API tools faq
paste
Advertisement
Guest User

Untitled

a guest
Feb 13th, 2014
41
0
Never
Add comment
Not a member of Pastebin yet? Sign Up, it unlocks many cool features!
text 56.70 KB | None | 0 0
raw download clone embed print report
  1. [16:54:37] <mat747> i still have lab to do too, had been waiting for results
  2. [16:54:40] <jnicol> I'm going on a trip till next Wednesday, so I should do some labs now :)
  3. [16:54:56] <Eli-Fisker> :)
  4. [16:55:02] <jnicol> I asked Nando if he could take over for next weeks class
  5. [16:55:03] <mat747> eli - hehe
  6. [16:55:11] <Eli-Fisker> Mat :)
  7. [16:55:25] <Eli-Fisker> That would be cool too
  8. [16:55:29] <jnicol> Curious to see what he comes up with
  9. [16:55:48] <Eli-Fisker> hehe, yep. Molecules break apart around him
  10. [16:56:12] <Eli-Fisker> I mean, he always digs out weird stuff in Chimera and other tools
  11. [16:56:39] <firedrake969> Hi
  12. [16:57:05] <Eli-Fisker> hi Fire
  13. [16:57:39] <jnicol> hi fire
  14. [16:57:43] <mat747> Hi Fire
  15. [16:58:23] <firedrake969> anyone think they can pinpoint a computer issue I just had :L
  16. [16:58:49] <firedrake969> Someone used my computer, and they closed the lid. I think the computer restarted or something, because when I opened it back up, it was a black screen.
  17. [16:58:53] <firedrake969> It was on, though.
  18. [16:59:01] <firedrake969> I restarted it, and it said that Windows failed to start.
  19. [16:59:09] <firedrake969> I just continued with booting.
  20. [16:59:33] <firedrake969> And now, it says Windows successfully installed updates.
  21. [16:59:40] <firedrake969> I think the update broke my computer ;_;
  22. [16:59:56] <jnicol> windows update broke my computer yesterday :(
  23. [17:00:30] <jnicol> Hi everyone, Welcome to EteRNA Class Time!
  24. [17:00:36] <firedrake969> I postponed my update as long as I could.
  25. [17:00:42] <machinelves> yay! thank you jnicol!
  26. [17:00:45] <Eli-Fisker> Thx John!
  27. [17:00:45] <jnicol> If you missed the first class last week, don't worry, it is not required to be able to follow along now.
  28. [17:00:47] <firedrake969> So technically I should've updated around a week ago.
  29. [17:00:48] <firedrake969> Sweet.
  30. [17:01:04] <jnicol> In this class, I would like to continue with the objective of generating an Energy Chart.
  31. [17:01:16] <jnicol> We are focusing on generating the tetraloop energies, but we would like this code to be useful for generating energies of internal loops also.
  32. [17:01:32] <jnicol> Lets start by opening the scripting interface, http://eterna.cmu.edu/web/script/create/
  33. [17:01:49] <jnicol> and copy the following code into it:
  34. [17:01:50] <jnicol> var nextbase = getNextBase("A");
  35. [17:01:51] <jnicol> outln(nextbase);
  36. [17:01:51] <jnicol> function getNextBase(b) {
  37. [17:01:51] <jnicol> if (b == "A") return "U";
  38. [17:01:51] <jnicol> if (b == "U") return "G";
  39. [17:01:51] <jnicol> if (b == "G") return "C";
  40. [17:01:51] <jnicol> return "A";
  41. [17:01:52] <jnicol> }
  42. [17:01:52] <jnicol> return true;
  43. [17:02:06] <firedrake969> jnicol, how do you do that type of chat?
  44. [17:02:20] <firedrake969> (i.e. outside of the space between your name and the timestamp)
  45. [17:02:22] <jnicol> I copy into mIrc
  46. [17:02:27] <firedrake969> What?
  47. [17:02:39] <jnicol> irc chat program, mIRC
  48. [17:02:53] <jnicol> We see that the function getNextBase will return a U if we pass in an A
  49. [17:03:07] <jnicol> return a G when a U is passed in, return a C when a G is passed, return an A when a C is passed in
  50. [17:03:31] <firedrake969> So mIRC can connect to here?
  51. [17:03:31] <jnicol> Did everyone run the program?
