Want more features on Pastebin? Sign Up, it's FREE!
Guest

faceface

By: a guest on Sep 4th, 2008  |  syntax: XML  |  size: 148.48 KB  |  views: 83  |  expires: Never
download  |  raw  |  embed  |  report abuse  |  print
Text below is selected. Please press Ctrl+C to copy to your clipboard. (⌘+C on Mac)
  1. <?xml version="1.0"?>
  2. <Bioseq-set>
  3. <Bioseq-set_seq-set>
  4. <Seq-entry>
  5.   <Seq-entry_seq>
  6.     <Bioseq>
  7.       <Bioseq_id>
  8.         <Seq-id>
  9.           <Seq-id_general>
  10.             <Dbtag>
  11.               <Dbtag_db>dbGSS</Dbtag_db>
  12.               <Dbtag_tag>
  13.                 <Object-id>
  14.                   <Object-id_id>20893449</Object-id_id>
  15.                 </Object-id>
  16.               </Dbtag_tag>
  17.             </Dbtag>
  18.           </Seq-id_general>
  19.         </Seq-id>
  20.         <Seq-id>
  21.           <Seq-id_genbank>
  22.             <Textseq-id>
  23.               <Textseq-id_accession>ER870415</Textseq-id_accession>
  24.               <Textseq-id_version>1</Textseq-id_version>
  25.             </Textseq-id>
  26.           </Seq-id_genbank>
  27.         </Seq-id>
  28.         <Seq-id>
  29.           <Seq-id_gi>148466254</Seq-id_gi>
  30.         </Seq-id>
  31.       </Bioseq_id>
  32.       <Bioseq_descr>
  33.         <Seq-descr>
  34.           <Seqdesc>
  35.             <Seqdesc_molinfo>
  36.               <MolInfo>
  37.                 <MolInfo_biomol value="genomic">1</MolInfo_biomol>
  38.                 <MolInfo_tech value="survey">4</MolInfo_tech>
  39.               </MolInfo>
  40.             </Seqdesc_molinfo>
  41.           </Seqdesc>
  42.           <Seqdesc>
  43.             <Seqdesc_title>POTLD51TR Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY103_I06.</Seqdesc_title>
  44.           </Seqdesc>
  45.           <Seqdesc>
  46.             <Seqdesc_create-date>
  47.               <Date>
  48.                 <Date_std>
  49.                   <Date-std>
  50.                     <Date-std_year>2007</Date-std_year>
  51.                     <Date-std_month>5</Date-std_month>
  52.                     <Date-std_day>30</Date-std_day>
  53.                   </Date-std>
  54.                 </Date_std>
  55.               </Date>
  56.             </Seqdesc_create-date>
  57.           </Seqdesc>
  58.           <Seqdesc>
  59.             <Seqdesc_update-date>
  60.               <Date>
  61.                 <Date_std>
  62.                   <Date-std>
  63.                     <Date-std_year>2008</Date-std_year>
  64.                     <Date-std_month>6</Date-std_month>
  65.                     <Date-std_day>18</Date-std_day>
  66.                   </Date-std>
  67.                 </Date_std>
  68.               </Date>
  69.             </Seqdesc_update-date>
  70.           </Seqdesc>
  71.           <Seqdesc>
  72.             <Seqdesc_comment>Other_GSSs: POTLD51TF~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: CAGGAAACAGCTATGACC~Class: BAC ends</Seqdesc_comment>
  73.           </Seqdesc>
  74.           <Seqdesc>
  75.             <Seqdesc_source>
  76.               <BioSource>
  77.                 <BioSource_org>
  78.                   <Org-ref>
  79.                     <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
  80.                     <Org-ref_common>potato</Org-ref_common>
  81.                     <Org-ref_db>
  82.                       <Dbtag>
  83.                         <Dbtag_db>taxon</Dbtag_db>
  84.                         <Dbtag_tag>
  85.                           <Object-id>
  86.                             <Object-id_id>4113</Object-id_id>
  87.                           </Object-id>
  88.                         </Dbtag_tag>
  89.                       </Dbtag>
  90.                     </Org-ref_db>
  91.                     <Org-ref_orgname>
  92.                       <OrgName>
  93.                         <OrgName_name>
  94.                           <OrgName_name_binomial>
  95.                             <BinomialOrgName>
  96.                               <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
  97.                               <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
  98.                             </BinomialOrgName>
  99.                           </OrgName_name_binomial>
  100.                         </OrgName_name>
  101.                         <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
  102.                         <OrgName_gcode>1</OrgName_gcode>
  103.                         <OrgName_mgcode>1</OrgName_mgcode>
  104.                         <OrgName_div>PLN</OrgName_div>
  105.                       </OrgName>
  106.                     </Org-ref_orgname>
  107.                   </Org-ref>
  108.                 </BioSource_org>
  109.                 <BioSource_subtype>
  110.                   <SubSource>
  111.                     <SubSource_subtype value="clone">3</SubSource_subtype>
  112.                     <SubSource_name>RHPOTKEY103_I06</SubSource_name>
  113.                   </SubSource>
  114.                   <SubSource>
  115.                     <SubSource_subtype value="clone-lib">11</SubSource_subtype>
  116.                     <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
  117.                   </SubSource>
  118.                 </BioSource_subtype>
  119.               </BioSource>
  120.             </Seqdesc_source>
  121.           </Seqdesc>
  122.           <Seqdesc>
  123.             <Seqdesc_pub>
  124.               <Pubdesc>
  125.                 <Pubdesc_pub>
  126.                   <Pub-equiv>
  127.                     <Pub>
  128.                       <Pub_pmid>
  129.                         <PubMedId>18554403</PubMedId>
  130.                       </Pub_pmid>
  131.                     </Pub>
  132.                     <Pub>
  133.                       <Pub_article>
  134.                         <Cit-art>
  135.                           <Cit-art_title>
  136.                             <Title>
  137.                               <Title_E>
  138.                                 <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
  139.                               </Title_E>
  140.                             </Title>
  141.                           </Cit-art_title>
  142.                           <Cit-art_authors>
  143.                             <Auth-list>
  144.                               <Auth-list_names>
  145.                                 <Auth-list_names_std>
  146.                                   <Author>
  147.                                     <Author_name>
  148.                                       <Person-id>
  149.                                         <Person-id_name>
  150.                                           <Name-std>
  151.                                             <Name-std_last>Zhu</Name-std_last>
  152.                                             <Name-std_initials>W.</Name-std_initials>
  153.                                           </Name-std>
  154.                                         </Person-id_name>
  155.                                       </Person-id>
  156.                                     </Author_name>
  157.                                   </Author>
  158.                                   <Author>
  159.                                     <Author_name>
  160.                                       <Person-id>
  161.                                         <Person-id_name>
  162.                                           <Name-std>
  163.                                             <Name-std_last>Ouyang</Name-std_last>
  164.                                             <Name-std_initials>S.</Name-std_initials>
  165.                                           </Name-std>
  166.                                         </Person-id_name>
  167.                                       </Person-id>
  168.                                     </Author_name>
  169.                                   </Author>
  170.                                   <Author>
  171.                                     <Author_name>
  172.                                       <Person-id>
  173.                                         <Person-id_name>
  174.                                           <Name-std>
  175.                                             <Name-std_last>Iovene</Name-std_last>
  176.                                             <Name-std_initials>M.</Name-std_initials>
  177.                                           </Name-std>
  178.                                         </Person-id_name>
  179.                                       </Person-id>
  180.                                     </Author_name>
  181.                                   </Author>
  182.                                   <Author>
  183.                                     <Author_name>
  184.                                       <Person-id>
  185.                                         <Person-id_name>
  186.                                           <Name-std>
  187.                                             <Name-std_last>O&apos;Brien</Name-std_last>
  188.                                             <Name-std_initials>K.</Name-std_initials>
  189.                                           </Name-std>
  190.                                         </Person-id_name>
  191.                                       </Person-id>
  192.                                     </Author_name>
  193.                                   </Author>
  194.                                   <Author>
  195.                                     <Author_name>
  196.                                       <Person-id>
  197.                                         <Person-id_name>
  198.                                           <Name-std>
  199.                                             <Name-std_last>Vuong</Name-std_last>
  200.                                             <Name-std_initials>H.</Name-std_initials>
  201.                                           </Name-std>
  202.                                         </Person-id_name>
  203.                                       </Person-id>
  204.                                     </Author_name>
  205.                                   </Author>
  206.                                   <Author>
  207.                                     <Author_name>
  208.                                       <Person-id>
  209.                                         <Person-id_name>
  210.                                           <Name-std>
  211.                                             <Name-std_last>Jiang</Name-std_last>
  212.                                             <Name-std_initials>J.</Name-std_initials>
  213.                                           </Name-std>
  214.                                         </Person-id_name>
  215.                                       </Person-id>
  216.                                     </Author_name>
  217.                                   </Author>
  218.                                   <Author>
  219.                                     <Author_name>
  220.                                       <Person-id>
  221.                                         <Person-id_name>
  222.                                           <Name-std>
  223.                                             <Name-std_last>Buell</Name-std_last>
  224.                                             <Name-std_initials>C.R.</Name-std_initials>
  225.                                           </Name-std>
  226.                                         </Person-id_name>
  227.                                       </Person-id>
  228.                                     </Author_name>
  229.                                   </Author>
  230.                                 </Auth-list_names_std>
  231.                               </Auth-list_names>
  232.                             </Auth-list>
  233.                           </Cit-art_authors>
  234.                           <Cit-art_from>
  235.                             <Cit-art_from_journal>
  236.                               <Cit-jour>
  237.                                 <Cit-jour_title>
  238.                                   <Title>
  239.                                     <Title_E>
  240.                                       <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
  241.                                     </Title_E>
  242.                                   </Title>
  243.                                 </Cit-jour_title>
  244.                                 <Cit-jour_imp>
  245.                                   <Imprint>
  246.                                     <Imprint_date>
  247.                                       <Date>
  248.                                         <Date_std>
  249.                                           <Date-std>
  250.                                             <Date-std_year>2008</Date-std_year>
  251.                                           </Date-std>
  252.                                         </Date_std>
  253.                                       </Date>
  254.                                     </Imprint_date>
  255.                                     <Imprint_volume>9</Imprint_volume>
  256.                                     <Imprint_issue>1</Imprint_issue>
  257.                                     <Imprint_pages>286</Imprint_pages>
  258.                                   </Imprint>
  259.                                 </Cit-jour_imp>
  260.                               </Cit-jour>
  261.                             </Cit-art_from_journal>
  262.                           </Cit-art_from>
  263.                         </Cit-art>
  264.                       </Pub_article>
  265.                     </Pub>
  266.                   </Pub-equiv>
  267.                 </Pubdesc_pub>
  268.               </Pubdesc>
  269.             </Seqdesc_pub>
  270.           </Seqdesc>
  271.         </Seq-descr>
  272.       </Bioseq_descr>
  273.       <Bioseq_inst>
  274.         <Seq-inst>
  275.           <Seq-inst_repr value="raw"/>
  276.           <Seq-inst_mol value="dna"/>
  277.           <Seq-inst_length>603</Seq-inst_length>
  278.           <Seq-inst_strand value="ds"/>
  279.           <Seq-inst_seq-data>
  280.             <Seq-data>
  281.               <Seq-data_iupacna>
  282.                 <IUPACna>GGAGTTTATGCCCAAGTTCTACTATATAATAAATATAATATGTAATATTGAAGAAACTTCCTTTTAAAAGTCCCACAAGAATATTATATATTATATTTGGGCCTAAACTCTCTTTTATAATATAGTAGAATAGAAAGTAGAATAGAATAGAATATTATAAACTACTATATTATAAAAGAGAGTTTACGGCCAAATATAATATAGTAGAATATATAGATAGAATATTATAAAAGAGAGTTTAGGGCCAAATCTTGAATATTATATATTATATATTATATTTGGCCCTAAACTCTCTCTTATAATATAGTAATAAATAGTAGATTTAGAAACAATGGAAAGTACATATAATAAGAGTATAATGCTGGTAAATGAACAAAATCATATGGTACACAACTAGTAGATAAAAGACTATTTACTTAAACTCTAGGGAGTAGGGGTGTGCATTCGGTTTTTCGGTTTGGTTTTACACTATTCGGTTTGGGTTTTCGGTTTTTGGTTTTGTAAAAGTGTAACCCAATCCGATCCAAAATAAATTTGTTTTGATTTGGTTTTCCTCTATTCGATTCGGTTTTTTTCGATTTGATTATTCGGTTATGTCAATAA</IUPACna>
  283.               </Seq-data_iupacna>
  284.             </Seq-data>
  285.           </Seq-inst_seq-data>
  286.         </Seq-inst>
  287.       </Bioseq_inst>
  288.     </Bioseq>
  289.   </Seq-entry_seq>
  290. </Seq-entry>
  291.  
