TGGTGA KI270726.1 1
  585. Processed 42000000 sequence pairs so far
  586. Processed 42000000 sequence pairs so far
  587. Processed 43000000 sequence pairs so far
  588. Processed 43000000 sequence pairs so far
  589. Processed 44000000 sequence pairs so far
  590. Processed 44000000 sequence pairs so far
  591. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:2:2215:20794:36465_1:N:0:TGGTGA KI270735.1 2
  592. Processed 45000000 sequence pairs so far
  593. Processed 45000000 sequence pairs so far
  594. Chromosomal sequence could not be extracted for HISEQ-MFG:108:HFC37ADXX:2:2216:8707:3858_1:N:0:TGGTGA KI270467.1 3818
  595. 45829609 reads; of these:
  596. 45829609 (100.00%) were paired; of these:
  597. 26578709 (57.99%) aligned concordantly 0 times
  598. 16759687 (36.57%) aligned concordantly exactly 1 time
  599. 2491213 (5.44%) aligned concordantly >1 times
  600. 42.01% overall alignment rate
  601. 45829609 reads; of these:
  602. 45829609 (100.00%) were paired; of these:
  603. 26622152 (58.09%) aligned concordantly 0 times
  604. 16684357 (36.41%) aligned concordantly exactly 1 time
  605. 2523100 (5.51%) aligned concordantly >1 times
  606. 41.91% overall alignment rate
  607. Processed 45829609 sequences in total
  608.  
  609.  
  610. Successfully deleted the temporary files /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.1_C_to_T.fastq and /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.1_G_to_A.fastq
  611.  
  612. Final Alignment report
  613. ======================
  614. Sequence pairs analysed in total: 45829609
  615. Number of paired-end alignments with a unique best hit: 33708979
  616. Mapping efficiency: 73.6%
  617.  
  618. Sequence pairs with no alignments under any condition: 9908734
  619. Sequence pairs did not map uniquely: 2211896
  620. Sequence pairs which were discarded because genomic sequence could not be extracted: 10
  621.  
  622. Number of sequence pairs with unique best (first) alignment came from the bowtie output:
  623. CT/GA/CT: 16895340 ((converted) top strand)
  624. GA/CT/CT: 0 (complementary to (converted) top strand)
  625. GA/CT/GA: 0 (complementary to (converted) bottom strand)
  626. CT/GA/GA: 16813629 ((converted) bottom strand)
  627.  
  628. Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
  629.  
  630. Final Cytosine Methylation Report
  631. =================================
  632. Total number of C's analysed: 1031115512
  633.  
  634. Total methylated C's in CpG context: 34462143
  635. Total methylated C's in CHG context: 4048566
  636. Total methylated C's in CHH context: 14008321
  637. Total methylated C's in Unknown context: 61
  638.  
  639. Total unmethylated C's in CpG context: 7964298
  640. Total unmethylated C's in CHG context: 208418423
  641. Total unmethylated C's in CHH context: 762213761
  642. Total unmethylated C's in Unknown context: 1110
  643.  
  644. C methylated in CpG context: 81.2%
  645. C methylated in CHG context: 1.9%
  646. C methylated in CHH context: 1.8%
  647. C methylated in unknown context (CN or CHN): 5.2%
  648.  
  649.  
  650. 45829608 reads; of these:
  651. 45829608 (100.00%) were paired; of these:
  652. 26572015 (57.98%) aligned concordantly 0 times
  653. 16764984 (36.58%) aligned concordantly exactly 1 time
  654. 2492609 (5.44%) aligned concordantly >1 times
  655. 42.02% overall alignment rate
  656. 45829608 reads; of these:
  657. 45829608 (100.00%) were paired; of these:
  658. 26622711 (58.09%) aligned concordantly 0 times
  659. 16681809 (36.40%) aligned concordantly exactly 1 time
  660. 2525088 (5.51%) aligned concordantly >1 times
  661. 41.91% overall alignment rate
  662. Processed 45829608 sequences in total
  663.  
  664.  
  665. Successfully deleted the temporary files /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.2_C_to_T.fastq and /home/enrico16/analysis/05alignment/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.2_G_to_A.fastq
  666.  
  667. Final Alignment report
  668. ======================
  669. Sequence pairs analysed in total: 45829608
  670. Number of paired-end alignments with a unique best hit: 33711074
  671. Mapping efficiency: 73.6%
  672.  