  52. [17:03:40] <firedrake969> yeah
  53. [17:03:42] <hoglahoo> I ran it
  54. [17:03:47] <jnicol> yup, hog and nando use mirc also
  55. [17:03:47] <machinelves> yes
  56. [17:03:51] <Eli-Fisker> yes
  57. [17:03:56] <jnicol> so using 1 line to call a function is preferred over writing the 4 lines everywhere we want to get the next base.
  58. [17:04:01] <mat747> yes
  59. [17:04:13] <jnicol> This function will help us to get every combination of the tetraloop unpaired bases.
  60. [17:04:24] <hoglahoo> in the last script, we did run 4 lines didn't we
  61. [17:04:48] <jnicol> yes, I didnt want to try functions in the previous class
  62. [17:05:05] <jnicol> bringing everyone along slowly :)
  63. [17:05:14] <hoglahoo> yes please :)
  64. [17:05:18] <machinelves> *salutes the captain*
  65. [17:05:23] <firedrake969> Can we go over each line again, like last week?
  66. [17:05:35] <jnicol> Hope you still feel that way after this class :)
  67. [17:05:39] <jnicol> Lets introduce another function, getNextSequence, which uses getNextBase, and will generate the sequences we want to find the energies of.
  68. [17:05:43] <hoglahoo> if I fall behind I will cheat off machinelves
  69. [17:05:49] <firedrake969> lol
  70. [17:06:03] <Eli-Fisker> ;)
  71. [17:06:10] <jnicol> delete all previous code and copy the following lines into the scripting window:
  72. [17:06:13] <jnicol> locks = "xxxxxxoxxx";
  73. [17:06:13] <jnicol> sequence = "GCGAAAACGC";
  74. [17:06:13] <jnicol> outln(sequence);
  75. [17:06:13] <jnicol> sequence = getNextSequence(sequence, locks);
  76. [17:06:13] <jnicol> outln(sequence);
  77. [17:06:13] <jnicol> sequence = getNextSequence(sequence, locks);
  78. [17:06:13] <jnicol> outln(sequence);
  79. [17:06:13] <jnicol> sequence = getNextSequence(sequence, locks);
  80. [17:06:13] <jnicol> outln(sequence);
  81. [17:06:14] <jnicol> sequence = getNextSequence(sequence, locks);
  82. [17:06:15] <jnicol> outln(sequence);
  83. [17:06:16] <jnicol> function getNextSequence(sq, lk) {
  84. [17:06:16] <jnicol> i = lk.length;
  85. [17:06:17] <jnicol> while (--i > 0) {
  86. [17:06:18] <jnicol> if (lk.substr(i,1) == "o") {
  87. [17:06:18] <jnicol> base = sq.substr(i,1);
  88. [17:06:19] <jnicol> sq = sq.substr(0,i) + getNextBase(base)
  89. [17:06:20] <jnicol> + sq.substr(i+1,sq.length-i);
  90. [17:06:21] <jnicol> if (base != "C") { return sq; }
  91. [17:06:24] <jnicol> }
  92. [17:06:24] <jnicol> }
  93. [17:06:25] <jnicol> return "done";
  94. [17:06:26] <jnicol> }
  95. [17:06:26] <jnicol> function getNextBase(b) {
  96. [17:06:29] <jnicol> if (b == "A") return "U";
  97. [17:06:29] <jnicol> if (b == "U") return "G";
  98. [17:06:29] <jnicol> if (b == "G") return "C";
  99. [17:06:31] <jnicol> return "A";
  100. [17:06:31] <jnicol> }
  101. [17:06:33] <jnicol> return true;
  102. [17:06:47] <jnicol> THat took a while :)
  103. [17:06:52] <firedrake969> Ok, please walk through code? :3
  104. [17:06:59] <jnicol> Now this may look complex, but stay with me and I promise we can get through this :)
  105. [17:07:02] <firedrake969> Oh, sweet, I get it.
  106. [17:07:14] <hoglahoo> can someone post the link to the big chat window please
  107. [17:07:15] <jnicol> First, it is best to understand what this code is doing, so click Evaluate and take a look at the result.
  108. [17:07:26] <jnicol> http://eterna.cmu.edu/web/chat/
  109. [17:07:40] <hoglahoo> ty
  110. [17:07:53] <jnicol> were you able to grab the code?