  292. <Seq-entry>
  293.   <Seq-entry_seq>
  294.     <Bioseq>
  295.       <Bioseq_id>
  296.         <Seq-id>
  297.           <Seq-id_general>
  298.             <Dbtag>
  299.               <Dbtag_db>dbGSS</Dbtag_db>
  300.               <Dbtag_tag>
  301.                 <Object-id>
  302.                   <Object-id_id>20893448</Object-id_id>
  303.                 </Object-id>
  304.               </Dbtag_tag>
  305.             </Dbtag>
  306.           </Seq-id_general>
  307.         </Seq-id>
  308.         <Seq-id>
  309.           <Seq-id_genbank>
  310.             <Textseq-id>
  311.               <Textseq-id_accession>ER870414</Textseq-id_accession>
  312.               <Textseq-id_version>1</Textseq-id_version>
  313.             </Textseq-id>
  314.           </Seq-id_genbank>
  315.         </Seq-id>
  316.         <Seq-id>
  317.           <Seq-id_gi>148466253</Seq-id_gi>
  318.         </Seq-id>
  319.       </Bioseq_id>
  320.       <Bioseq_descr>
  321.         <Seq-descr>
  322.           <Seqdesc>
  323.             <Seqdesc_molinfo>
  324.               <MolInfo>
  325.                 <MolInfo_biomol value="genomic">1</MolInfo_biomol>
  326.                 <MolInfo_tech value="survey">4</MolInfo_tech>
  327.               </MolInfo>
  328.             </Seqdesc_molinfo>
  329.           </Seqdesc>
  330.           <Seqdesc>
  331.             <Seqdesc_title>PPTH947TF Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY184_G22.</Seqdesc_title>
  332.           </Seqdesc>
  333.           <Seqdesc>
  334.             <Seqdesc_create-date>
  335.               <Date>
  336.                 <Date_std>
  337.                   <Date-std>
  338.                     <Date-std_year>2007</Date-std_year>
  339.                     <Date-std_month>5</Date-std_month>
  340.                     <Date-std_day>30</Date-std_day>
  341.                   </Date-std>
  342.                 </Date_std>
  343.               </Date>
  344.             </Seqdesc_create-date>
  345.           </Seqdesc>
  346.           <Seqdesc>
  347.             <Seqdesc_update-date>
  348.               <Date>
  349.                 <Date_std>
  350.                   <Date-std>
  351.                     <Date-std_year>2008</Date-std_year>
  352.                     <Date-std_month>6</Date-std_month>
  353.                     <Date-std_day>18</Date-std_day>
  354.                   </Date-std>
  355.                 </Date_std>
  356.               </Date>
  357.             </Seqdesc_update-date>
  358.           </Seqdesc>
  359.           <Seqdesc>
  360.             <Seqdesc_comment>Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: TGTAAAACGACGGCCAGT~Class: BAC ends</Seqdesc_comment>
  361.           </Seqdesc>
  362.           <Seqdesc>
  363.             <Seqdesc_source>
  364.               <BioSource>
  365.                 <BioSource_org>
  366.                   <Org-ref>
  367.                     <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
  368.                     <Org-ref_common>potato</Org-ref_common>
  369.                     <Org-ref_db>
  370.                       <Dbtag>
  371.                         <Dbtag_db>taxon</Dbtag_db>
  372.                         <Dbtag_tag>
  373.                           <Object-id>
  374.                             <Object-id_id>4113</Object-id_id>
  375.                           </Object-id>
  376.                         </Dbtag_tag>
  377.                       </Dbtag>
  378.                     </Org-ref_db>
  379.                     <Org-ref_orgname>
  380.                       <OrgName>
  381.                         <OrgName_name>
  382.                           <OrgName_name_binomial>
  383.                             <BinomialOrgName>
  384.                               <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
  385.                               <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
  386.                             </BinomialOrgName>
  387.                           </OrgName_name_binomial>
  388.                         </OrgName_name>
  389.                         <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
  390.                         <OrgName_gcode>1</OrgName_gcode>
  391.                         <OrgName_mgcode>1</OrgName_mgcode>
  392.                         <OrgName_div>PLN</OrgName_div>
  393.                       </OrgName>
  394.                     </Org-ref_orgname>
  395.                   </Org-ref>
  396.                 </BioSource_org>
  397.                 <BioSource_subtype>
  398.                   <SubSource>
  399.                     <SubSource_subtype value="clone">3</SubSource_subtype>
  400.                     <SubSource_name>RHPOTKEY184_G22</SubSource_name>
  401.                   </SubSource>
  402.                   <SubSource>
  403.                     <SubSource_subtype value="clone-lib">11</SubSource_subtype>
  404.                     <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
  405.                   </SubSource>
  406.                 </BioSource_subtype>
  407.               </BioSource>
  408.             </Seqdesc_source>
  409.           </Seqdesc>
  410.           <Seqdesc>
  411.             <Seqdesc_pub>
  412.               <Pubdesc>
  413.                 <Pubdesc_pub>
  414.                   <Pub-equiv>
  415.                     <Pub>
  416.                       <Pub_pmid>
  417.                         <PubMedId>18554403</PubMedId>
  418.                       </Pub_pmid>
  419.                     </Pub>
  420.                     <Pub>
  421.                       <Pub_article>
  422.                         <Cit-art>
  423.                           <Cit-art_title>
  424.                             <Title>
  425.                               <Title_E>
  426.                                 <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
  427.                               </Title_E>
  428.                             </Title>
  429.                           </Cit-art_title>
  430.                           <Cit-art_authors>
  431.                             <Auth-list>
  432.                               <Auth-list_names>
  433.                                 <Auth-list_names_std>
  434.                                   <Author>
  435.                                     <Author_name>
  436.                                       <Person-id>
  437.                                         <Person-id_name>
  438.                                           <Name-std>
  439.                                             <Name-std_last>Zhu</Name-std_last>
  440.                                             <Name-std_initials>W.</Name-std_initials>
  441.                                           </Name-std>
  442.                                         </Person-id_name>
  443.                                       </Person-id>
  444.                                     </Author_name>
  445.                                   </Author>
  446.                                   <Author>
  447.                                     <Author_name>
  448.                                       <Person-id>
  449.                                         <Person-id_name>
  450.                                           <Name-std>
  451.                                             <Name-std_last>Ouyang</Name-std_last>
  452.                                             <Name-std_initials>S.</Name-std_initials>
  453.                                           </Name-std>
  454.                                         </Person-id_name>
  455.                                       </Person-id>
  456.                                     </Author_name>
  457.                                   </Author>
  458.                                   <Author>
  459.                                     <Author_name>
  460.                                       <Person-id>
  461.                                         <Person-id_name>
  462.                                           <Name-std>
  463.                                             <Name-std_last>Iovene</Name-std_last>
  464.                                             <Name-std_initials>M.</Name-std_initials>
  465.                                           </Name-std>
  466.                                         </Person-id_name>
  467.                                       </Person-id>
  468.                                     </Author_name>
  469.                                   </Author>
  470.                                   <Author>
  471.                                     <Author_name>
  472.                                       <Person-id>
  473.                                         <Person-id_name>
  474.                                           <Name-std>
  475.                                             <Name-std_last>O&apos;Brien</Name-std_last>
  476.                                             <Name-std_initials>K.</Name-std_initials>
  477.                                           </Name-std>
  478.                                         </Person-id_name>
  479.                                       </Person-id>
  480.                                     </Author_name>
  481.                                   </Author>
  482.                                   <Author>
  483.                                     <Author_name>
  484.                                       <Person-id>
  485.                                         <Person-id_name>
  486.                                           <Name-std>
  487.                                             <Name-std_last>Vuong</Name-std_last>
  488.                                             <Name-std_initials>H.</Name-std_initials>
  489.                                           </Name-std>
  490.                                         </Person-id_name>
  491.                                       </Person-id>
  492.                                     </Author_name>
  493.                                   </Author>
  494.                                   <Author>
  495.                                     <Author_name>
  496.                                       <Person-id>
  497.                                         <Person-id_name>
  498.                                           <Name-std>
  499.                                             <Name-std_last>Jiang</Name-std_last>
  500.                                             <Name-std_initials>J.</Name-std_initials>
  501.                                           </Name-std>
  502.                                         </Person-id_name>
  503.                                       </Person-id>
  504.                                     </Author_name>
  505.                                   </Author>
  506.                                   <Author>
  507.                                     <Author_name>
  508.                                       <Person-id>
  509.                                         <Person-id_name>
  510.                                           <Name-std>
  511.                                             <Name-std_last>Buell</Name-std_last>
  512.                                             <Name-std_initials>C.R.</Name-std_initials>
  513.                                           </Name-std>
  514.                                         </Person-id_name>
  515.                                       </Person-id>
  516.                                     </Author_name>
  517.                                   </Author>
  518.                                 </Auth-list_names_std>
  519.                               </Auth-list_names>
  520.                             </Auth-list>
  521.                           </Cit-art_authors>
  522.                           <Cit-art_from>
  523.                             <Cit-art_from_journal>
  524.                               <Cit-jour>
  525.                                 <Cit-jour_title>
  526.                                   <Title>
  527.                                     <Title_E>
  528.                                       <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
  529.                                     </Title_E>
  530.                                   </Title>
  531.                                 </Cit-jour_title>
  532.                                 <Cit-jour_imp>
  533.                                   <Imprint>
  534.                                     <Imprint_date>
  535.                                       <Date>
  536.                                         <Date_std>
  537.                                           <Date-std>
  538.                                             <Date-std_year>2008</Date-std_year>
  539.                                           </Date-std>
  540.                                         </Date_std>
  541.                                       </Date>
  542.                                     </Imprint_date>
  543.                                     <Imprint_volume>9</Imprint_volume>
  544.                                     <Imprint_issue>1</Imprint_issue>
  545.                                     <Imprint_pages>286</Imprint_pages>
  546.                                   </Imprint>
  547.                                 </Cit-jour_imp>
  548.                               </Cit-jour>
  549.                             </Cit-art_from_journal>
  550.                           </Cit-art_from>
  551.                         </Cit-art>
  552.                       </Pub_article>
  553.                     </Pub>
  554.                   </Pub-equiv>
  555.                 </Pubdesc_pub>
  556.               </Pubdesc>
  557.             </Seqdesc_pub>
  558.           </Seqdesc>
  559.         </Seq-descr>
  560.       </Bioseq_descr>
  561.       <Bioseq_inst>
  562.         <Seq-inst>
  563.           <Seq-inst_repr value="raw"/>
  564.           <Seq-inst_mol value="dna"/>
  565.           <Seq-inst_length>374</Seq-inst_length>
  566.           <Seq-inst_strand value="ds"/>
  567.           <Seq-inst_seq-data>
  568.             <Seq-data>
  569.               <Seq-data_iupacna>
  570.                 <IUPACna>GGATTTACTGCATTTGGCCATTTGACTATATTTGCTCTTAAGAGCAGTGTCACCTGCTCTATCATTGCGCAAATTTTTGAGATTTAGCGCAAACGTGGGCTACTCAGAATTCACCCAATAAATTGAACCATACGCAACCACGACCCAATGAGATTTCATTAAAAAGCACAAAAATTACGGGCATTCGACAATTAAACAATACGGGAAAGATTTTTGAATTTAAATAGGCATGTAATCATTCTAATCCTATCATAGAGGCCCAACACACATCACTAAGAGACAATCATTGTAAATGAGTACAAAAACATTCAAATGTAAAAGTGTGAAAAGGAAACCAACCTTCAATGTTGATTAAATTCGATTTGAAAATCTAG</IUPACna>
  571.               </Seq-data_iupacna>
  572.             </Seq-data>
  573.           </Seq-inst_seq-data>
  574.         </Seq-inst>
  575.       </Bioseq_inst>
  576.     </Bioseq>
  577.   </Seq-entry_seq>
  578. </Seq-entry>
  579.  
  580. <Seq-entry>
  581.   <Seq-entry_seq>
  582.     <Bioseq>
  583.       <Bioseq_id>
  584.         <Seq-id>
  585.           <Seq-id_general>
  586.             <Dbtag>
  587.               <Dbtag_db>dbGSS</Dbtag_db>
  588.               <Dbtag_tag>
  589.                 <Object-id>
  590.                   <Object-id_id>20893447</Object-id_id>
  591.                 </Object-id>
  592.               </Dbtag_tag>
  593.             </Dbtag>
  594.           </Seq-id_general>
  595.         </Seq-id>
  596.         <Seq-id>
  597.           <Seq-id_genbank>
  598.             <Textseq-id>
  599.               <Textseq-id_accession>ER870413</Textseq-id_accession>
  600.               <Textseq-id_version>1</Textseq-id_version>
  601.             </Textseq-id>
  602.           </Seq-id_genbank>
  603.         </Seq-id>
  604.         <Seq-id>
  605.           <Seq-id_gi>148466252</Seq-id_gi>
  606.         </Seq-id>
  607.       </Bioseq_id>
  608.       <Bioseq_descr>
  609.         <Seq-descr>
  610.           <Seqdesc>
  611.             <Seqdesc_molinfo>
  612.               <MolInfo>
  613.                 <MolInfo_biomol value="genomic">1</MolInfo_biomol>
  614.                 <MolInfo_tech value="survey">4</MolInfo_tech>
  615.               </MolInfo>
  616.             </Seqdesc_molinfo>
  617.           </Seqdesc>
  618.           <Seqdesc>
  619.             <Seqdesc_title>POTJR43TF Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY088_H14.</Seqdesc_title>
  620.           </Seqdesc>
  621.           <Seqdesc>
  622.             <Seqdesc_create-date>
  623.               <Date>
  624.                 <Date_std>
  625.                   <Date-std>
  626.                     <Date-std_year>2007</Date-std_year>
  627.                     <Date-std_month>5</Date-std_month>
  628.                     <Date-std_day>30</Date-std_day>
  629.                   </Date-std>
  630.                 </Date_std>
  631.               </Date>
  632.             </Seqdesc_create-date>
  633.           </Seqdesc>
  634.           <Seqdesc>
  635.             <Seqdesc_update-date>
  636.               <Date>
  637.                 <Date_std>
  638.                   <Date-std>
  639.                     <Date-std_year>2008</Date-std_year>
  640.                     <Date-std_month>6</Date-std_month>
  641.                     <Date-std_day>18</Date-std_day>
  642.                   </Date-std>
  643.                 </Date_std>
  644.               </Date>
  645.             </Seqdesc_update-date>
  646.           </Seqdesc>
  647.           <Seqdesc>
  648.             <Seqdesc_comment>Other_GSSs: POTJR43TR~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: TGTAAAACGACGGCCAGT~Class: BAC ends</Seqdesc_comment>
  649.           </Seqdesc>
  650.           <Seqdesc>
  651.             <Seqdesc_source>
  652.               <BioSource>
  653.                 <BioSource_org>
  654.                   <Org-ref>
  655.                     <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
  656.                     <Org-ref_common>potato</Org-ref_common>
  657.                     <Org-ref_db>
  658.                       <Dbtag>
  659.                         <Dbtag_db>taxon</Dbtag_db>
  660.                         <Dbtag_tag>
  661.                           <Object-id>
  662.                             <Object-id_id>4113</Object-id_id>
  663.                           </Object-id>
  664.                         </Dbtag_tag>
  665.                       </Dbtag>
  666.                     </Org-ref_db>
  667.                     <Org-ref_orgname>
  668.                       <OrgName>
  669.                         <OrgName_name>
  670.                           <OrgName_name_binomial>
  671.                             <BinomialOrgName>
  672.                               <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
  673.                               <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
  674.                             </BinomialOrgName>
  675.                           </OrgName_name_binomial>
  676.                         </OrgName_name>
  677.                         <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
  678.                         <OrgName_gcode>1</OrgName_gcode>
  679.                         <OrgName_mgcode>1</OrgName_mgcode>
  680.                         <OrgName_div>PLN</OrgName_div>
  681.                       </OrgName>
  682.                     </Org-ref_orgname>
  683.                   </Org-ref>
  684.                 </BioSource_org>
  685.                 <BioSource_subtype>
  686.                   <SubSource>
  687.                     <SubSource_subtype value="clone">3</SubSource_subtype>
  688.                     <SubSource_name>RHPOTKEY088_H14</SubSource_name>
  689.                   </SubSource>
  690.                   <SubSource>
  691.                     <SubSource_subtype value="clone-lib">11</SubSource_subtype>
  692.                     <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
  693.                   </SubSource>
  694.                 </BioSource_subtype>
  695.               </BioSource>
  696.             </Seqdesc_source>
  697.           </Seqdesc>
  698.           <Seqdesc>
  699.             <Seqdesc_pub>
  700.               <Pubdesc>
  701.                 <Pubdesc_pub>
  702.                   <Pub-equiv>
  703.                     <Pub>
  704.                       <Pub_pmid>
  705.                         <PubMedId>18554403</PubMedId>
  706.                       </Pub_pmid>
  707.                     </Pub>
  708.                     <Pub>
  709.                       <Pub_article>
  710.                         <Cit-art>
  711.                           <Cit-art_title>
  712.                             <Title>
  713.                               <Title_E>
  714.                                 <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
  715.                               </Title_E>
  716.                             </Title>
  717.                           </Cit-art_title>
  718.                           <Cit-art_authors>
  719.                             <Auth-list>
  720.                               <Auth-list_names>
  721.                                 <Auth-list_names_std>
  722.                                   <Author>
  723.                                     <Author_name>
  724.                                       <Person-id>
  725.                                         <Person-id_name>
  726.                                           <Name-std>
  727.                                             <Name-std_last>Zhu</Name-std_last>
  728.                                             <Name-std_initials>W.</Name-std_initials>
  729.                                           </Name-std>
  730.                                         </Person-id_name>
  731.                                       </Person-id>
  732.                                     </Author_name>
  733.                                   </Author>
  734.                                   <Author>
  735.                                     <Author_name>
  736.                                       <Person-id>
  737.                                         <Person-id_name>
  738.                                           <Name-std>
  739.                                             <Name-std_last>Ouyang</Name-std_last>
  740.                                             <Name-std_initials>S.</Name-std_initials>
  741.                                           </Name-std>
  742.                                         </Person-id_name>
  743.                                       </Person-id>
  744.                                     </Author_name>
  745.                                   </Author>
  746.                                   <Author>
  747.                                     <Author_name>
  748.                                       <Person-id>
  749.                                         <Person-id_name>
  750.                                           <Name-std>
  751.                                             <Name-std_last>Iovene</Name-std_last>
  752.                                             <Name-std_initials>M.</Name-std_initials>
  753.                                           </Name-std>
  754.                                         </Person-id_name>
  755.                                       </Person-id>
  756.                                     </Author_name>
  757.                                   </Author>
  758.                                   <Author>
  759.                                     <Author_name>
  760.                                       <Person-id>
  761.                                         <Person-id_name>
  762.                                           <Name-std>
  763.                                             <Name-std_last>O&apos;Brien</Name-std_last>
  764.                                             <Name-std_initials>K.</Name-std_initials>
  765.                                           </Name-std>
  766.                                         </Person-id_name>
  767.                                       </Person-id>
  768.                                     </Author_name>
  769.                                   </Author>
  770.                                   <Author>
  771.                                     <Author_name>
  772.                                       <Person-id>
  773.                                         <Person-id_name>
  774.                                           <Name-std>
  775.                                             <Name-std_last>Vuong</Name-std_last>
  776.                                             <Name-std_initials>H.</Name-std_initials>
  777.                                           </Name-std>
  778.                                         </Person-id_name>
  779.                                       </Person-id>
  780.                                     </Author_name>
  781.                                   </Author>
  782.                                   <Author>
  783.                                     <Author_name>
  784.                                       <Person-id>
  785.                                         <Person-id_name>
  786.                                           <Name-std>
  787.                                             <Name-std_last>Jiang</Name-std_last>
  788.                                             <Name-std_initials>J.</Name-std_initials>
  789.                                           </Name-std>
  790.                                         </Person-id_name>
  791.                                       </Person-id>
  792.                                     </Author_name>
  793.                                   </Author>
  794.                                   <Author>
  795.                                     <Author_name>
  796.                                       <Person-id>
  797.                                         <Person-id_name>
  798.                                           <Name-std>
  799.                                             <Name-std_last>Buell</Name-std_last>
  800.                                             <Name-std_initials>C.R.</Name-std_initials>
  801.                                           </Name-std>
  802.                                         </Person-id_name>
  803.                                       </Person-id>
  804.                                     </Author_name>
  805.                                   </Author>
  806.                                 </Auth-list_names_std>
  807.                               </Auth-list_names>
  808.                             </Auth-list>
  809.                           </Cit-art_authors>
  810.                           <Cit-art_from>
  811.                             <Cit-art_from_journal>
  812.                               <Cit-jour>
  813.                                 <Cit-jour_title>
  814.                                   <Title>
  815.                                     <Title_E>
  816.                                       <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
  817.                                     </Title_E>
  818.                                   </Title>
  819.                                 </Cit-jour_title>
  820.                                 <Cit-jour_imp>
  821.                                   <Imprint>
  822.                                     <Imprint_date>
  823.                                       <Date>
  824.                                         <Date_std>
  825.                                           <Date-std>
  826.                                             <Date-std_year>2008</Date-std_year>
  827.                                           </Date-std>
  828.                                         </Date_std>
  829.                                       </Date>
  830.                                     </Imprint_date>
  831.                                     <Imprint_volume>9</Imprint_volume>
  832.                                     <Imprint_issue>1</Imprint_issue>
  833.                                     <Imprint_pages>286</Imprint_pages>
  834.                                   </Imprint>
  835.                                 </Cit-jour_imp>
  836.                               </Cit-jour>
  837.                             </Cit-art_from_journal>
  838.                           </Cit-art_from>
  839.                         </Cit-art>
  840.                       </Pub_article>
  841.                     </Pub>
  842.                   </Pub-equiv>
  843.                 </Pubdesc_pub>
  844.               </Pubdesc>
  845.             </Seqdesc_pub>
  846.           </Seqdesc>
  847.         </Seq-descr>
  848.       </Bioseq_descr>
  849.       <Bioseq_inst>
  850.         <Seq-inst>
  851.           <Seq-inst_repr value="raw"/>
  852.           <Seq-inst_mol value="dna"/>
  853.           <Seq-inst_length>192</Seq-inst_length>
  854.           <Seq-inst_strand value="ds"/>
  855.           <Seq-inst_seq-data>
  856.             <Seq-data>
  857.               <Seq-data_iupacna>
  858.                 <IUPACna>AAGGTGGTTGCTACATATGCGGCGGACCGCACGGCTATGCAAAGTGCCCTGAACTGAAGAGCCTTGGTGCTATCCTGCGAGAACGGAAGGAGAAAGACGCACAGGAGAAAGGACAAGGCGCAGAGACAACACAGTTGGGCTTGATAGGGCTATGCGGAGCAATCACCAAGCAGCCAGAGAAGCCAAGAGGAT</IUPACna>
  859.               </Seq-data_iupacna>
  860.             </Seq-data>
  861.           </Seq-inst_seq-data>
  862.         </Seq-inst>
  863.       </Bioseq_inst>
  864.     </Bioseq>
  865.   </Seq-entry_seq>
  866. </Seq-entry>
  867.  