  673. Sequence pairs with no alignments under any condition: 9904043
  674. Sequence pairs did not map uniquely: 2214491
  675. Sequence pairs which were discarded because genomic sequence could not be extracted: 11
  676.  
  677. Number of sequence pairs with unique best (first) alignment came from the bowtie output:
  678. CT/GA/CT: 16891215 ((converted) top strand)
  679. GA/CT/CT: 0 (complementary to (converted) top strand)
  680. GA/CT/GA: 0 (complementary to (converted) bottom strand)
  681. CT/GA/GA: 16819848 ((converted) bottom strand)
  682.  
  683. Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
  684.  
  685. Final Cytosine Methylation Report
  686. =================================
  687. Total number of C's analysed: 1030909873
  688.  
  689. Total methylated C's in CpG context: 34455854
  690. Total methylated C's in CHG context: 4048303
  691. Total methylated C's in CHH context: 13992717
  692. Total methylated C's in Unknown context: 64
  693.  
  694. Total unmethylated C's in CpG context: 7965039
  695. Total unmethylated C's in CHG context: 208377228
  696. Total unmethylated C's in CHH context: 762070732
  697. Total unmethylated C's in Unknown context: 1100
  698.  
  699. C methylated in CpG context: 81.2%
  700. C methylated in CHG context: 1.9%
  701. C methylated in CHH context: 1.8%
  702. C methylated in unknown context (CN or CHN): 5.5%
  703.  
  704.  
  705. Now waiting for all child processes to complete
  706.  
  707.  
  708. Right, cleaning up now...
  709.  
  710. Deleting temporary sequence files...
  711. /home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.1 Failed to delete temporary FastQ file /home/enrico16/analysis/05alignment/SampleX//home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.1: No such file or directory
  712. /home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.1 Failed to delete temporary FastQ file /home/enrico16/analysis/05alignment/SampleX//home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.1: No such file or directory
  713. /home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.2 Failed to delete temporary FastQ file /home/enrico16/analysis/05alignment/SampleX//home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.2: No such file or directory
  714. /home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.2 Failed to delete temporary FastQ file /home/enrico16/analysis/05alignment/SampleX//home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair2.fastq.gz.temp.2: No such file or directory
  715.  
  716.  
  717. Now merging BAM files /home/enrico16/analysis/05alignment/SampleX//home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.1_bismark_bt2_pe.bam /home/enrico16/analysis/05alignment/SampleX//home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.2_bismark_bt2_pe.bam into >>> /home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz_bismark_bt2_pe.bam <<<
  718. Merging from file >> /home/enrico16/analysis/05alignment/SampleX//home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.1_bismark_bt2_pe.bam <<
  719. open: No such file or directory
  720. [main_samview] fail to open "/home/enrico16/analysis/05alignment/SampleX//home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.1_bismark_bt2_pe.bam" for reading.
  721. Failed to close filehandle
  722. Merging from file >> /home/enrico16/analysis/05alignment/SampleX//home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.2_bismark_bt2_pe.bam <<
  723. open: No such file or directory
  724. [main_samview] fail to open "/home/enrico16/analysis/05alignment/SampleX//home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.2_bismark_bt2_pe.bam" for reading.
  725. Failed to close filehandle
  726.  
  727. Failed to close output filehandle
  728.  
  729. Deleting temporary BAM files...
  730. /home/enrico16/analysis/05alignment/SampleX//home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.1_bismark_bt2_pe.bam Failed to delete temporary BAM file /home/enrico16/analysis/05alignment/SampleX//home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.1_bismark_bt2_pe.bam: No such file or directory
  731. /home/enrico16/analysis/05alignment/SampleX//home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.2_bismark_bt2_pe.bam Failed to delete temporary BAM file /home/enrico16/analysis/05alignment/SampleX//home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz.temp.2_bismark_bt2_pe.bam: No such file or directory
  732.  
  733.  
  734. Failed to write to /home/enrico16/analysis/02trimming/SampleX/SampleX-trimmed-pair1.fastq.gz_bismark_bt2_PE_report.txt: No such file or directory
Advertisement
Add Comment
Please, Sign In to add comment
Advertisement
Public Pastes
Advertisement
We use cookies for various purposes including analytics. By continuing to use Pastebin, you agree to our use of cookies as described in the Cookies Policy.  OK, I Understand
Not a member of Pastebin yet?
Sign Up, it unlocks many cool features!