  111. [17:07:54] <hoglahoo> meh.
  112. [17:07:58] <firedrake969> What does locks do?
  113. [17:08:06] <jnicol> Notice that every time getNextSequence is called, base #7 is 'incremented' to the next valid base.
  114. [17:08:20] <jnicol> The while loop is looking at every character in 'locks' (lines 15 and 16), starting at the last character of the string and moving toward the first character.
  115. [17:08:49] <jnicol> This is because I want to display the changing sequence as
  116. [17:08:51] <jnicol> AAAA
  117. [17:08:52] <jnicol> AAAU
  118. [17:08:52] <jnicol> AAAG
  119. [17:08:52] <jnicol> AAAC
  120. [17:08:52] <jnicol> AAUA
  121. [17:08:52] <jnicol> ...
  122. [17:09:37] <jnicol> Locks is like the structure, but it identifies the bases that we want to change
  123. [17:09:54] <jnicol> so we see base 7 is unlocked
  124. [17:10:04] <firedrake969> Ok, thanks
  125. [17:10:08] <firedrake969> And they can be any characters, right?
  126. [17:10:21] <Eli-Fisker> yes
  127. [17:10:22] <jnicol> which means we keep all other bases as is and only change base 7
  128. [17:10:24] <firedrake969> Ok
  129. [17:10:47] <Eli-Fisker> http://prntscr.com/2s8r5t
  130. [17:10:55] <jnicol> well, the gatNextBase, assumes A is the first base being used
  131. [17:11:10] <jnicol> thanks eli :)
  132. [17:11:15] <Eli-Fisker> np :)
  133. [17:11:23] <steven123505> hai
  134. [17:11:35] <jnicol> hai steven
  135. [17:11:35] <machinelves> hey! welcome to class! :)
  136. [17:11:36] <Eli-Fisker> hi Steven. John is giving a script lecture
  137. [17:11:46] <steven123505> hi john :D
  138. [17:11:49] <jnicol> When 'locks' has an 'o', we want to change that base (lines 16 and 17).
  139. [17:12:04] <jnicol> A new sequence using that changed base is saved (lines 18 and 19).
  140. [17:12:06] <Eli-Fisker> o= open?
  141. [17:12:25] <firedrake969> HI steven
  142. 03[17:12:25] * hoglahoo sets mode: +o Brourd
  143. [17:12:38] <firedrake969> What does the "sq.substr()" do?
  144. [17:12:47] <jnicol> yes, that is actually the same way eterna uses it when we lock bases in a puzzle
  145. [17:12:59] <jewfrosamurai42> hey guys, i wish i was adenine so i could be with u tomorrow
  146. [17:13:00] <Eli-Fisker> cool, John
  147. [17:13:04] <machinelves> ahh cool
  148. [17:13:30] <jnicol> substr() is taking 1 character at base 7
  149. [17:14:13] <firedrake969> Base 7 of the sq?
  150. [17:14:16] <jnicol> whenever you have a question about what the code is doing
  151. [17:14:31] <jnicol> you can put in an outln statement to see
  152. [17:14:43] <jnicol> like outln(sq.substr(i,1));
  153. [17:14:53] <jnicol> right after that line
  154. [17:14:57] <jnicol> in the code
  155. [17:15:12] <Eli-Fisker> That is handy
  156. [17:15:20] <jnicol> sq is a shortened name for sequence
  157. [17:15:49] <firedrake969> Yeah
  158. [17:15:59] <firedrake969> Ok, what I meant is the [obj].substr();
  159. [17:16:01] <jnicol> I unlocked 1 base to make the output result easy to see for now
  160. [17:16:03] <firedrake969> It takes it from the [obj] part.
  161. [17:16:18] <jnicol> correct fire
  162. [17:16:46] <jnicol> eventually we will unlock 4 bases to check all tetraloop combinations
  163. [17:17:00] <firedrake969> Ok, thanks, jnicol
  164. [17:17:08] <machinelves> sooper cool!
  165. [17:17:56] <jnicol> do my line numbers match up? I think I had a blank line in my original code
  166. [17:18:20] <jnicol> but when i copied it I doont see any blank lines
  167. [17:18:27] <firedrake969> Line numbers?