  868. <Seq-entry>
  869.   <Seq-entry_seq>
  870.     <Bioseq>
  871.       <Bioseq_id>
  872.         <Seq-id>
  873.           <Seq-id_general>
  874.             <Dbtag>
  875.               <Dbtag_db>dbGSS</Dbtag_db>
  876.               <Dbtag_tag>
  877.                 <Object-id>
  878.                   <Object-id_id>20893446</Object-id_id>
  879.                 </Object-id>
  880.               </Dbtag_tag>
  881.             </Dbtag>
  882.           </Seq-id_general>
  883.         </Seq-id>
  884.         <Seq-id>
  885.           <Seq-id_genbank>
  886.             <Textseq-id>
  887.               <Textseq-id_accession>ER870412</Textseq-id_accession>
  888.               <Textseq-id_version>1</Textseq-id_version>
  889.             </Textseq-id>
  890.           </Seq-id_genbank>
  891.         </Seq-id>
  892.         <Seq-id>
  893.           <Seq-id_gi>148466251</Seq-id_gi>
  894.         </Seq-id>
  895.       </Bioseq_id>
  896.       <Bioseq_descr>
  897.         <Seq-descr>
  898.           <Seqdesc>
  899.             <Seqdesc_molinfo>
  900.               <MolInfo>
  901.                 <MolInfo_biomol value="genomic">1</MolInfo_biomol>
  902.                 <MolInfo_tech value="survey">4</MolInfo_tech>
  903.               </MolInfo>
  904.             </Seqdesc_molinfo>
  905.           </Seqdesc>
  906.           <Seqdesc>
  907.             <Seqdesc_title>PPTH371TR Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY182_L22.</Seqdesc_title>
  908.           </Seqdesc>
  909.           <Seqdesc>
  910.             <Seqdesc_create-date>
  911.               <Date>
  912.                 <Date_std>
  913.                   <Date-std>
  914.                     <Date-std_year>2007</Date-std_year>
  915.                     <Date-std_month>5</Date-std_month>
  916.                     <Date-std_day>30</Date-std_day>
  917.                   </Date-std>
  918.                 </Date_std>
  919.               </Date>
  920.             </Seqdesc_create-date>
  921.           </Seqdesc>
  922.           <Seqdesc>
  923.             <Seqdesc_update-date>
  924.               <Date>
  925.                 <Date_std>
  926.                   <Date-std>
  927.                     <Date-std_year>2008</Date-std_year>
  928.                     <Date-std_month>6</Date-std_month>
  929.                     <Date-std_day>18</Date-std_day>
  930.                   </Date-std>
  931.                 </Date_std>
  932.               </Date>
  933.             </Seqdesc_update-date>
  934.           </Seqdesc>
  935.           <Seqdesc>
  936.             <Seqdesc_comment>Other_GSSs: PPTH371TF~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: CAGGAAACAGCTATGACC~Class: BAC ends</Seqdesc_comment>
  937.           </Seqdesc>
  938.           <Seqdesc>
  939.             <Seqdesc_source>
  940.               <BioSource>
  941.                 <BioSource_org>
  942.                   <Org-ref>
  943.                     <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
  944.                     <Org-ref_common>potato</Org-ref_common>
  945.                     <Org-ref_db>
  946.                       <Dbtag>
  947.                         <Dbtag_db>taxon</Dbtag_db>
  948.                         <Dbtag_tag>
  949.                           <Object-id>
  950.                             <Object-id_id>4113</Object-id_id>
  951.                           </Object-id>
  952.                         </Dbtag_tag>
  953.                       </Dbtag>
  954.                     </Org-ref_db>
  955.                     <Org-ref_orgname>
  956.                       <OrgName>
  957.                         <OrgName_name>
  958.                           <OrgName_name_binomial>
  959.                             <BinomialOrgName>
  960.                               <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
  961.                               <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
  962.                             </BinomialOrgName>
  963.                           </OrgName_name_binomial>
  964.                         </OrgName_name>
  965.                         <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
  966.                         <OrgName_gcode>1</OrgName_gcode>
  967.                         <OrgName_mgcode>1</OrgName_mgcode>
  968.                         <OrgName_div>PLN</OrgName_div>
  969.                       </OrgName>
  970.                     </Org-ref_orgname>
  971.                   </Org-ref>
  972.                 </BioSource_org>
  973.                 <BioSource_subtype>
  974.                   <SubSource>
  975.                     <SubSource_subtype value="clone">3</SubSource_subtype>
  976.                     <SubSource_name>RHPOTKEY182_L22</SubSource_name>
  977.                   </SubSource>
  978.                   <SubSource>
  979.                     <SubSource_subtype value="clone-lib">11</SubSource_subtype>
  980.                     <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
  981.                   </SubSource>
  982.                 </BioSource_subtype>
  983.               </BioSource>
  984.             </Seqdesc_source>
  985.           </Seqdesc>
  986.           <Seqdesc>
  987.             <Seqdesc_pub>
  988.               <Pubdesc>
  989.                 <Pubdesc_pub>
  990.                   <Pub-equiv>
  991.                     <Pub>
  992.                       <Pub_pmid>
  993.                         <PubMedId>18554403</PubMedId>
  994.                       </Pub_pmid>
  995.                     </Pub>
  996.                     <Pub>
  997.                       <Pub_article>
  998.                         <Cit-art>
  999.                           <Cit-art_title>
  1000.                             <Title>
  1001.                               <Title_E>
  1002.                                 <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
  1003.                               </Title_E>
  1004.                             </Title>
  1005.                           </Cit-art_title>
  1006.                           <Cit-art_authors>
  1007.                             <Auth-list>
  1008.                               <Auth-list_names>
  1009.                                 <Auth-list_names_std>
  1010.                                   <Author>
  1011.                                     <Author_name>
  1012.                                       <Person-id>
  1013.                                         <Person-id_name>
  1014.                                           <Name-std>
  1015.                                             <Name-std_last>Zhu</Name-std_last>
  1016.                                             <Name-std_initials>W.</Name-std_initials>
  1017.                                           </Name-std>
  1018.                                         </Person-id_name>
  1019.                                       </Person-id>
  1020.                                     </Author_name>
  1021.                                   </Author>
  1022.                                   <Author>
  1023.                                     <Author_name>
  1024.                                       <Person-id>
  1025.                                         <Person-id_name>
  1026.                                           <Name-std>
  1027.                                             <Name-std_last>Ouyang</Name-std_last>
  1028.                                             <Name-std_initials>S.</Name-std_initials>
  1029.                                           </Name-std>
  1030.                                         </Person-id_name>
  1031.                                       </Person-id>
  1032.                                     </Author_name>
  1033.                                   </Author>
  1034.                                   <Author>
  1035.                                     <Author_name>
  1036.                                       <Person-id>
  1037.                                         <Person-id_name>
  1038.                                           <Name-std>
  1039.                                             <Name-std_last>Iovene</Name-std_last>
  1040.                                             <Name-std_initials>M.</Name-std_initials>
  1041.                                           </Name-std>
  1042.                                         </Person-id_name>
  1043.                                       </Person-id>
  1044.                                     </Author_name>
  1045.                                   </Author>
  1046.                                   <Author>
  1047.                                     <Author_name>
  1048.                                       <Person-id>
  1049.                                         <Person-id_name>
  1050.                                           <Name-std>
  1051.                                             <Name-std_last>O&apos;Brien</Name-std_last>
  1052.                                             <Name-std_initials>K.</Name-std_initials>
  1053.                                           </Name-std>
  1054.                                         </Person-id_name>
  1055.                                       </Person-id>
  1056.                                     </Author_name>
  1057.                                   </Author>
  1058.                                   <Author>
  1059.                                     <Author_name>
  1060.                                       <Person-id>
  1061.                                         <Person-id_name>
  1062.                                           <Name-std>
  1063.                                             <Name-std_last>Vuong</Name-std_last>
  1064.                                             <Name-std_initials>H.</Name-std_initials>
  1065.                                           </Name-std>
  1066.                                         </Person-id_name>
  1067.                                       </Person-id>
  1068.                                     </Author_name>
  1069.                                   </Author>
  1070.                                   <Author>
  1071.                                     <Author_name>
  1072.                                       <Person-id>
  1073.                                         <Person-id_name>
  1074.                                           <Name-std>
  1075.                                             <Name-std_last>Jiang</Name-std_last>
  1076.                                             <Name-std_initials>J.</Name-std_initials>
  1077.                                           </Name-std>
  1078.                                         </Person-id_name>
  1079.                                       </Person-id>
  1080.                                     </Author_name>
  1081.                                   </Author>
  1082.                                   <Author>
  1083.                                     <Author_name>
  1084.                                       <Person-id>
  1085.                                         <Person-id_name>
  1086.                                           <Name-std>
  1087.                                             <Name-std_last>Buell</Name-std_last>
  1088.                                             <Name-std_initials>C.R.</Name-std_initials>
  1089.                                           </Name-std>
  1090.                                         </Person-id_name>
  1091.                                       </Person-id>
  1092.                                     </Author_name>
  1093.                                   </Author>
  1094.                                 </Auth-list_names_std>
  1095.                               </Auth-list_names>
  1096.                             </Auth-list>
  1097.                           </Cit-art_authors>
  1098.                           <Cit-art_from>
  1099.                             <Cit-art_from_journal>
  1100.                               <Cit-jour>
  1101.                                 <Cit-jour_title>
  1102.                                   <Title>
  1103.                                     <Title_E>
  1104.                                       <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
  1105.                                     </Title_E>
  1106.                                   </Title>
  1107.                                 </Cit-jour_title>
  1108.                                 <Cit-jour_imp>
  1109.                                   <Imprint>
  1110.                                     <Imprint_date>
  1111.                                       <Date>
  1112.                                         <Date_std>
  1113.                                           <Date-std>
  1114.                                             <Date-std_year>2008</Date-std_year>
  1115.                                           </Date-std>
  1116.                                         </Date_std>
  1117.                                       </Date>
  1118.                                     </Imprint_date>
  1119.                                     <Imprint_volume>9</Imprint_volume>
  1120.                                     <Imprint_issue>1</Imprint_issue>
  1121.                                     <Imprint_pages>286</Imprint_pages>
  1122.                                   </Imprint>
  1123.                                 </Cit-jour_imp>
  1124.                               </Cit-jour>
  1125.                             </Cit-art_from_journal>
  1126.                           </Cit-art_from>
  1127.                         </Cit-art>
  1128.                       </Pub_article>
  1129.                     </Pub>
  1130.                   </Pub-equiv>
  1131.                 </Pubdesc_pub>
  1132.               </Pubdesc>
  1133.             </Seqdesc_pub>
  1134.           </Seqdesc>
  1135.         </Seq-descr>
  1136.       </Bioseq_descr>
  1137.       <Bioseq_inst>
  1138.         <Seq-inst>
  1139.           <Seq-inst_repr value="raw"/>
  1140.           <Seq-inst_mol value="dna"/>
  1141.           <Seq-inst_length>382</Seq-inst_length>
  1142.           <Seq-inst_strand value="ds"/>
  1143.           <Seq-inst_seq-data>
  1144.             <Seq-data>
  1145.               <Seq-data_iupacna>
  1146.                 <IUPACna>TATTCCAGCTAAATTTCATGTTTTCAATGTCAACTTTCTATGTTTTATATGAGTAAACTCAAGTTGGTTTCATTATTTAGAGTTTAAGGGGATCACTCAGAATATCAAGAGAATATGTTTCTAGATTCATACACTGGTTAAAAATTATATGTTTAGATTCATATATGATACGTGTCTAGAGACTCATTATACTTGAAGATTTGAATAAGTAAAATCTTGTAGAACATTGTTATAGGAATAGAACATTTTCTTACTTCATTAGCATAAAAATTGATTACCTATCTAATCGTATGTACTTTAAGACTTTCTATATAAGGAACACCTCTTGTATATTGTTTCTTAATCAAGTCAATGAGAAGTTTTTCCTAATTTAACATGGCCT</IUPACna>
  1147.               </Seq-data_iupacna>
  1148.             </Seq-data>
  1149.           </Seq-inst_seq-data>
  1150.         </Seq-inst>
  1151.       </Bioseq_inst>
  1152.     </Bioseq>
  1153.   </Seq-entry_seq>
  1154. </Seq-entry>
  1155.  
  1156. <Seq-entry>
  1157.   <Seq-entry_seq>
  1158.     <Bioseq>
  1159.       <Bioseq_id>
  1160.         <Seq-id>
  1161.           <Seq-id_general>
  1162.             <Dbtag>
  1163.               <Dbtag_db>dbGSS</Dbtag_db>
  1164.               <Dbtag_tag>
  1165.                 <Object-id>
  1166.                   <Object-id_id>20893445</Object-id_id>
  1167.                 </Object-id>
  1168.               </Dbtag_tag>
  1169.             </Dbtag>
  1170.           </Seq-id_general>
  1171.         </Seq-id>
  1172.         <Seq-id>
  1173.           <Seq-id_genbank>
  1174.             <Textseq-id>
  1175.               <Textseq-id_accession>ER870411</Textseq-id_accession>
  1176.               <Textseq-id_version>1</Textseq-id_version>
  1177.             </Textseq-id>
  1178.           </Seq-id_genbank>
  1179.         </Seq-id>
  1180.         <Seq-id>
  1181.           <Seq-id_gi>148466250</Seq-id_gi>
  1182.         </Seq-id>
  1183.       </Bioseq_id>
  1184.       <Bioseq_descr>
  1185.         <Seq-descr>
  1186.           <Seqdesc>
  1187.             <Seqdesc_molinfo>
  1188.               <MolInfo>
  1189.                 <MolInfo_biomol value="genomic">1</MolInfo_biomol>
  1190.                 <MolInfo_tech value="survey">4</MolInfo_tech>
  1191.               </MolInfo>
  1192.             </Seqdesc_molinfo>
  1193.           </Seqdesc>
  1194.           <Seqdesc>
  1195.             <Seqdesc_title>PPTHM74TF Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY187_N03.</Seqdesc_title>
  1196.           </Seqdesc>
  1197.           <Seqdesc>
  1198.             <Seqdesc_create-date>
  1199.               <Date>
  1200.                 <Date_std>
  1201.                   <Date-std>
  1202.                     <Date-std_year>2007</Date-std_year>
  1203.                     <Date-std_month>5</Date-std_month>
  1204.                     <Date-std_day>30</Date-std_day>
  1205.                   </Date-std>
  1206.                 </Date_std>
  1207.               </Date>
  1208.             </Seqdesc_create-date>
  1209.           </Seqdesc>
  1210.           <Seqdesc>
  1211.             <Seqdesc_update-date>
  1212.               <Date>
  1213.                 <Date_std>
  1214.                   <Date-std>
  1215.                     <Date-std_year>2008</Date-std_year>
  1216.                     <Date-std_month>6</Date-std_month>
  1217.                     <Date-std_day>18</Date-std_day>
  1218.                   </Date-std>
  1219.                 </Date_std>
  1220.               </Date>
  1221.             </Seqdesc_update-date>
  1222.           </Seqdesc>
  1223.           <Seqdesc>
  1224.             <Seqdesc_comment>Other_GSSs: PPTHM74TR~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: TGTAAAACGACGGCCAGT~Class: BAC ends</Seqdesc_comment>
  1225.           </Seqdesc>
  1226.           <Seqdesc>
  1227.             <Seqdesc_source>
  1228.               <BioSource>
  1229.                 <BioSource_org>
  1230.                   <Org-ref>
  1231.                     <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
  1232.                     <Org-ref_common>potato</Org-ref_common>
  1233.                     <Org-ref_db>
  1234.                       <Dbtag>
  1235.                         <Dbtag_db>taxon</Dbtag_db>
  1236.                         <Dbtag_tag>
  1237.                           <Object-id>
  1238.                             <Object-id_id>4113</Object-id_id>
  1239.                           </Object-id>
  1240.                         </Dbtag_tag>
  1241.                       </Dbtag>
  1242.                     </Org-ref_db>
  1243.                     <Org-ref_orgname>
  1244.                       <OrgName>
  1245.                         <OrgName_name>
  1246.                           <OrgName_name_binomial>
  1247.                             <BinomialOrgName>
  1248.                               <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
  1249.                               <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
  1250.                             </BinomialOrgName>
  1251.                           </OrgName_name_binomial>
  1252.                         </OrgName_name>
  1253.                         <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
  1254.                         <OrgName_gcode>1</OrgName_gcode>
  1255.                         <OrgName_mgcode>1</OrgName_mgcode>
  1256.                         <OrgName_div>PLN</OrgName_div>
  1257.                       </OrgName>
  1258.                     </Org-ref_orgname>
  1259.                   </Org-ref>
  1260.                 </BioSource_org>
  1261.                 <BioSource_subtype>
  1262.                   <SubSource>
  1263.                     <SubSource_subtype value="clone">3</SubSource_subtype>
  1264.                     <SubSource_name>RHPOTKEY187_N03</SubSource_name>
  1265.                   </SubSource>
  1266.                   <SubSource>
  1267.                     <SubSource_subtype value="clone-lib">11</SubSource_subtype>
  1268.                     <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
  1269.                   </SubSource>
  1270.                 </BioSource_subtype>
  1271.               </BioSource>
  1272.             </Seqdesc_source>
  1273.           </Seqdesc>
  1274.           <Seqdesc>
  1275.             <Seqdesc_pub>
  1276.               <Pubdesc>
  1277.                 <Pubdesc_pub>
  1278.                   <Pub-equiv>
  1279.                     <Pub>
  1280.                       <Pub_pmid>
  1281.                         <PubMedId>18554403</PubMedId>
  1282.                       </Pub_pmid>
  1283.                     </Pub>
  1284.                     <Pub>
  1285.                       <Pub_article>
  1286.                         <Cit-art>
  1287.                           <Cit-art_title>
  1288.                             <Title>
  1289.                               <Title_E>
  1290.                                 <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
  1291.                               </Title_E>
  1292.                             </Title>
  1293.                           </Cit-art_title>
  1294.                           <Cit-art_authors>
  1295.                             <Auth-list>
  1296.                               <Auth-list_names>
  1297.                                 <Auth-list_names_std>
  1298.                                   <Author>
  1299.                                     <Author_name>
  1300.                                       <Person-id>
  1301.                                         <Person-id_name>
  1302.                                           <Name-std>
  1303.                                             <Name-std_last>Zhu</Name-std_last>
  1304.                                             <Name-std_initials>W.</Name-std_initials>
  1305.                                           </Name-std>
  1306.                                         </Person-id_name>
  1307.                                       </Person-id>
  1308.                                     </Author_name>
  1309.                                   </Author>
  1310.                                   <Author>
  1311.                                     <Author_name>
  1312.                                       <Person-id>
  1313.                                         <Person-id_name>
  1314.                                           <Name-std>
  1315.                                             <Name-std_last>Ouyang</Name-std_last>
  1316.                                             <Name-std_initials>S.</Name-std_initials>
  1317.                                           </Name-std>
  1318.                                         </Person-id_name>
  1319.                                       </Person-id>
  1320.                                     </Author_name>
  1321.                                   </Author>
  1322.                                   <Author>
  1323.                                     <Author_name>
  1324.                                       <Person-id>
  1325.                                         <Person-id_name>
  1326.                                           <Name-std>
  1327.                                             <Name-std_last>Iovene</Name-std_last>
  1328.                                             <Name-std_initials>M.</Name-std_initials>
  1329.                                           </Name-std>
  1330.                                         </Person-id_name>
  1331.                                       </Person-id>
  1332.                                     </Author_name>
  1333.                                   </Author>
  1334.                                   <Author>
  1335.                                     <Author_name>
  1336.                                       <Person-id>
  1337.                                         <Person-id_name>
  1338.                                           <Name-std>
  1339.                                             <Name-std_last>O&apos;Brien</Name-std_last>
  1340.                                             <Name-std_initials>K.</Name-std_initials>
  1341.                                           </Name-std>
  1342.                                         </Person-id_name>
  1343.                                       </Person-id>
  1344.                                     </Author_name>
  1345.                                   </Author>
  1346.                                   <Author>
  1347.                                     <Author_name>
  1348.                                       <Person-id>
  1349.                                         <Person-id_name>
  1350.                                           <Name-std>
  1351.                                             <Name-std_last>Vuong</Name-std_last>
  1352.                                             <Name-std_initials>H.</Name-std_initials>
  1353.                                           </Name-std>
  1354.                                         </Person-id_name>
  1355.                                       </Person-id>
  1356.                                     </Author_name>
  1357.                                   </Author>
  1358.                                   <Author>
  1359.                                     <Author_name>
  1360.                                       <Person-id>
  1361.                                         <Person-id_name>
  1362.                                           <Name-std>
  1363.                                             <Name-std_last>Jiang</Name-std_last>
  1364.                                             <Name-std_initials>J.</Name-std_initials>
  1365.                                           </Name-std>
  1366.                                         </Person-id_name>
  1367.                                       </Person-id>
  1368.                                     </Author_name>
  1369.                                   </Author>
  1370.                                   <Author>
  1371.                                     <Author_name>
  1372.                                       <Person-id>
  1373.                                         <Person-id_name>
  1374.                                           <Name-std>
  1375.                                             <Name-std_last>Buell</Name-std_last>
  1376.                                             <Name-std_initials>C.R.</Name-std_initials>
  1377.                                           </Name-std>
  1378.                                         </Person-id_name>
  1379.                                       </Person-id>
  1380.                                     </Author_name>
  1381.                                   </Author>
  1382.                                 </Auth-list_names_std>
  1383.                               </Auth-list_names>
  1384.                             </Auth-list>
  1385.                           </Cit-art_authors>
  1386.                           <Cit-art_from>
  1387.                             <Cit-art_from_journal>
  1388.                               <Cit-jour>
  1389.                                 <Cit-jour_title>
  1390.                                   <Title>
  1391.                                     <Title_E>
  1392.                                       <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
  1393.                                     </Title_E>
  1394.                                   </Title>
  1395.                                 </Cit-jour_title>
  1396.                                 <Cit-jour_imp>
  1397.                                   <Imprint>
  1398.                                     <Imprint_date>
  1399.                                       <Date>
  1400.                                         <Date_std>
  1401.                                           <Date-std>
  1402.                                             <Date-std_year>2008</Date-std_year>
  1403.                                           </Date-std>
  1404.                                         </Date_std>
  1405.                                       </Date>
  1406.                                     </Imprint_date>
  1407.                                     <Imprint_volume>9</Imprint_volume>
  1408.                                     <Imprint_issue>1</Imprint_issue>
  1409.                                     <Imprint_pages>286</Imprint_pages>
  1410.                                   </Imprint>
  1411.                                 </Cit-jour_imp>
  1412.                               </Cit-jour>
  1413.                             </Cit-art_from_journal>
  1414.                           </Cit-art_from>
  1415.                         </Cit-art>
  1416.                       </Pub_article>
  1417.                     </Pub>
  1418.                   </Pub-equiv>
  1419.                 </Pubdesc_pub>
  1420.               </Pubdesc>
  1421.             </Seqdesc_pub>
  1422.           </Seqdesc>
  1423.         </Seq-descr>
  1424.       </Bioseq_descr>
  1425.       <Bioseq_inst>
  1426.         <Seq-inst>
  1427.           <Seq-inst_repr value="raw"/>
  1428.           <Seq-inst_mol value="dna"/>
  1429.           <Seq-inst_length>227</Seq-inst_length>
  1430.           <Seq-inst_strand value="ds"/>
  1431.           <Seq-inst_seq-data>
  1432.             <Seq-data>
  1433.               <Seq-data_iupacna>
  1434.                 <IUPACna>CCAGATATTTGAGATCTTTCTCTTTGAATAAGATCTCAATTCCAGCGACGGTTTCATTAGATATCTTACAACTAGAATCCCTCTTTTTTCCGATCCAGTTCCTCCACCAACGCGAACCCCAGTTAGATTCAGGCATGCTACACTTTTTAGTTATTGGGAGAACCCAAGTACTCTCTTTCGGATTCAGGAAACAACTCTCAGAGATCTTTTTTCCTTTGGGAAGATAC</IUPACna>
  1435.               </Seq-data_iupacna>
  1436.             </Seq-data>
  1437.           </Seq-inst_seq-data>
  1438.         </Seq-inst>
  1439.       </Bioseq_inst>
  1440.     </Bioseq>
  1441.   </Seq-entry_seq>
  1442. </Seq-entry>
  1443.  
  1444. <Seq-entry>
  1445.   <Seq-entry_seq>
  1446.     <Bioseq>
  1447.       <Bioseq_id>
  1448.         <Seq-id>
  1449.           <Seq-id_general>
  1450.             <Dbtag>
  1451.               <Dbtag_db>dbGSS</Dbtag_db>
  1452.               <Dbtag_tag>
  1453.                 <Object-id>
  1454.                   <Object-id_id>20893444</Object-id_id>
  1455.                 </Object-id>
  1456.               </Dbtag_tag>
  1457.             </Dbtag>
  1458.           </Seq-id_general>
  1459.         </Seq-id>
  1460.         <Seq-id>
  1461.           <Seq-id_genbank>
  1462.             <Textseq-id>
  1463.               <Textseq-id_accession>ER870410</Textseq-id_accession>
  1464.               <Textseq-id_version>1</Textseq-id_version>
  1465.             </Textseq-id>
  1466.           </Seq-id_genbank>
  1467.         </Seq-id>
  1468.         <Seq-id>
  1469.           <Seq-id_gi>148466249</Seq-id_gi>
  1470.         </Seq-id>
  1471.       </Bioseq_id>
  1472.       <Bioseq_descr>
  1473.         <Seq-descr>
  1474.           <Seqdesc>
  1475.             <Seqdesc_molinfo>
  1476.               <MolInfo>
  1477.                 <MolInfo_biomol value="genomic">1</MolInfo_biomol>
  1478.                 <MolInfo_tech value="survey">4</MolInfo_tech>
  1479.               </MolInfo>
  1480.             </Seqdesc_molinfo>
  1481.           </Seqdesc>
  1482.           <Seqdesc>
  1483.             <Seqdesc_title>PPTHX08TR Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY190_A16.</Seqdesc_title>
  1484.           </Seqdesc>
  1485.           <Seqdesc>
  1486.             <Seqdesc_create-date>
  1487.               <Date>
  1488.                 <Date_std>
  1489.                   <Date-std>
  1490.                     <Date-std_year>2007</Date-std_year>
  1491.                     <Date-std_month>5</Date-std_month>
  1492.                     <Date-std_day>30</Date-std_day>
  1493.                   </Date-std>
  1494.                 </Date_std>
  1495.               </Date>
  1496.             </Seqdesc_create-date>
  1497.           </Seqdesc>
  1498.           <Seqdesc>
  1499.             <Seqdesc_update-date>
  1500.               <Date>
  1501.                 <Date_std>
  1502.                   <Date-std>
  1503.                     <Date-std_year>2008</Date-std_year>
  1504.                     <Date-std_month>6</Date-std_month>
  1505.                     <Date-std_day>18</Date-std_day>
  1506.                   </Date-std>
  1507.                 </Date_std>
  1508.               </Date>
  1509.             </Seqdesc_update-date>
  1510.           </Seqdesc>
  1511.           <Seqdesc>
  1512.             <Seqdesc_comment>Other_GSSs: PPTHX08TF~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: CAGGAAACAGCTATGACC~Class: BAC ends</Seqdesc_comment>
  1513.           </Seqdesc>
  1514.           <Seqdesc>
  1515.             <Seqdesc_source>
  1516.               <BioSource>
  1517.                 <BioSource_org>
  1518.                   <Org-ref>
  1519.                     <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
  1520.                     <Org-ref_common>potato</Org-ref_common>
  1521.                     <Org-ref_db>
  1522.                       <Dbtag>
  1523.                         <Dbtag_db>taxon</Dbtag_db>
  1524.                         <Dbtag_tag>
  1525.                           <Object-id>
  1526.                             <Object-id_id>4113</Object-id_id>
  1527.                           </Object-id>
  1528.                         </Dbtag_tag>
  1529.                       </Dbtag>
  1530.                     </Org-ref_db>
  1531.                     <Org-ref_orgname>
  1532.                       <OrgName>
  1533.                         <OrgName_name>
  1534.                           <OrgName_name_binomial>
  1535.                             <BinomialOrgName>
  1536.                               <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
  1537.                               <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
  1538.                             </BinomialOrgName>
  1539.                           </OrgName_name_binomial>
  1540.                         </OrgName_name>
  1541.                         <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
  1542.                         <OrgName_gcode>1</OrgName_gcode>
  1543.                         <OrgName_mgcode>1</OrgName_mgcode>
  1544.                         <OrgName_div>PLN</OrgName_div>
  1545.                       </OrgName>
  1546.                     </Org-ref_orgname>
  1547.                   </Org-ref>
  1548.                 </BioSource_org>
  1549.                 <BioSource_subtype>
  1550.                   <SubSource>
  1551.                     <SubSource_subtype value="clone">3</SubSource_subtype>
  1552.                     <SubSource_name>RHPOTKEY190_A16</SubSource_name>
  1553.                   </SubSource>
  1554.                   <SubSource>
  1555.                     <SubSource_subtype value="clone-lib">11</SubSource_subtype>
  1556.                     <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
  1557.                   </SubSource>
  1558.                 </BioSource_subtype>
  1559.               </BioSource>
  1560.             </Seqdesc_source>
  1561.           </Seqdesc>
  1562.           <Seqdesc>
  1563.             <Seqdesc_pub>
  1564.               <Pubdesc>
  1565.                 <Pubdesc_pub>
  1566.                   <Pub-equiv>
  1567.                     <Pub>
  1568.                       <Pub_pmid>
  1569.                         <PubMedId>18554403</PubMedId>
  1570.                       </Pub_pmid>
  1571.                     </Pub>
  1572.                     <Pub>
  1573.                       <Pub_article>
  1574.                         <Cit-art>
  1575.                           <Cit-art_title>
  1576.                             <Title>
  1577.                               <Title_E>
  1578.                                 <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
  1579.                               </Title_E>
  1580.                             </Title>
  1581.                           </Cit-art_title>
  1582.                           <Cit-art_authors>
  1583.                             <Auth-list>
  1584.                               <Auth-list_names>
  1585.                                 <Auth-list_names_std>
  1586.                                   <Author>
  1587.                                     <Author_name>
  1588.                                       <Person-id>
  1589.                                         <Person-id_name>
  1590.                                           <Name-std>
  1591.                                             <Name-std_last>Zhu</Name-std_last>
  1592.                                             <Name-std_initials>W.</Name-std_initials>
  1593.                                           </Name-std>
  1594.                                         </Person-id_name>
  1595.                                       </Person-id>
  1596.                                     </Author_name>
  1597.                                   </Author>
  1598.                                   <Author>
  1599.                                     <Author_name>
  1600.                                       <Person-id>
  1601.                                         <Person-id_name>
  1602.                                           <Name-std>
  1603.                                             <Name-std_last>Ouyang</Name-std_last>
  1604.                                             <Name-std_initials>S.</Name-std_initials>
  1605.                                           </Name-std>
  1606.                                         </Person-id_name>
  1607.                                       </Person-id>
  1608.                                     </Author_name>
  1609.                                   </Author>
  1610.                                   <Author>
  1611.                                     <Author_name>
  1612.                                       <Person-id>
  1613.                                         <Person-id_name>
  1614.                                           <Name-std>
  1615.                                             <Name-std_last>Iovene</Name-std_last>
  1616.                                             <Name-std_initials>M.</Name-std_initials>
  1617.                                           </Name-std>
  1618.                                         </Person-id_name>
  1619.                                       </Person-id>
  1620.                                     </Author_name>
  1621.                                   </Author>
  1622.                                   <Author>
  1623.                                     <Author_name>
  1624.                                       <Person-id>
  1625.                                         <Person-id_name>
  1626.                                           <Name-std>
  1627.                                             <Name-std_last>O&apos;Brien</Name-std_last>
  1628.                                             <Name-std_initials>K.</Name-std_initials>
  1629.                                           </Name-std>
  1630.                                         </Person-id_name>
  1631.                                       </Person-id>
  1632.                                     </Author_name>
  1633.                                   </Author>
  1634.                                   <Author>
  1635.                                     <Author_name>
  1636.                                       <Person-id>
  1637.                                         <Person-id_name>
  1638.                                           <Name-std>
  1639.                                             <Name-std_last>Vuong</Name-std_last>
  1640.                                             <Name-std_initials>H.</Name-std_initials>
  1641.                                           </Name-std>
  1642.                                         </Person-id_name>
  1643.                                       </Person-id>
  1644.                                     </Author_name>
  1645.                                   </Author>
  1646.                                   <Author>
  1647.                                     <Author_name>
  1648.                                       <Person-id>
  1649.                                         <Person-id_name>
  1650.                                           <Name-std>
  1651.                                             <Name-std_last>Jiang</Name-std_last>
  1652.                                             <Name-std_initials>J.</Name-std_initials>
  1653.                                           </Name-std>
  1654.                                         </Person-id_name>
  1655.                                       </Person-id>
  1656.                                     </Author_name>
  1657.                                   </Author>
  1658.                                   <Author>
  1659.                                     <Author_name>
  1660.                                       <Person-id>
  1661.                                         <Person-id_name>
  1662.                                           <Name-std>
  1663.                                             <Name-std_last>Buell</Name-std_last>
  1664.                                             <Name-std_initials>C.R.</Name-std_initials>
  1665.                                           </Name-std>
  1666.                                         </Person-id_name>
  1667.                                       </Person-id>
  1668.                                     </Author_name>
  1669.                                   </Author>
  1670.                                 </Auth-list_names_std>
  1671.                               </Auth-list_names>
  1672.                             </Auth-list>
  1673.                           </Cit-art_authors>
  1674.                           <Cit-art_from>
  1675.                             <Cit-art_from_journal>
  1676.                               <Cit-jour>
  1677.                                 <Cit-jour_title>
  1678.                                   <Title>
  1679.                                     <Title_E>
  1680.                                       <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
  1681.                                     </Title_E>
  1682.                                   </Title>
  1683.                                 </Cit-jour_title>
  1684.                                 <Cit-jour_imp>
  1685.                                   <Imprint>
  1686.                                     <Imprint_date>
  1687.                                       <Date>
  1688.                                         <Date_std>
  1689.                                           <Date-std>
  1690.                                             <Date-std_year>2008</Date-std_year>
  1691.                                           </Date-std>
  1692.                                         </Date_std>
  1693.                                       </Date>
  1694.                                     </Imprint_date>
  1695.                                     <Imprint_volume>9</Imprint_volume>
  1696.                                     <Imprint_issue>1</Imprint_issue>
  1697.                                     <Imprint_pages>286</Imprint_pages>
  1698.                                   </Imprint>
  1699.                                 </Cit-jour_imp>
  1700.                               </Cit-jour>
  1701.                             </Cit-art_from_journal>
  1702.                           </Cit-art_from>
  1703.                         </Cit-art>
  1704.                       </Pub_article>
  1705.                     </Pub>
  1706.                   </Pub-equiv>
  1707.                 </Pubdesc_pub>
  1708.               </Pubdesc>
  1709.             </Seqdesc_pub>
  1710.           </Seqdesc>
  1711.         </Seq-descr>
  1712.       </Bioseq_descr>
  1713.       <Bioseq_inst>
  1714.         <Seq-inst>
  1715.           <Seq-inst_repr value="raw"/>
  1716.           <Seq-inst_mol value="dna"/>
  1717.           <Seq-inst_length>728</Seq-inst_length>
  1718.           <Seq-inst_strand value="ds"/>
  1719.           <Seq-inst_seq-data>
  1720.             <Seq-data>
  1721.               <Seq-data_iupacna>
  1722.                 <IUPACna>TTATTTGATGTTATTTGGTAGTAACAATAAAATATATTTTTTGTAAAATATTTTTGCACCAAAAGGGAAAAAAACTTCATTCACTTGTGAGCAAAAAATATTTTCTTGCTGGTATTTAAGCTTTCTTGAATATTGATATCTTTTTATGAGGAAATGACTTTGATATTTTATTTTGTTTAATGTTTATAGACGGATCCGAAAAAGATAAAATTGTTAAGGAAGTGATTGAGGCAATTGATCCTGAGGAGAAATCGATCACTTGGAAGGTAATTGGAGGAGATTTGCTAGAGTTGTATGATTCTCTTACTATTATCACAGCATGCGAACATGAGTGGACTACATGTTCATTTATATATGAGAAAAAAACTGAAGACACCCCAGAACCTCTTGTTCCATTTGGTTTCCTCCTTAATTTGATCAAGGAAATGGAGGGTCATCTTCTCAAATAATACAAGATCAATCTGGTATCTGATAGTTCTTATCGTTACGTATTTGTGTATGTCTACGTGAACACGCGTGTGAATTTATGAATATATATATATATATATGTGTGTGTGTGAGAGAGAGAGAGAGAGAGAGTTTGTGTTACAAATATATACTATATATGTGTGTGTGTGTGTGAAGTTTGTGTTACAAATATATACTATATTTTGTAATATTGGCTAATTCTAGCTAGTGTGTCAAAATTAGTAATGTTGTGTTAAAAATAAAGAATATATCGGATGTAT</IUPACna>
  1723.               </Seq-data_iupacna>
  1724.             </Seq-data>
  1725.           </Seq-inst_seq-data>
  1726.         </Seq-inst>
  1727.       </Bioseq_inst>
  1728.     </Bioseq>
  1729.   </Seq-entry_seq>
  1730. </Seq-entry>
  1731.  