  168. [17:18:28] <machinelves> i did not get a blank line
  169. [17:19:04] <Eli-Fisker> http://prntscr.com/2s8u1i
  170. [17:19:08] <Eli-Fisker> This is what I got
  171. [17:19:12] <jnicol> is lines 16 and 17
  172. [17:19:15] <jnicol> while (--i > 0) {
  173. [17:19:16] <jnicol> if (lk.substr(i,1) == "o") {
  174. [17:19:31] <hoglahoo> mine agrees with Eli
  175. [17:19:33] <Eli-Fisker> no
  176. [17:19:38] <machinelves> 14 & 15 for me
  177. [17:19:48] <Eli-Fisker> Same as Machine
  178. [17:19:52] <jnicol> so sorry, I may be off a line or two when I reference line numbers'
  179. [17:19:57] <firedrake969> That's 13 and 14 for me
  180. [17:20:14] <firedrake969> but I'm editting the code right now to test somethign
  181. [17:20:19] <Eli-Fisker> np
  182. [17:20:20] <firedrake969> something*
  183. [17:20:26] <jnicol> well hopefullyh it is not too confusing :(
  184. [17:20:39] <firedrake969> jnicol
  185. [17:20:49] <firedrake969> Question.... why isn't this bit of code working?
  186. [17:20:52] <firedrake969> i = 0;while (i &lt; 4){ sequence = getNextSequence(sequence, locks); outln(sequence); i++}
  187. [17:21:03] <firedrake969> Hopefully it's not too badly messed up
  188. [17:21:24] <machinelves> fyi eterna plugin just crashed for me so i lost transcript. someone recording may want to backup now
  189. [17:21:36] <jnicol> try it on separate lines
  190. [17:21:38] <Eli-Fisker> Thx for the warning machine
  191. [17:21:42] <firedrake969> Ok
  192. [17:21:45] <machinelves> np :)
  193. [17:21:53] <firedrake969> I'm getting the transcript
  194. [17:21:56] <firedrake969> but via /web/chat
  195. [17:22:02] <firedrake969> i = 0;
  196. [17:22:06] <firedrake969> while (i &lt; 4){
  197. [17:22:09] <firedrake969> sequence = getNextSequence(sequence, locks);
  198. [17:22:10] <machinelves> ahh may i please have code repost
  199. [17:22:14] <firedrake969> outln(sequence);
  200. [17:22:20] <firedrake969> i++
  201. [17:22:24] <firedrake969> }
  202. [17:22:29] <firedrake969> @jnicol that's what i have
  203. [17:22:38] <jnicol> if you add a blank line before each function, our line numbers should match
  204. [17:22:46] <hoglahoo> doesn't i++ need a ;
  205. [17:23:01] <jnicol> yes it does hog, good eye
  206. [17:23:11] <DARKvLIGHT> you guys talking C++
  207. [17:23:17] <jnicol> javascript
  208. [17:23:24] <firedrake969> oh yeah thanks hog
  209. [17:23:38] <firedrake969> Still doesn't work?
  210. [17:24:15] <jnicol> A new sequence using that changed base is saved (lines 18 and 19).
  211. [17:24:16] <hoglahoo> machinelves do you still need the code
  212. 03[17:24:20] * Looking up machinelves__25772904525315 user info...
  213. [17:24:22] <machinelves> yes please!
  214. 03[17:24:24] * Looking up machinelves__25774297055846 user info...
  215. [17:24:37] <machinelves> thank you! & sorry :)
  216. [17:24:38] <hoglahoo> I hope that works...