  1732. <Seq-entry>
  1733.   <Seq-entry_seq>
  1734.     <Bioseq>
  1735.       <Bioseq_id>
  1736.         <Seq-id>
  1737.           <Seq-id_general>
  1738.             <Dbtag>
  1739.               <Dbtag_db>dbGSS</Dbtag_db>
  1740.               <Dbtag_tag>
  1741.                 <Object-id>
  1742.                   <Object-id_id>20893443</Object-id_id>
  1743.                 </Object-id>
  1744.               </Dbtag_tag>
  1745.             </Dbtag>
  1746.           </Seq-id_general>
  1747.         </Seq-id>
  1748.         <Seq-id>
  1749.           <Seq-id_genbank>
  1750.             <Textseq-id>
  1751.               <Textseq-id_accession>ER870409</Textseq-id_accession>
  1752.               <Textseq-id_version>1</Textseq-id_version>
  1753.             </Textseq-id>
  1754.           </Seq-id_genbank>
  1755.         </Seq-id>
  1756.         <Seq-id>
  1757.           <Seq-id_gi>148466248</Seq-id_gi>
  1758.         </Seq-id>
  1759.       </Bioseq_id>
  1760.       <Bioseq_descr>
  1761.         <Seq-descr>
  1762.           <Seqdesc>
  1763.             <Seqdesc_molinfo>
  1764.               <MolInfo>
  1765.                 <MolInfo_biomol value="genomic">1</MolInfo_biomol>
  1766.                 <MolInfo_tech value="survey">4</MolInfo_tech>
  1767.               </MolInfo>
  1768.             </Seqdesc_molinfo>
  1769.           </Seqdesc>
  1770.           <Seqdesc>
  1771.             <Seqdesc_title>PPTJ884TF Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY202_M23.</Seqdesc_title>
  1772.           </Seqdesc>
  1773.           <Seqdesc>
  1774.             <Seqdesc_create-date>
  1775.               <Date>
  1776.                 <Date_std>
  1777.                   <Date-std>
  1778.                     <Date-std_year>2007</Date-std_year>
  1779.                     <Date-std_month>5</Date-std_month>
  1780.                     <Date-std_day>30</Date-std_day>
  1781.                   </Date-std>
  1782.                 </Date_std>
  1783.               </Date>
  1784.             </Seqdesc_create-date>
  1785.           </Seqdesc>
  1786.           <Seqdesc>
  1787.             <Seqdesc_update-date>
  1788.               <Date>
  1789.                 <Date_std>
  1790.                   <Date-std>
  1791.                     <Date-std_year>2008</Date-std_year>
  1792.                     <Date-std_month>6</Date-std_month>
  1793.                     <Date-std_day>18</Date-std_day>
  1794.                   </Date-std>
  1795.                 </Date_std>
  1796.               </Date>
  1797.             </Seqdesc_update-date>
  1798.           </Seqdesc>
  1799.           <Seqdesc>
  1800.             <Seqdesc_comment>Other_GSSs: PPTJ884TR~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: TGTAAAACGACGGCCAGT~Class: BAC ends</Seqdesc_comment>
  1801.           </Seqdesc>
  1802.           <Seqdesc>
  1803.             <Seqdesc_source>
  1804.               <BioSource>
  1805.                 <BioSource_org>
  1806.                   <Org-ref>
  1807.                     <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
  1808.                     <Org-ref_common>potato</Org-ref_common>
  1809.                     <Org-ref_db>
  1810.                       <Dbtag>
  1811.                         <Dbtag_db>taxon</Dbtag_db>
  1812.                         <Dbtag_tag>
  1813.                           <Object-id>
  1814.                             <Object-id_id>4113</Object-id_id>
  1815.                           </Object-id>
  1816.                         </Dbtag_tag>
  1817.                       </Dbtag>
  1818.                     </Org-ref_db>
  1819.                     <Org-ref_orgname>
  1820.                       <OrgName>
  1821.                         <OrgName_name>
  1822.                           <OrgName_name_binomial>
  1823.                             <BinomialOrgName>
  1824.                               <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
  1825.                               <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
  1826.                             </BinomialOrgName>
  1827.                           </OrgName_name_binomial>
  1828.                         </OrgName_name>
  1829.                         <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
  1830.                         <OrgName_gcode>1</OrgName_gcode>
  1831.                         <OrgName_mgcode>1</OrgName_mgcode>
  1832.                         <OrgName_div>PLN</OrgName_div>
  1833.                       </OrgName>
  1834.                     </Org-ref_orgname>
  1835.                   </Org-ref>
  1836.                 </BioSource_org>
  1837.                 <BioSource_subtype>
  1838.                   <SubSource>
  1839.                     <SubSource_subtype value="clone">3</SubSource_subtype>
  1840.                     <SubSource_name>RHPOTKEY202_M23</SubSource_name>
  1841.                   </SubSource>
  1842.                   <SubSource>
  1843.                     <SubSource_subtype value="clone-lib">11</SubSource_subtype>
  1844.                     <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
  1845.                   </SubSource>
  1846.                 </BioSource_subtype>
  1847.               </BioSource>
  1848.             </Seqdesc_source>
  1849.           </Seqdesc>
  1850.           <Seqdesc>
  1851.             <Seqdesc_pub>
  1852.               <Pubdesc>
  1853.                 <Pubdesc_pub>
  1854.                   <Pub-equiv>
  1855.                     <Pub>
  1856.                       <Pub_pmid>
  1857.                         <PubMedId>18554403</PubMedId>
  1858.                       </Pub_pmid>
  1859.                     </Pub>
  1860.                     <Pub>
  1861.                       <Pub_article>
  1862.                         <Cit-art>
  1863.                           <Cit-art_title>
  1864.                             <Title>
  1865.                               <Title_E>
  1866.                                 <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
  1867.                               </Title_E>
  1868.                             </Title>
  1869.                           </Cit-art_title>
  1870.                           <Cit-art_authors>
  1871.                             <Auth-list>
  1872.                               <Auth-list_names>
  1873.                                 <Auth-list_names_std>
  1874.                                   <Author>
  1875.                                     <Author_name>
  1876.                                       <Person-id>
  1877.                                         <Person-id_name>
  1878.                                           <Name-std>
  1879.                                             <Name-std_last>Zhu</Name-std_last>
  1880.                                             <Name-std_initials>W.</Name-std_initials>
  1881.                                           </Name-std>
  1882.                                         </Person-id_name>
  1883.                                       </Person-id>
  1884.                                     </Author_name>
  1885.                                   </Author>
  1886.                                   <Author>
  1887.                                     <Author_name>
  1888.                                       <Person-id>
  1889.                                         <Person-id_name>
  1890.                                           <Name-std>
  1891.                                             <Name-std_last>Ouyang</Name-std_last>
  1892.                                             <Name-std_initials>S.</Name-std_initials>
  1893.                                           </Name-std>
  1894.                                         </Person-id_name>
  1895.                                       </Person-id>
  1896.                                     </Author_name>
  1897.                                   </Author>
  1898.                                   <Author>
  1899.                                     <Author_name>
  1900.                                       <Person-id>
  1901.                                         <Person-id_name>
  1902.                                           <Name-std>
  1903.                                             <Name-std_last>Iovene</Name-std_last>
  1904.                                             <Name-std_initials>M.</Name-std_initials>
  1905.                                           </Name-std>
  1906.                                         </Person-id_name>
  1907.                                       </Person-id>
  1908.                                     </Author_name>
  1909.                                   </Author>
  1910.                                   <Author>
  1911.                                     <Author_name>
  1912.                                       <Person-id>
  1913.                                         <Person-id_name>
  1914.                                           <Name-std>
  1915.                                             <Name-std_last>O&apos;Brien</Name-std_last>
  1916.                                             <Name-std_initials>K.</Name-std_initials>
  1917.                                           </Name-std>
  1918.                                         </Person-id_name>
  1919.                                       </Person-id>
  1920.                                     </Author_name>
  1921.                                   </Author>
  1922.                                   <Author>
  1923.                                     <Author_name>
  1924.                                       <Person-id>
  1925.                                         <Person-id_name>
  1926.                                           <Name-std>
  1927.                                             <Name-std_last>Vuong</Name-std_last>
  1928.                                             <Name-std_initials>H.</Name-std_initials>
  1929.                                           </Name-std>
  1930.                                         </Person-id_name>
  1931.                                       </Person-id>
  1932.                                     </Author_name>
  1933.                                   </Author>
  1934.                                   <Author>
  1935.                                     <Author_name>
  1936.                                       <Person-id>
  1937.                                         <Person-id_name>
  1938.                                           <Name-std>
  1939.                                             <Name-std_last>Jiang</Name-std_last>
  1940.                                             <Name-std_initials>J.</Name-std_initials>
  1941.                                           </Name-std>
  1942.                                         </Person-id_name>
  1943.                                       </Person-id>
  1944.                                     </Author_name>
  1945.                                   </Author>
  1946.                                   <Author>
  1947.                                     <Author_name>
  1948.                                       <Person-id>
  1949.                                         <Person-id_name>
  1950.                                           <Name-std>
  1951.                                             <Name-std_last>Buell</Name-std_last>
  1952.                                             <Name-std_initials>C.R.</Name-std_initials>
  1953.                                           </Name-std>
  1954.                                         </Person-id_name>
  1955.                                       </Person-id>
  1956.                                     </Author_name>
  1957.                                   </Author>
  1958.                                 </Auth-list_names_std>
  1959.                               </Auth-list_names>
  1960.                             </Auth-list>
  1961.                           </Cit-art_authors>
  1962.                           <Cit-art_from>
  1963.                             <Cit-art_from_journal>
  1964.                               <Cit-jour>
  1965.                                 <Cit-jour_title>
  1966.                                   <Title>
  1967.                                     <Title_E>
  1968.                                       <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
  1969.                                     </Title_E>
  1970.                                   </Title>
  1971.                                 </Cit-jour_title>
  1972.                                 <Cit-jour_imp>
  1973.                                   <Imprint>
  1974.                                     <Imprint_date>
  1975.                                       <Date>
  1976.                                         <Date_std>
  1977.                                           <Date-std>
  1978.                                             <Date-std_year>2008</Date-std_year>
  1979.                                           </Date-std>
  1980.                                         </Date_std>
  1981.                                       </Date>
  1982.                                     </Imprint_date>
  1983.                                     <Imprint_volume>9</Imprint_volume>
  1984.                                     <Imprint_issue>1</Imprint_issue>
  1985.                                     <Imprint_pages>286</Imprint_pages>
  1986.                                   </Imprint>
  1987.                                 </Cit-jour_imp>
  1988.                               </Cit-jour>
  1989.                             </Cit-art_from_journal>
  1990.                           </Cit-art_from>
  1991.                         </Cit-art>
  1992.                       </Pub_article>
  1993.                     </Pub>
  1994.                   </Pub-equiv>
  1995.                 </Pubdesc_pub>
  1996.               </Pubdesc>
  1997.             </Seqdesc_pub>
  1998.           </Seqdesc>
  1999.         </Seq-descr>
  2000.       </Bioseq_descr>
  2001.       <Bioseq_inst>
  2002.         <Seq-inst>
  2003.           <Seq-inst_repr value="raw"/>
  2004.           <Seq-inst_mol value="dna"/>
  2005.           <Seq-inst_length>286</Seq-inst_length>
  2006.           <Seq-inst_strand value="ds"/>
  2007.           <Seq-inst_seq-data>
  2008.             <Seq-data>
  2009.               <Seq-data_iupacna>
  2010.                 <IUPACna>TTGAAGAAGTAAGGTTCTTGAAGAACAAATTGTAGAATTCTTGTTGGTTGAGTTGTTGATGCTTGGGGGTGAGTTGATTCATGTTTTCGAGTTGCTTTTCGTGTTAGATTGGTTGTATATTGAGGGTACAATTGATCCTAAGTGTTTGGGGAAGGAACTATGGAAGTTAGGGAGGTTTAGAGAGGAAGAACGGAAGAGAAAAGTCAGAAGTCGCTGGGCAAAAGGGCTGGGGCTCCGCGCCTGCCACAACGCCACAAAAACTTCTCTGAAGTTTGGCCTTTGGCGT</IUPACna>
  2011.               </Seq-data_iupacna>
  2012.             </Seq-data>
  2013.           </Seq-inst_seq-data>
  2014.         </Seq-inst>
  2015.       </Bioseq_inst>
  2016.     </Bioseq>
  2017.   </Seq-entry_seq>
  2018. </Seq-entry>
  2019.  
  2020. <Seq-entry>
  2021.   <Seq-entry_seq>
  2022.     <Bioseq>
  2023.       <Bioseq_id>
  2024.         <Seq-id>
  2025.           <Seq-id_general>
  2026.             <Dbtag>
  2027.               <Dbtag_db>dbGSS</Dbtag_db>
  2028.               <Dbtag_tag>
  2029.                 <Object-id>
  2030.                   <Object-id_id>20893442</Object-id_id>
  2031.                 </Object-id>
  2032.               </Dbtag_tag>
  2033.             </Dbtag>
  2034.           </Seq-id_general>
  2035.         </Seq-id>
  2036.         <Seq-id>
  2037.           <Seq-id_genbank>
  2038.             <Textseq-id>
  2039.               <Textseq-id_accession>ER870408</Textseq-id_accession>
  2040.               <Textseq-id_version>1</Textseq-id_version>
  2041.             </Textseq-id>
  2042.           </Seq-id_genbank>
  2043.         </Seq-id>
  2044.         <Seq-id>
  2045.           <Seq-id_gi>148466247</Seq-id_gi>
  2046.         </Seq-id>
  2047.       </Bioseq_id>
  2048.       <Bioseq_descr>
  2049.         <Seq-descr>
  2050.           <Seqdesc>
  2051.             <Seqdesc_molinfo>
  2052.               <MolInfo>
  2053.                 <MolInfo_biomol value="genomic">1</MolInfo_biomol>
  2054.                 <MolInfo_tech value="survey">4</MolInfo_tech>
  2055.               </MolInfo>
  2056.             </Seqdesc_molinfo>
  2057.           </Seqdesc>
  2058.           <Seqdesc>
  2059.             <Seqdesc_title>POTN776TF Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY119_N08.</Seqdesc_title>
  2060.           </Seqdesc>
  2061.           <Seqdesc>
  2062.             <Seqdesc_create-date>
  2063.               <Date>
  2064.                 <Date_std>
  2065.                   <Date-std>
  2066.                     <Date-std_year>2007</Date-std_year>
  2067.                     <Date-std_month>5</Date-std_month>
  2068.                     <Date-std_day>30</Date-std_day>
  2069.                   </Date-std>
  2070.                 </Date_std>
  2071.               </Date>
  2072.             </Seqdesc_create-date>
  2073.           </Seqdesc>
  2074.           <Seqdesc>
  2075.             <Seqdesc_update-date>
  2076.               <Date>
  2077.                 <Date_std>
  2078.                   <Date-std>
  2079.                     <Date-std_year>2008</Date-std_year>
  2080.                     <Date-std_month>6</Date-std_month>
  2081.                     <Date-std_day>18</Date-std_day>
  2082.                   </Date-std>
  2083.                 </Date_std>
  2084.               </Date>
  2085.             </Seqdesc_update-date>
  2086.           </Seqdesc>
  2087.           <Seqdesc>
  2088.             <Seqdesc_comment>Other_GSSs: POTN776TR~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: TGTAAAACGACGGCCAGT~Class: BAC ends</Seqdesc_comment>
  2089.           </Seqdesc>
  2090.           <Seqdesc>
  2091.             <Seqdesc_source>
  2092.               <BioSource>
  2093.                 <BioSource_org>
  2094.                   <Org-ref>
  2095.                     <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
  2096.                     <Org-ref_common>potato</Org-ref_common>
  2097.                     <Org-ref_db>
  2098.                       <Dbtag>
  2099.                         <Dbtag_db>taxon</Dbtag_db>
  2100.                         <Dbtag_tag>
  2101.                           <Object-id>
  2102.                             <Object-id_id>4113</Object-id_id>
  2103.                           </Object-id>
  2104.                         </Dbtag_tag>
  2105.                       </Dbtag>
  2106.                     </Org-ref_db>
  2107.                     <Org-ref_orgname>
  2108.                       <OrgName>
  2109.                         <OrgName_name>
  2110.                           <OrgName_name_binomial>
  2111.                             <BinomialOrgName>
  2112.                               <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
  2113.                               <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
  2114.                             </BinomialOrgName>
  2115.                           </OrgName_name_binomial>
  2116.                         </OrgName_name>
  2117.                         <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
  2118.                         <OrgName_gcode>1</OrgName_gcode>
  2119.                         <OrgName_mgcode>1</OrgName_mgcode>
  2120.                         <OrgName_div>PLN</OrgName_div>
  2121.                       </OrgName>
  2122.                     </Org-ref_orgname>
  2123.                   </Org-ref>
  2124.                 </BioSource_org>
  2125.                 <BioSource_subtype>
  2126.                   <SubSource>
  2127.                     <SubSource_subtype value="clone">3</SubSource_subtype>
  2128.                     <SubSource_name>RHPOTKEY119_N08</SubSource_name>
  2129.                   </SubSource>
  2130.                   <SubSource>
  2131.                     <SubSource_subtype value="clone-lib">11</SubSource_subtype>
  2132.                     <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
  2133.                   </SubSource>
  2134.                 </BioSource_subtype>
  2135.               </BioSource>
  2136.             </Seqdesc_source>
  2137.           </Seqdesc>
  2138.           <Seqdesc>
  2139.             <Seqdesc_pub>
  2140.               <Pubdesc>
  2141.                 <Pubdesc_pub>
  2142.                   <Pub-equiv>
  2143.                     <Pub>
  2144.                       <Pub_pmid>
  2145.                         <PubMedId>18554403</PubMedId>
  2146.                       </Pub_pmid>
  2147.                     </Pub>
  2148.                     <Pub>
  2149.                       <Pub_article>
  2150.                         <Cit-art>
  2151.                           <Cit-art_title>
  2152.                             <Title>
  2153.                               <Title_E>
  2154.                                 <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
  2155.                               </Title_E>
  2156.                             </Title>
  2157.                           </Cit-art_title>
  2158.                           <Cit-art_authors>
  2159.                             <Auth-list>
  2160.                               <Auth-list_names>
  2161.                                 <Auth-list_names_std>
  2162.                                   <Author>
  2163.                                     <Author_name>
  2164.                                       <Person-id>
  2165.                                         <Person-id_name>
  2166.                                           <Name-std>
  2167.                                             <Name-std_last>Zhu</Name-std_last>
  2168.                                             <Name-std_initials>W.</Name-std_initials>
  2169.                                           </Name-std>
  2170.                                         </Person-id_name>
  2171.                                       </Person-id>
  2172.                                     </Author_name>
  2173.                                   </Author>
  2174.                                   <Author>
  2175.                                     <Author_name>
  2176.                                       <Person-id>
  2177.                                         <Person-id_name>
  2178.                                           <Name-std>
  2179.                                             <Name-std_last>Ouyang</Name-std_last>
  2180.                                             <Name-std_initials>S.</Name-std_initials>
  2181.                                           </Name-std>
  2182.                                         </Person-id_name>
  2183.                                       </Person-id>
  2184.                                     </Author_name>
  2185.                                   </Author>
  2186.                                   <Author>
  2187.                                     <Author_name>
  2188.                                       <Person-id>
  2189.                                         <Person-id_name>
  2190.                                           <Name-std>
  2191.                                             <Name-std_last>Iovene</Name-std_last>
  2192.                                             <Name-std_initials>M.</Name-std_initials>
  2193.                                           </Name-std>
  2194.                                         </Person-id_name>
  2195.                                       </Person-id>
  2196.                                     </Author_name>
  2197.                                   </Author>
  2198.                                   <Author>
  2199.                                     <Author_name>
  2200.                                       <Person-id>
  2201.                                         <Person-id_name>
  2202.                                           <Name-std>
  2203.                                             <Name-std_last>O&apos;Brien</Name-std_last>
  2204.                                             <Name-std_initials>K.</Name-std_initials>
  2205.                                           </Name-std>
  2206.                                         </Person-id_name>
  2207.                                       </Person-id>
  2208.                                     </Author_name>
  2209.                                   </Author>
  2210.                                   <Author>
  2211.                                     <Author_name>
  2212.                                       <Person-id>
  2213.                                         <Person-id_name>
  2214.                                           <Name-std>
  2215.                                             <Name-std_last>Vuong</Name-std_last>
  2216.                                             <Name-std_initials>H.</Name-std_initials>
  2217.                                           </Name-std>
  2218.                                         </Person-id_name>
  2219.                                       </Person-id>
  2220.                                     </Author_name>
  2221.                                   </Author>
  2222.                                   <Author>
  2223.                                     <Author_name>
  2224.                                       <Person-id>
  2225.                                         <Person-id_name>
  2226.                                           <Name-std>
  2227.                                             <Name-std_last>Jiang</Name-std_last>
  2228.                                             <Name-std_initials>J.</Name-std_initials>
  2229.                                           </Name-std>
  2230.                                         </Person-id_name>
  2231.                                       </Person-id>
  2232.                                     </Author_name>
  2233.                                   </Author>
  2234.                                   <Author>
  2235.                                     <Author_name>
  2236.                                       <Person-id>
  2237.                                         <Person-id_name>
  2238.                                           <Name-std>
  2239.                                             <Name-std_last>Buell</Name-std_last>
  2240.                                             <Name-std_initials>C.R.</Name-std_initials>
  2241.                                           </Name-std>
  2242.                                         </Person-id_name>
  2243.                                       </Person-id>
  2244.                                     </Author_name>
  2245.                                   </Author>
  2246.                                 </Auth-list_names_std>
  2247.                               </Auth-list_names>
  2248.                             </Auth-list>
  2249.                           </Cit-art_authors>
  2250.                           <Cit-art_from>
  2251.                             <Cit-art_from_journal>
  2252.                               <Cit-jour>
  2253.                                 <Cit-jour_title>
  2254.                                   <Title>
  2255.                                     <Title_E>
  2256.                                       <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
  2257.                                     </Title_E>
  2258.                                   </Title>
  2259.                                 </Cit-jour_title>
  2260.                                 <Cit-jour_imp>
  2261.                                   <Imprint>
  2262.                                     <Imprint_date>
  2263.                                       <Date>
  2264.                                         <Date_std>
  2265.                                           <Date-std>
  2266.                                             <Date-std_year>2008</Date-std_year>
  2267.                                           </Date-std>
  2268.                                         </Date_std>
  2269.                                       </Date>
  2270.                                     </Imprint_date>
  2271.                                     <Imprint_volume>9</Imprint_volume>
  2272.                                     <Imprint_issue>1</Imprint_issue>
  2273.                                     <Imprint_pages>286</Imprint_pages>
  2274.                                   </Imprint>
  2275.                                 </Cit-jour_imp>
  2276.                               </Cit-jour>
  2277.                             </Cit-art_from_journal>
  2278.                           </Cit-art_from>
  2279.                         </Cit-art>
  2280.                       </Pub_article>
  2281.                     </Pub>
  2282.                   </Pub-equiv>
  2283.                 </Pubdesc_pub>
  2284.               </Pubdesc>
  2285.             </Seqdesc_pub>
  2286.           </Seqdesc>
  2287.         </Seq-descr>
  2288.       </Bioseq_descr>
  2289.       <Bioseq_inst>
  2290.         <Seq-inst>
  2291.           <Seq-inst_repr value="raw"/>
  2292.           <Seq-inst_mol value="dna"/>
  2293.           <Seq-inst_length>798</Seq-inst_length>
  2294.           <Seq-inst_strand value="ds"/>
  2295.           <Seq-inst_seq-data>
  2296.             <Seq-data>
  2297.               <Seq-data_iupacna>
  2298.                 <IUPACna>AATTTCCTATATAAAGTGTTGCATGACCATGCCCGGTCCGGGGGAAAAGAACCGGACAACCATGTGAGAGGTTTATATCTCACCACCTAGGATGCTTGGGGTGTGACCAACATCAACCATGTGAGAGGTTTATATCTCACCACCTAGGATGCTTGGGGTGTGACCAACATCAACCATGTGAGAGGTTTATATCTCACCACCTAGGATGCTTGGGGTGTGACCAACATCAACCATGTGAGAGGTTTATATCTCACCACCTAGGATGCTTGGGGTGTGACCAACATCAACCATGTGAGGGGTTTATACCTTGCCACCAGGGTGTCCGGGTGTGAACGGCATCCCCCATCCTAAGTTGGGGTTATAGATTGGTTGGATCATGCATACACATATGATATCTACTATTAGTATAAAGTTACTTAAACATGTTTTGACTTCACTTTGATCATGCATCCTCATATTGTTATTCATAATGCCTATGAAACTATTTCTTGTATTTCGATTGTGTCCTTGTCTATTGTTGTGTTGCACCCCGCATACTTAGTACATTCCAAGTACTAACGCATATTTTGCCTACATGATGTCACCATGTAGGGACCGGAGTTACTCTTGATCCTTCTCTTCATTCACGTGGCTAGTACGGTGCTTATCCGAGTTGTTGGTGAGTCCTCAATGATTCGAGGGCAATGTTATGTTTCCTACTCCTATGTTTTGAGACTTTAGCTTGCAATTGTATTTTGACTATGAGGGGAGCCGGTAGAATGTCATGGCCCCGTCCTATCTATGTATGTAGAGGTGTGC</IUPACna>
  2299.               </Seq-data_iupacna>
  2300.             </Seq-data>
  2301.           </Seq-inst_seq-data>
  2302.         </Seq-inst>
  2303.       </Bioseq_inst>
  2304.     </Bioseq>
  2305.   </Seq-entry_seq>
  2306. </Seq-entry>
  2307.  