  217. [17:24:45] <jnicol> i got it hog
  218. [17:24:47] <hoglahoo> oh ok
  219. [17:24:50] <jnicol> locks = "xxxxxxoxxx";
  220. [17:24:50] <jnicol> sequence = "GCGAAAACGC";
  221. [17:24:50] <jnicol> outln(sequence);
  222. [17:24:50] <jnicol> sequence = getNextSequence(sequence, locks);
  223. [17:24:50] <jnicol> outln(sequence);
  224. [17:24:50] <jnicol> sequence = getNextSequence(sequence, locks);
  225. [17:24:50] <jnicol> outln(sequence);
  226. [17:24:50] <jnicol> sequence = getNextSequence(sequence, locks);
  227. [17:24:50] <jnicol> outln(sequence);
  228. [17:24:50] <jnicol> sequence = getNextSequence(sequence, locks);
  229. [17:24:51] <jnicol> outln(sequence);
  230. [17:24:51] <jnicol> function getNextSequence(sq, lk) {
  231. [17:24:52] <jnicol> i = lk.length;
  232. [17:24:55] <hoglahoo> now she got it twice
  233. [17:24:55] <jnicol> while (--i > 0) {
  234. [17:24:55] <jnicol> if (lk.substr(i,1) == "o") {
  235. [17:24:56] <jnicol> base = sq.substr(i,1);
  236. [17:24:57] <jnicol> sq = sq.substr(0,i) + getNextBase(base)
  237. [17:24:58] <jnicol> + sq.substr(i+1,sq.length-i);
  238. [17:24:59] <jnicol> if (base != "C") { return sq; }
  239. [17:24:59] <jnicol> }
  240. [17:25:00] <jnicol> }
  241. [17:25:03] <jnicol> return "done";
  242. [17:25:03] <jnicol> }
  243. [17:25:04] <jnicol> function getNextBase(b) {
  244. [17:25:05] <jnicol> if (b == "A") return "U";
  245. [17:25:05] <jnicol> if (b == "U") return "G";
  246. [17:25:07] <jnicol> if (b == "G") return "C";
  247. [17:25:07] <jnicol> return "A";
  248. [17:25:08] <jnicol> }
  249. [17:25:11] <jnicol> return true;
  250. [17:25:42] <jnicol> lets try again, I will post in pieces
  251. [17:25:56] <jnicol> aftfer each piece add a blank line
  252. [17:26:03] <jnicol> locks = "xxxxxxoxxx";
  253. [17:26:03] <jnicol> sequence = "GCGAAAACGC";
  254. [17:26:03] <jnicol> outln(sequence);
  255. [17:26:03] <jnicol> sequence = getNextSequence(sequence, locks);
  256. [17:26:03] <jnicol> outln(sequence);
  257. [17:26:04] <jnicol> sequence = getNextSequence(sequence, locks);
  258. [17:26:04] <jnicol> outln(sequence);
  259. [17:26:04] <jnicol> sequence = getNextSequence(sequence, locks);
  260. [17:26:04] <jnicol> outln(sequence);
  261. [17:26:04] <jnicol> sequence = getNextSequence(sequence, locks);
  262. [17:26:04] <machinelves> i got it
  263. [17:26:04] <jnicol> outln(sequence);
  264. [17:26:14] <machinelves> thanks!
  265. [17:26:29] <jnicol> function getNextSequence(sq, lk) {
  266. [17:26:29] <jnicol> i = lk.length;
  267. [17:26:29] <jnicol> while (--i > 0) {
  268. [17:26:29] <jnicol> if (lk.substr(i,1) == "o") {
  269. [17:26:29] <jnicol> base = sq.substr(i,1);
  270. [17:26:29] <jnicol> sq = sq.substr(0,i) + getNextBase(base)
  271. [17:26:29] <jnicol> + sq.substr(i+1,sq.length-i);
  272. [17:26:29] <jnicol> if (base != "C") { return sq; }
  273. [17:26:29] <jnicol> }
  274. [17:26:29] <jnicol> }
  275. [17:26:30] <jnicol> return "done";
  276. [17:26:30] <jnicol> }
  277. [17:26:41] <jnicol> function getNextBase(b) {
  278. [17:26:41] <jnicol> if (b == "A") return "U";
  279. [17:26:41] <jnicol> if (b == "U") return "G";
  280. [17:26:41] <jnicol> if (b == "G") return "C";
  281. [17:26:41] <jnicol> return "A";
  282. [17:26:41] <jnicol> }
  283. [17:27:03] <jnicol> I need to get better with that :)
  284. [17:27:05] <hoglahoo> is that 3 blank lines at 12, 25, and 32 if done correctly?
  285. [17:27:16] <jnicol> correct
  286. [17:27:31] <hoglahoo> might try a comment instead of a blank line for pasting here
  287. [17:27:42] <firedrake969> jnicol, what about my faulty while loop?