  2308. <Seq-entry>
  2309.   <Seq-entry_seq>
  2310.     <Bioseq>
  2311.       <Bioseq_id>
  2312.         <Seq-id>
  2313.           <Seq-id_general>
  2314.             <Dbtag>
  2315.               <Dbtag_db>dbGSS</Dbtag_db>
  2316.               <Dbtag_tag>
  2317.                 <Object-id>
  2318.                   <Object-id_id>20893441</Object-id_id>
  2319.                 </Object-id>
  2320.               </Dbtag_tag>
  2321.             </Dbtag>
  2322.           </Seq-id_general>
  2323.         </Seq-id>
  2324.         <Seq-id>
  2325.           <Seq-id_genbank>
  2326.             <Textseq-id>
  2327.               <Textseq-id_accession>ER870407</Textseq-id_accession>
  2328.               <Textseq-id_version>1</Textseq-id_version>
  2329.             </Textseq-id>
  2330.           </Seq-id_genbank>
  2331.         </Seq-id>
  2332.         <Seq-id>
  2333.           <Seq-id_gi>148466246</Seq-id_gi>
  2334.         </Seq-id>
  2335.       </Bioseq_id>
  2336.       <Bioseq_descr>
  2337.         <Seq-descr>
  2338.           <Seqdesc>
  2339.             <Seqdesc_molinfo>
  2340.               <MolInfo>
  2341.                 <MolInfo_biomol value="genomic">1</MolInfo_biomol>
  2342.                 <MolInfo_tech value="survey">4</MolInfo_tech>
  2343.               </MolInfo>
  2344.             </Seqdesc_molinfo>
  2345.           </Seqdesc>
  2346.           <Seqdesc>
  2347.             <Seqdesc_title>PPTFO31TR Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY170_E13.</Seqdesc_title>
  2348.           </Seqdesc>
  2349.           <Seqdesc>
  2350.             <Seqdesc_create-date>
  2351.               <Date>
  2352.                 <Date_std>
  2353.                   <Date-std>
  2354.                     <Date-std_year>2007</Date-std_year>
  2355.                     <Date-std_month>5</Date-std_month>
  2356.                     <Date-std_day>30</Date-std_day>
  2357.                   </Date-std>
  2358.                 </Date_std>
  2359.               </Date>
  2360.             </Seqdesc_create-date>
  2361.           </Seqdesc>
  2362.           <Seqdesc>
  2363.             <Seqdesc_update-date>
  2364.               <Date>
  2365.                 <Date_std>
  2366.                   <Date-std>
  2367.                     <Date-std_year>2008</Date-std_year>
  2368.                     <Date-std_month>6</Date-std_month>
  2369.                     <Date-std_day>18</Date-std_day>
  2370.                   </Date-std>
  2371.                 </Date_std>
  2372.               </Date>
  2373.             </Seqdesc_update-date>
  2374.           </Seqdesc>
  2375.           <Seqdesc>
  2376.             <Seqdesc_comment>Other_GSSs: PPTFO31TF~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: CAGGAAACAGCTATGACC~Class: BAC ends</Seqdesc_comment>
  2377.           </Seqdesc>
  2378.           <Seqdesc>
  2379.             <Seqdesc_source>
  2380.               <BioSource>
  2381.                 <BioSource_org>
  2382.                   <Org-ref>
  2383.                     <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
  2384.                     <Org-ref_common>potato</Org-ref_common>
  2385.                     <Org-ref_db>
  2386.                       <Dbtag>
  2387.                         <Dbtag_db>taxon</Dbtag_db>
  2388.                         <Dbtag_tag>
  2389.                           <Object-id>
  2390.                             <Object-id_id>4113</Object-id_id>
  2391.                           </Object-id>
  2392.                         </Dbtag_tag>
  2393.                       </Dbtag>
  2394.                     </Org-ref_db>
  2395.                     <Org-ref_orgname>
  2396.                       <OrgName>
  2397.                         <OrgName_name>
  2398.                           <OrgName_name_binomial>
  2399.                             <BinomialOrgName>
  2400.                               <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
  2401.                               <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
  2402.                             </BinomialOrgName>
  2403.                           </OrgName_name_binomial>
  2404.                         </OrgName_name>
  2405.                         <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
  2406.                         <OrgName_gcode>1</OrgName_gcode>
  2407.                         <OrgName_mgcode>1</OrgName_mgcode>
  2408.                         <OrgName_div>PLN</OrgName_div>
  2409.                       </OrgName>
  2410.                     </Org-ref_orgname>
  2411.                   </Org-ref>
  2412.                 </BioSource_org>
  2413.                 <BioSource_subtype>
  2414.                   <SubSource>
  2415.                     <SubSource_subtype value="clone">3</SubSource_subtype>
  2416.                     <SubSource_name>RHPOTKEY170_E13</SubSource_name>
  2417.                   </SubSource>
  2418.                   <SubSource>
  2419.                     <SubSource_subtype value="clone-lib">11</SubSource_subtype>
  2420.                     <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
  2421.                   </SubSource>
  2422.                 </BioSource_subtype>
  2423.               </BioSource>
  2424.             </Seqdesc_source>
  2425.           </Seqdesc>
  2426.           <Seqdesc>
  2427.             <Seqdesc_pub>
  2428.               <Pubdesc>
  2429.                 <Pubdesc_pub>
  2430.                   <Pub-equiv>
  2431.                     <Pub>
  2432.                       <Pub_pmid>
  2433.                         <PubMedId>18554403</PubMedId>
  2434.                       </Pub_pmid>
  2435.                     </Pub>
  2436.                     <Pub>
  2437.                       <Pub_article>
  2438.                         <Cit-art>
  2439.                           <Cit-art_title>
  2440.                             <Title>
  2441.                               <Title_E>
  2442.                                 <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
  2443.                               </Title_E>
  2444.                             </Title>
  2445.                           </Cit-art_title>
  2446.                           <Cit-art_authors>
  2447.                             <Auth-list>
  2448.                               <Auth-list_names>
  2449.                                 <Auth-list_names_std>
  2450.                                   <Author>
  2451.                                     <Author_name>
  2452.                                       <Person-id>
  2453.                                         <Person-id_name>
  2454.                                           <Name-std>
  2455.                                             <Name-std_last>Zhu</Name-std_last>
  2456.                                             <Name-std_initials>W.</Name-std_initials>
  2457.                                           </Name-std>
  2458.                                         </Person-id_name>
  2459.                                       </Person-id>
  2460.                                     </Author_name>
  2461.                                   </Author>
  2462.                                   <Author>
  2463.                                     <Author_name>
  2464.                                       <Person-id>
  2465.                                         <Person-id_name>
  2466.                                           <Name-std>
  2467.                                             <Name-std_last>Ouyang</Name-std_last>
  2468.                                             <Name-std_initials>S.</Name-std_initials>
  2469.                                           </Name-std>
  2470.                                         </Person-id_name>
  2471.                                       </Person-id>
  2472.                                     </Author_name>
  2473.                                   </Author>
  2474.                                   <Author>
  2475.                                     <Author_name>
  2476.                                       <Person-id>
  2477.                                         <Person-id_name>
  2478.                                           <Name-std>
  2479.                                             <Name-std_last>Iovene</Name-std_last>
  2480.                                             <Name-std_initials>M.</Name-std_initials>
  2481.                                           </Name-std>
  2482.                                         </Person-id_name>
  2483.                                       </Person-id>
  2484.                                     </Author_name>
  2485.                                   </Author>
  2486.                                   <Author>
  2487.                                     <Author_name>
  2488.                                       <Person-id>
  2489.                                         <Person-id_name>
  2490.                                           <Name-std>
  2491.                                             <Name-std_last>O&apos;Brien</Name-std_last>
  2492.                                             <Name-std_initials>K.</Name-std_initials>
  2493.                                           </Name-std>
  2494.                                         </Person-id_name>
  2495.                                       </Person-id>
  2496.                                     </Author_name>
  2497.                                   </Author>
  2498.                                   <Author>
  2499.                                     <Author_name>
  2500.                                       <Person-id>
  2501.                                         <Person-id_name>
  2502.                                           <Name-std>
  2503.                                             <Name-std_last>Vuong</Name-std_last>
  2504.                                             <Name-std_initials>H.</Name-std_initials>
  2505.                                           </Name-std>
  2506.                                         </Person-id_name>
  2507.                                       </Person-id>
  2508.                                     </Author_name>
  2509.                                   </Author>
  2510.                                   <Author>
  2511.                                     <Author_name>
  2512.                                       <Person-id>
  2513.                                         <Person-id_name>
  2514.                                           <Name-std>
  2515.                                             <Name-std_last>Jiang</Name-std_last>
  2516.                                             <Name-std_initials>J.</Name-std_initials>
  2517.                                           </Name-std>
  2518.                                         </Person-id_name>
  2519.                                       </Person-id>
  2520.                                     </Author_name>
  2521.                                   </Author>
  2522.                                   <Author>
  2523.                                     <Author_name>
  2524.                                       <Person-id>
  2525.                                         <Person-id_name>
  2526.                                           <Name-std>
  2527.                                             <Name-std_last>Buell</Name-std_last>
  2528.                                             <Name-std_initials>C.R.</Name-std_initials>
  2529.                                           </Name-std>
  2530.                                         </Person-id_name>
  2531.                                       </Person-id>
  2532.                                     </Author_name>
  2533.                                   </Author>
  2534.                                 </Auth-list_names_std>
  2535.                               </Auth-list_names>
  2536.                             </Auth-list>
  2537.                           </Cit-art_authors>
  2538.                           <Cit-art_from>
  2539.                             <Cit-art_from_journal>
  2540.                               <Cit-jour>
  2541.                                 <Cit-jour_title>
  2542.                                   <Title>
  2543.                                     <Title_E>
  2544.                                       <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
  2545.                                     </Title_E>
  2546.                                   </Title>
  2547.                                 </Cit-jour_title>
  2548.                                 <Cit-jour_imp>
  2549.                                   <Imprint>
  2550.                                     <Imprint_date>
  2551.                                       <Date>
  2552.                                         <Date_std>
  2553.                                           <Date-std>
  2554.                                             <Date-std_year>2008</Date-std_year>
  2555.                                           </Date-std>
  2556.                                         </Date_std>
  2557.                                       </Date>
  2558.                                     </Imprint_date>
  2559.                                     <Imprint_volume>9</Imprint_volume>
  2560.                                     <Imprint_issue>1</Imprint_issue>
  2561.                                     <Imprint_pages>286</Imprint_pages>
  2562.                                   </Imprint>
  2563.                                 </Cit-jour_imp>
  2564.                               </Cit-jour>
  2565.                             </Cit-art_from_journal>
  2566.                           </Cit-art_from>
  2567.                         </Cit-art>
  2568.                       </Pub_article>
  2569.                     </Pub>
  2570.                   </Pub-equiv>
  2571.                 </Pubdesc_pub>
  2572.               </Pubdesc>
  2573.             </Seqdesc_pub>
  2574.           </Seqdesc>
  2575.         </Seq-descr>
  2576.       </Bioseq_descr>
  2577.       <Bioseq_inst>
  2578.         <Seq-inst>
  2579.           <Seq-inst_repr value="raw"/>
  2580.           <Seq-inst_mol value="dna"/>
  2581.           <Seq-inst_length>742</Seq-inst_length>
  2582.           <Seq-inst_strand value="ds"/>
  2583.           <Seq-inst_seq-data>
  2584.             <Seq-data>
  2585.               <Seq-data_iupacna>
  2586.                 <IUPACna>ATACATGAGAGTAACATACCCCGGTGTTAAAGATGCAAGAGATGAGAGAATTTGAGAGAAAATAAGCCATAGGTCGTACAAGATGAATTTTATATTGACCCATCGTCTTAACTTAATAAATAGAGAATTTTAAAATCTAGACTCTTAAAAAATTTCTTGGCGCGGTGCGCCCATGCTACAGGCTACTAAAAAAATAGCCTAGCGTGGTGCGCCCATGCTACCAGGCACGCAGAGCAAACGGTCAATTTGACATCTCTCTAGTAAAATGCAGATAACTTTTTACTCAAGAGTTGGGTAGATGAGCGATCAGTGACATTGGAAGGAACAAATGTAGACCTTTAATTTGATAAGTCACGGGTCATCTAAATTTTACTACTCTAAGAGGCATGATCGGTTGAAGTTGACCCTTGTATGAACTCATGTGAAAATATAGCTGATAGAAATGCTTTGAACTTGGTTTGGTGTTTAAGGTTCCTTACGACCCTAAACCATATATGATATACTTACTATAGTTTGTAAAGGACCTTAACATATATGCACAACTTAGTACTATTCATCGGGTTCGGACCTATACACATACAGAGGATGATTTGAATCTTTGCTTAGAAGTTTTTGGACGTTACGTAGATTGTCCCACATTTTTTTGGGTACTCAAAGAATTGTGACAGAAAATGGAAAACACTTCAATTATTGGCCGAAAGCAAATGAAGAGTCCTTTGACATTTCTTGATGTTACACATGT</IUPACna>
  2587.               </Seq-data_iupacna>
  2588.             </Seq-data>
  2589.           </Seq-inst_seq-data>
  2590.         </Seq-inst>
  2591.       </Bioseq_inst>
  2592.     </Bioseq>
  2593.   </Seq-entry_seq>
  2594. </Seq-entry>
  2595.  
  2596. <Seq-entry>
  2597.   <Seq-entry_seq>
  2598.     <Bioseq>
  2599.       <Bioseq_id>
  2600.         <Seq-id>
  2601.           <Seq-id_general>
  2602.             <Dbtag>
  2603.               <Dbtag_db>dbGSS</Dbtag_db>
  2604.               <Dbtag_tag>
  2605.                 <Object-id>
  2606.                   <Object-id_id>20893440</Object-id_id>
  2607.                 </Object-id>
  2608.               </Dbtag_tag>
  2609.             </Dbtag>
  2610.           </Seq-id_general>
  2611.         </Seq-id>
  2612.         <Seq-id>
  2613.           <Seq-id_genbank>
  2614.             <Textseq-id>
  2615.               <Textseq-id_accession>ER870406</Textseq-id_accession>
  2616.               <Textseq-id_version>1</Textseq-id_version>
  2617.             </Textseq-id>
  2618.           </Seq-id_genbank>
  2619.         </Seq-id>
  2620.         <Seq-id>
  2621.           <Seq-id_gi>148466245</Seq-id_gi>
  2622.         </Seq-id>
  2623.       </Bioseq_id>
  2624.       <Bioseq_descr>
  2625.         <Seq-descr>
  2626.           <Seqdesc>
  2627.             <Seqdesc_molinfo>
  2628.               <MolInfo>
  2629.                 <MolInfo_biomol value="genomic">1</MolInfo_biomol>
  2630.                 <MolInfo_tech value="survey">4</MolInfo_tech>
  2631.               </MolInfo>
  2632.             </Seqdesc_molinfo>
  2633.           </Seqdesc>
  2634.           <Seqdesc>
  2635.             <Seqdesc_title>PPTGD37TR Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY176_G02.</Seqdesc_title>
  2636.           </Seqdesc>
  2637.           <Seqdesc>
  2638.             <Seqdesc_create-date>
  2639.               <Date>
  2640.                 <Date_std>
  2641.                   <Date-std>
  2642.                     <Date-std_year>2007</Date-std_year>
  2643.                     <Date-std_month>5</Date-std_month>
  2644.                     <Date-std_day>30</Date-std_day>
  2645.                   </Date-std>
  2646.                 </Date_std>
  2647.               </Date>
  2648.             </Seqdesc_create-date>
  2649.           </Seqdesc>
  2650.           <Seqdesc>
  2651.             <Seqdesc_update-date>
  2652.               <Date>
  2653.                 <Date_std>
  2654.                   <Date-std>
  2655.                     <Date-std_year>2008</Date-std_year>
  2656.                     <Date-std_month>6</Date-std_month>
  2657.                     <Date-std_day>18</Date-std_day>
  2658.                   </Date-std>
  2659.                 </Date_std>
  2660.               </Date>
  2661.             </Seqdesc_update-date>
  2662.           </Seqdesc>
  2663.           <Seqdesc>
  2664.             <Seqdesc_comment>Other_GSSs: PPTGD37TF~Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: CAGGAAACAGCTATGACC~Class: BAC ends</Seqdesc_comment>
  2665.           </Seqdesc>
  2666.           <Seqdesc>
  2667.             <Seqdesc_source>
  2668.               <BioSource>
  2669.                 <BioSource_org>
  2670.                   <Org-ref>
  2671.                     <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
  2672.                     <Org-ref_common>potato</Org-ref_common>
  2673.                     <Org-ref_db>
  2674.                       <Dbtag>
  2675.                         <Dbtag_db>taxon</Dbtag_db>
  2676.                         <Dbtag_tag>
  2677.                           <Object-id>
  2678.                             <Object-id_id>4113</Object-id_id>
  2679.                           </Object-id>
  2680.                         </Dbtag_tag>
  2681.                       </Dbtag>
  2682.                     </Org-ref_db>
  2683.                     <Org-ref_orgname>
  2684.                       <OrgName>
  2685.                         <OrgName_name>
  2686.                           <OrgName_name_binomial>
  2687.                             <BinomialOrgName>
  2688.                               <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
  2689.                               <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
  2690.                             </BinomialOrgName>
  2691.                           </OrgName_name_binomial>
  2692.                         </OrgName_name>
  2693.                         <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
  2694.                         <OrgName_gcode>1</OrgName_gcode>
  2695.                         <OrgName_mgcode>1</OrgName_mgcode>
  2696.                         <OrgName_div>PLN</OrgName_div>
  2697.                       </OrgName>
  2698.                     </Org-ref_orgname>
  2699.                   </Org-ref>
  2700.                 </BioSource_org>
  2701.                 <BioSource_subtype>
  2702.                   <SubSource>
  2703.                     <SubSource_subtype value="clone">3</SubSource_subtype>
  2704.                     <SubSource_name>RHPOTKEY176_G02</SubSource_name>
  2705.                   </SubSource>
  2706.                   <SubSource>
  2707.                     <SubSource_subtype value="clone-lib">11</SubSource_subtype>
  2708.                     <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
  2709.                   </SubSource>
  2710.                 </BioSource_subtype>
  2711.               </BioSource>
  2712.             </Seqdesc_source>
  2713.           </Seqdesc>
  2714.           <Seqdesc>
  2715.             <Seqdesc_pub>
  2716.               <Pubdesc>
  2717.                 <Pubdesc_pub>
  2718.                   <Pub-equiv>
  2719.                     <Pub>
  2720.                       <Pub_pmid>
  2721.                         <PubMedId>18554403</PubMedId>
  2722.                       </Pub_pmid>
  2723.                     </Pub>
  2724.                     <Pub>
  2725.                       <Pub_article>
  2726.                         <Cit-art>
  2727.                           <Cit-art_title>
  2728.                             <Title>
  2729.                               <Title_E>
  2730.                                 <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
  2731.                               </Title_E>
  2732.                             </Title>
  2733.                           </Cit-art_title>
  2734.                           <Cit-art_authors>
  2735.                             <Auth-list>
  2736.                               <Auth-list_names>
  2737.                                 <Auth-list_names_std>
  2738.                                   <Author>
  2739.                                     <Author_name>
  2740.                                       <Person-id>
  2741.                                         <Person-id_name>
  2742.                                           <Name-std>
  2743.                                             <Name-std_last>Zhu</Name-std_last>
  2744.                                             <Name-std_initials>W.</Name-std_initials>
  2745.                                           </Name-std>
  2746.                                         </Person-id_name>
  2747.                                       </Person-id>
  2748.                                     </Author_name>
  2749.                                   </Author>
  2750.                                   <Author>
  2751.                                     <Author_name>
  2752.                                       <Person-id>
  2753.                                         <Person-id_name>
  2754.                                           <Name-std>
  2755.                                             <Name-std_last>Ouyang</Name-std_last>
  2756.                                             <Name-std_initials>S.</Name-std_initials>
  2757.                                           </Name-std>
  2758.                                         </Person-id_name>
  2759.                                       </Person-id>
  2760.                                     </Author_name>
  2761.                                   </Author>
  2762.                                   <Author>
  2763.                                     <Author_name>
  2764.                                       <Person-id>
  2765.                                         <Person-id_name>
  2766.                                           <Name-std>
  2767.                                             <Name-std_last>Iovene</Name-std_last>
  2768.                                             <Name-std_initials>M.</Name-std_initials>
  2769.                                           </Name-std>
  2770.                                         </Person-id_name>
  2771.                                       </Person-id>
  2772.                                     </Author_name>
  2773.                                   </Author>
  2774.                                   <Author>
  2775.                                     <Author_name>
  2776.                                       <Person-id>
  2777.                                         <Person-id_name>
  2778.                                           <Name-std>
  2779.                                             <Name-std_last>O&apos;Brien</Name-std_last>
  2780.                                             <Name-std_initials>K.</Name-std_initials>
  2781.                                           </Name-std>
  2782.                                         </Person-id_name>
  2783.                                       </Person-id>
  2784.                                     </Author_name>
  2785.                                   </Author>
  2786.                                   <Author>
  2787.                                     <Author_name>
  2788.                                       <Person-id>
  2789.                                         <Person-id_name>
  2790.                                           <Name-std>
  2791.                                             <Name-std_last>Vuong</Name-std_last>
  2792.                                             <Name-std_initials>H.</Name-std_initials>
  2793.                                           </Name-std>
  2794.                                         </Person-id_name>
  2795.                                       </Person-id>
  2796.                                     </Author_name>
  2797.                                   </Author>
  2798.                                   <Author>
  2799.                                     <Author_name>
  2800.                                       <Person-id>
  2801.                                         <Person-id_name>
  2802.                                           <Name-std>
  2803.                                             <Name-std_last>Jiang</Name-std_last>
  2804.                                             <Name-std_initials>J.</Name-std_initials>
  2805.                                           </Name-std>
  2806.                                         </Person-id_name>
  2807.                                       </Person-id>
  2808.                                     </Author_name>
  2809.                                   </Author>
  2810.                                   <Author>
  2811.                                     <Author_name>
  2812.                                       <Person-id>
  2813.                                         <Person-id_name>
  2814.                                           <Name-std>
  2815.                                             <Name-std_last>Buell</Name-std_last>
  2816.                                             <Name-std_initials>C.R.</Name-std_initials>
  2817.                                           </Name-std>
  2818.                                         </Person-id_name>
  2819.                                       </Person-id>
  2820.                                     </Author_name>
  2821.                                   </Author>
  2822.                                 </Auth-list_names_std>
  2823.                               </Auth-list_names>
  2824.                             </Auth-list>
  2825.                           </Cit-art_authors>
  2826.                           <Cit-art_from>
  2827.                             <Cit-art_from_journal>
  2828.                               <Cit-jour>
  2829.                                 <Cit-jour_title>
  2830.                                   <Title>
  2831.                                     <Title_E>
  2832.                                       <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
  2833.                                     </Title_E>
  2834.                                   </Title>
  2835.                                 </Cit-jour_title>
  2836.                                 <Cit-jour_imp>
  2837.                                   <Imprint>
  2838.                                     <Imprint_date>
  2839.                                       <Date>
  2840.                                         <Date_std>
  2841.                                           <Date-std>
  2842.                                             <Date-std_year>2008</Date-std_year>
  2843.                                           </Date-std>
  2844.                                         </Date_std>
  2845.                                       </Date>
  2846.                                     </Imprint_date>
  2847.                                     <Imprint_volume>9</Imprint_volume>
  2848.                                     <Imprint_issue>1</Imprint_issue>
  2849.                                     <Imprint_pages>286</Imprint_pages>
  2850.                                   </Imprint>
  2851.                                 </Cit-jour_imp>
  2852.                               </Cit-jour>
  2853.                             </Cit-art_from_journal>
  2854.                           </Cit-art_from>
  2855.                         </Cit-art>
  2856.                       </Pub_article>
  2857.                     </Pub>
  2858.                   </Pub-equiv>
  2859.                 </Pubdesc_pub>
  2860.               </Pubdesc>
  2861.             </Seqdesc_pub>
  2862.           </Seqdesc>
  2863.         </Seq-descr>
  2864.       </Bioseq_descr>
  2865.       <Bioseq_inst>
  2866.         <Seq-inst>
  2867.           <Seq-inst_repr value="raw"/>
  2868.           <Seq-inst_mol value="dna"/>
  2869.           <Seq-inst_length>723</Seq-inst_length>
  2870.           <Seq-inst_strand value="ds"/>
  2871.           <Seq-inst_seq-data>
  2872.             <Seq-data>
  2873.               <Seq-data_iupacna>
  2874.                 <IUPACna>TTATGTAATTATCCGCTCAATATAAGATTTAATACTTCTCATTTTATCTTAAAGATCATAAATTTTAAAAGTAAAAAACTTTTGTTTTAAACTCATGCCTAATTAAAATGCATCACATAAATTAGGATGGAAGAAATCATTTTGAATTTGTTCATTAAAGAAAACGTAGAATTTTAAAACGGAAAAAGACCTAAAATACCCTCGAAGTATTGGAAATTGTACAAAACTATCCTCCATCCATCTATTGGCTCCAAAATGCCCTTGTCATCCACCTTTGGGTCCAAAATTGACAACTTTTTTAACGGTTTTAAATTTAAACTATTTAATTATTTTTTAAATACGTGGCGCTCAACTATTGGTTATAATTTAATTAATTAATATAATTTATAAACCCACAATATTGTTACTCCCCTCCTCTATTTTTCTTTTCTCGACCTACAATTTTATTGTCTTAAAAAAAAAGGTCATGGCGTTGAAAATTTGAAAAACATGTCTTAGATGCCTAAATAGGAGCTGAGAAAATAAGGCATAAAACGCATTCGGCGTAGTGCGATTTATGTATAAATTTCAGTCTCTTCTTATTTATTGTTGAAATTACATTATTACCCCTTCCGTTTAAGTTAAAATTTAACTTTATCGGTGAATTTTCGATTCACCACATTGTTAATCCCCTCCTCTATTTTTCTTTTCTCGACCCACAATTTTATTTTTTGTCTTTTTAAA</IUPACna>
  2875.               </Seq-data_iupacna>
  2876.             </Seq-data>
  2877.           </Seq-inst_seq-data>
  2878.         </Seq-inst>
  2879.       </Bioseq_inst>
  2880.     </Bioseq>
  2881.   </Seq-entry_seq>
  2882. </Seq-entry>
  2883.  
  2884. <Seq-entry>
  2885.   <Seq-entry_seq>
  2886.     <Bioseq>
  2887.       <Bioseq_id>
  2888.         <Seq-id>
  2889.           <Seq-id_general>
  2890.             <Dbtag>
  2891.               <Dbtag_db>dbGSS</Dbtag_db>
  2892.               <Dbtag_tag>
  2893.                 <Object-id>
  2894.                   <Object-id_id>20893439</Object-id_id>
  2895.                 </Object-id>
  2896.               </Dbtag_tag>
  2897.             </Dbtag>
  2898.           </Seq-id_general>
  2899.         </Seq-id>
  2900.         <Seq-id>
  2901.           <Seq-id_genbank>
  2902.             <Textseq-id>
  2903.               <Textseq-id_accession>ER870405</Textseq-id_accession>
  2904.               <Textseq-id_version>1</Textseq-id_version>
  2905.             </Textseq-id>
  2906.           </Seq-id_genbank>
  2907.         </Seq-id>
  2908.         <Seq-id>
  2909.           <Seq-id_gi>148466244</Seq-id_gi>
  2910.         </Seq-id>
  2911.       </Bioseq_id>
  2912.       <Bioseq_descr>
  2913.         <Seq-descr>
  2914.           <Seqdesc>
  2915.             <Seqdesc_molinfo>
  2916.               <MolInfo>
  2917.                 <MolInfo_biomol value="genomic">1</MolInfo_biomol>
  2918.                 <MolInfo_tech value="survey">4</MolInfo_tech>
  2919.               </MolInfo>
  2920.             </Seqdesc_molinfo>
  2921.           </Seqdesc>
  2922.           <Seqdesc>
  2923.             <Seqdesc_title>PPTI520TF Solanum tuberosum RHPOTKEY BAC ends Solanum tuberosum genomic clone RHPOTKEY192_C16.</Seqdesc_title>
  2924.           </Seqdesc>
  2925.           <Seqdesc>
  2926.             <Seqdesc_create-date>
  2927.               <Date>
  2928.                 <Date_std>
  2929.                   <Date-std>
  2930.                     <Date-std_year>2007</Date-std_year>
  2931.                     <Date-std_month>5</Date-std_month>
  2932.                     <Date-std_day>30</Date-std_day>
  2933.                   </Date-std>
  2934.                 </Date_std>
  2935.               </Date>
  2936.             </Seqdesc_create-date>
  2937.           </Seqdesc>
  2938.           <Seqdesc>
  2939.             <Seqdesc_update-date>
  2940.               <Date>
  2941.                 <Date_std>
  2942.                   <Date-std>
  2943.                     <Date-std_year>2008</Date-std_year>
  2944.                     <Date-std_month>6</Date-std_month>
  2945.                     <Date-std_day>18</Date-std_day>
  2946.                   </Date-std>
  2947.                 </Date_std>
  2948.               </Date>
  2949.             </Seqdesc_update-date>
  2950.           </Seqdesc>
  2951.           <Seqdesc>
  2952.             <Seqdesc_comment>Contact: C. Robin Buell~The Institute for Genomic Research (TIGR; www.tigr.org)~9712 Medical Center Drive, Rockville, MD 20850, USA~Seq primer: TGTAAAACGACGGCCAGT~Class: BAC ends</Seqdesc_comment>
  2953.           </Seqdesc>
  2954.           <Seqdesc>
  2955.             <Seqdesc_source>
  2956.               <BioSource>
  2957.                 <BioSource_org>
  2958.                   <Org-ref>
  2959.                     <Org-ref_taxname>Solanum tuberosum</Org-ref_taxname>
  2960.                     <Org-ref_common>potato</Org-ref_common>
  2961.                     <Org-ref_db>
  2962.                       <Dbtag>
  2963.                         <Dbtag_db>taxon</Dbtag_db>
  2964.                         <Dbtag_tag>
  2965.                           <Object-id>
  2966.                             <Object-id_id>4113</Object-id_id>
  2967.                           </Object-id>
  2968.                         </Dbtag_tag>
  2969.                       </Dbtag>
  2970.                     </Org-ref_db>
  2971.                     <Org-ref_orgname>
  2972.                       <OrgName>
  2973.                         <OrgName_name>
  2974.                           <OrgName_name_binomial>
  2975.                             <BinomialOrgName>
  2976.                               <BinomialOrgName_genus>Solanum</BinomialOrgName_genus>
  2977.                               <BinomialOrgName_species>tuberosum</BinomialOrgName_species>
  2978.                             </BinomialOrgName>
  2979.                           </OrgName_name_binomial>
  2980.                         </OrgName_name>
  2981.                         <OrgName_lineage>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum</OrgName_lineage>
  2982.                         <OrgName_gcode>1</OrgName_gcode>
  2983.                         <OrgName_mgcode>1</OrgName_mgcode>
  2984.                         <OrgName_div>PLN</OrgName_div>
  2985.                       </OrgName>
  2986.                     </Org-ref_orgname>
  2987.                   </Org-ref>
  2988.                 </BioSource_org>
  2989.                 <BioSource_subtype>
  2990.                   <SubSource>
  2991.                     <SubSource_subtype value="clone">3</SubSource_subtype>
  2992.                     <SubSource_name>RHPOTKEY192_C16</SubSource_name>
  2993.                   </SubSource>
  2994.                   <SubSource>
  2995.                     <SubSource_subtype value="clone-lib">11</SubSource_subtype>
  2996.                     <SubSource_name>Solanum tuberosum RHPOTKEY BAC ends</SubSource_name>
  2997.                   </SubSource>
  2998.                 </BioSource_subtype>
  2999.               </BioSource>
  3000.             </Seqdesc_source>
  3001.           </Seqdesc>
  3002.           <Seqdesc>
  3003.             <Seqdesc_pub>
  3004.               <Pubdesc>
  3005.                 <Pubdesc_pub>
  3006.                   <Pub-equiv>
  3007.                     <Pub>
  3008.                       <Pub_pmid>
  3009.                         <PubMedId>18554403</PubMedId>
  3010.                       </Pub_pmid>
  3011.                     </Pub>
  3012.                     <Pub>
  3013.                       <Pub_article>
  3014.                         <Cit-art>
  3015.                           <Cit-art_title>
  3016.                             <Title>
  3017.                               <Title_E>
  3018.                                 <Title_E_iso-jta>Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition</Title_E_iso-jta>
  3019.                               </Title_E>
  3020.                             </Title>
  3021.                           </Cit-art_title>
  3022.                           <Cit-art_authors>
  3023.                             <Auth-list>
  3024.                               <Auth-list_names>
  3025.                                 <Auth-list_names_std>
  3026.                                   <Author>
  3027.                                     <Author_name>
  3028.                                       <Person-id>
  3029.                                         <Person-id_name>
  3030.                                           <Name-std>
  3031.                                             <Name-std_last>Zhu</Name-std_last>
  3032.                                             <Name-std_initials>W.</Name-std_initials>
  3033.                                           </Name-std>
  3034.                                         </Person-id_name>
  3035.                                       </Person-id>
  3036.                                     </Author_name>
  3037.                                   </Author>
  3038.                                   <Author>
  3039.                                     <Author_name>
  3040.                                       <Person-id>
  3041.                                         <Person-id_name>
  3042.                                           <Name-std>
  3043.                                             <Name-std_last>Ouyang</Name-std_last>
  3044.                                             <Name-std_initials>S.</Name-std_initials>
  3045.                                           </Name-std>
  3046.                                         </Person-id_name>
  3047.                                       </Person-id>
  3048.                                     </Author_name>
  3049.                                   </Author>
  3050.                                   <Author>
  3051.                                     <Author_name>
  3052.                                       <Person-id>
  3053.                                         <Person-id_name>
  3054.                                           <Name-std>
  3055.                                             <Name-std_last>Iovene</Name-std_last>
  3056.                                             <Name-std_initials>M.</Name-std_initials>
  3057.                                           </Name-std>
  3058.                                         </Person-id_name>
  3059.                                       </Person-id>
  3060.                                     </Author_name>
  3061.                                   </Author>
  3062.                                   <Author>
  3063.                                     <Author_name>
  3064.                                       <Person-id>
  3065.                                         <Person-id_name>
  3066.                                           <Name-std>
  3067.                                             <Name-std_last>O&apos;Brien</Name-std_last>
  3068.                                             <Name-std_initials>K.</Name-std_initials>
  3069.                                           </Name-std>
  3070.                                         </Person-id_name>
  3071.                                       </Person-id>
  3072.                                     </Author_name>
  3073.                                   </Author>
  3074.                                   <Author>
  3075.                                     <Author_name>
  3076.                                       <Person-id>
  3077.                                         <Person-id_name>
  3078.                                           <Name-std>
  3079.                                             <Name-std_last>Vuong</Name-std_last>
  3080.                                             <Name-std_initials>H.</Name-std_initials>
  3081.                                           </Name-std>
  3082.                                         </Person-id_name>
  3083.                                       </Person-id>
  3084.                                     </Author_name>
  3085.                                   </Author>
  3086.                                   <Author>
  3087.                                     <Author_name>
  3088.                                       <Person-id>
  3089.                                         <Person-id_name>
  3090.                                           <Name-std>
  3091.                                             <Name-std_last>Jiang</Name-std_last>
  3092.                                             <Name-std_initials>J.</Name-std_initials>
  3093.                                           </Name-std>
  3094.                                         </Person-id_name>
  3095.                                       </Person-id>
  3096.                                     </Author_name>
  3097.                                   </Author>
  3098.                                   <Author>
  3099.                                     <Author_name>
  3100.                                       <Person-id>
  3101.                                         <Person-id_name>
  3102.                                           <Name-std>
  3103.                                             <Name-std_last>Buell</Name-std_last>
  3104.                                             <Name-std_initials>C.R.</Name-std_initials>
  3105.                                           </Name-std>
  3106.                                         </Person-id_name>
  3107.                                       </Person-id>
  3108.                                     </Author_name>
  3109.                                   </Author>
  3110.                                 </Auth-list_names_std>
  3111.                               </Auth-list_names>
  3112.                             </Auth-list>
  3113.                           </Cit-art_authors>
  3114.                           <Cit-art_from>
  3115.                             <Cit-art_from_journal>
  3116.                               <Cit-jour>
  3117.                                 <Cit-jour_title>
  3118.                                   <Title>
  3119.                                     <Title_E>
  3120.                                       <Title_E_iso-jta>BMC Genomics</Title_E_iso-jta>
  3121.                                     </Title_E>
  3122.                                   </Title>
  3123.                                 </Cit-jour_title>
  3124.                                 <Cit-jour_imp>
  3125.                                   <Imprint>
  3126.                                     <Imprint_date>
  3127.                                       <Date>
  3128.                                         <Date_std>
  3129.                                           <Date-std>
  3130.                                             <Date-std_year>2008</Date-std_year>
  3131.                                           </Date-std>
  3132.                                         </Date_std>
  3133.                                       </Date>
  3134.                                     </Imprint_date>
  3135.                                     <Imprint_volume>9</Imprint_volume>
  3136.                                     <Imprint_issue>1</Imprint_issue>
  3137.                                     <Imprint_pages>286</Imprint_pages>
  3138.                                   </Imprint>
  3139.                                 </Cit-jour_imp>
  3140.                               </Cit-jour>
  3141.                             </Cit-art_from_journal>
  3142.                           </Cit-art_from>
  3143.                         </Cit-art>
  3144.                       </Pub_article>
  3145.                     </Pub>
  3146.                   </Pub-equiv>
  3147.                 </Pubdesc_pub>
  3148.               </Pubdesc>
  3149.             </Seqdesc_pub>
  3150.           </Seqdesc>
  3151.         </Seq-descr>
  3152.       </Bioseq_descr>
  3153.       <Bioseq_inst>
  3154.         <Seq-inst>
  3155.           <Seq-inst_repr value="raw"/>
  3156.           <Seq-inst_mol value="dna"/>
  3157.           <Seq-inst_length>479</Seq-inst_length>
  3158.           <Seq-inst_strand value="ds"/>
  3159.           <Seq-inst_seq-data>
  3160.             <Seq-data>
  3161.               <Seq-data_iupacna>
  3162.                 <IUPACna>ATATTTTTTAAAAAAAGATAATTTAATAATAAAGATAATGACTTTTCTTGAAAAATAAAAAATAAATAAAATGATTTTCAAAAAAATAAAAATTTCGGAAGTTATGTTTCAGTCCGTCATCCAACACACTCTATCCCACCCTCACACCCACACCTTTCATATTATTTGCATATATAATTTTATGTAAATATTTTTTACCTATGTACTAAATACTAATAACTAAACCTTAAAATAAATCATTTATTTCTCATCATATCAAACATACCATTAGTTTATATTTCCTTTCATCAGAATTGGGGGATCTTAGTTTGTACACTTTCCAAATCACGTAATTAATTATAGACGATGACATTTCACCATTATTTTAAAGAGTTAATACCTTAAAAAATGGGGAAAGTACACAAATTACTATTCATAAAATTAAATTAATTATCCTGTTTCATCCTTCTTTTTTCAAGCATGAATCAGTATGGCATCAG</IUPACna>
  3163.               </Seq-data_iupacna>
  3164.             </Seq-data>
  3165.           </Seq-inst_seq-data>
  3166.         </Seq-inst>
  3167.       </Bioseq_inst>
  3168.     </Bioseq>
  3169.   </Seq-entry_seq>
  3170. </Seq-entry>
  3171.  
  3172. </Bioseq-set_seq-set>
  3173. </Bioseq-set>
clone this paste RAW Paste Data