  288. [17:27:42] <hoglahoo> actually no... hmm
  289. [17:28:01] <jnicol> idk fire, we can look at it after this class
  290. [17:28:33] <jnicol> reposted last statement
  291. [17:28:35] <jnicol> A new sequence using that changed base is saved (lines 18 and 19).
  292. [17:28:39] <firedrake969> Ok
  293. [17:28:50] <jnicol> When that base is not a C, then we have found the next sequence and can return (line 20).
  294. [17:29:01] <jnicol> When that base is a C, then we want to change it back to an A, and check to see if there is a lower base number that needs to be changed, which is done by checking the next base in the while loop.
  295. [17:29:10] <jnicol> When all the bases to be changed are set to C, then we are finished with all the sequences and can return "done" (line 23)
  296. [17:29:47] <jnicol> do line numbers sync now?
  297. [17:29:55] <machinelves> yes
  298. [17:30:00] <jnicol> good
  299. [17:30:13] <firedrake969> Yup
  300. [17:30:34] <Eli-Fisker> Yes
  301. [17:30:36] <jnicol> I'm going to try hogs suggestion of adding a comment for blank lines
  302. [17:30:45] <hoglahoo> I don't think the chat will like / though
  303. [17:30:51] <hoglahoo> mirc reserves it for commands
  304. [17:31:15] <Eli-Fisker> What I got now, if anyone is in doubt
  305. [17:31:16] <Eli-Fisker> http://prntscr.com/2s8y3f
  306. [17:31:41] <jnicol> any questions on the previous code?
  307. [17:31:48] <jnicol> is it sasfe to move forward?
  308. [17:31:54] <firedrake969> Yeah
  309. [17:32:06] <machinelves> ready
  310. [17:32:25] <jnicol> Now lets use 2 unlocked bases and watch what happens as the sequence runs through all the possible combinations.
  311. [17:32:26] <firedrake969> wait, one thing
  312. [17:32:41] <firedrake969> How do you create a new variable?
  313. [17:32:41] <jnicol> ok fire
  314. [17:32:57] <TomoeUzumaki> aah is today the class?
  315. [17:33:02] <jnicol> you can just use it
  316. [17:33:12] <Eli-Fisker> Tomoe, yep
  317. [17:33:12] <machinelves> yes tomoe, hi!
  318. [17:33:14] <firedrake969> Use it?
  319. [17:33:16] <jnicol> or formally, you should prefix it with var
  320. [17:33:20] <TomoeUzumaki> oops
  321. [17:33:21] <firedrake969> I've tried something with j but it doesn't work
  322. [17:33:27] <TomoeUzumaki> well, I was studying for an exam
  323. [17:33:38] <firedrake969> nvm, it works :3
  324. [17:33:43] <jnicol> for instance just put "myEnergy = 0;"
  325. [17:33:50] <jnicol> good
  326. [17:34:14] <jnicol> delete all previous code and copy the following lines into the scripting window:
  327. [17:34:16] <firedrake969> :D
  328. [17:34:17] <jnicol> locks = "xxxxxooxxx";
  329. [17:34:17] <jnicol> sequence = "GCGAAAACGC";
  330. [17:34:17] <jnicol> while (sequence != "done") {
  331. [17:34:17] <jnicol> outln(sequence);
  332. [17:34:17] <jnicol> sequence = getNextSequence(sequence, locks);
  333. [17:34:17] <jnicol> }
  334. [17:34:18] <jnicol> function getNextSequence(sq, lk) {
  335. [17:34:18] <jnicol> i = lk.length;
  336. [17:34:18] <jnicol> while (--i > 0) {
  337. [17:34:18] <jnicol> if (lk.substr(i,1) == "o") {
  338. [17:34:19] <jnicol> base = sq.substr(i,1);
  339. [17:34:20] <jnicol> sq = sq.substr(0,i) + getNextBase(base)
  340. [17:34:20] <jnicol> + sq.substr(i+1,sq.length-i);
  341. [17:34:21] <jnicol> if (base != "C") { return sq; }
  342. [17:34:22] <jnicol> }
  343. [17:34:23] <jnicol> }
  344. [17:34:24] <jnicol> return "done";
  345. [17:34:25] <jnicol> }
  346. [17:34:26] <jnicol> function getNextBase(b) {
  347. [17:34:27] <jnicol> if (b == "A") return "U";
  348. [17:34:27] <jnicol> if (b == "U") return "G";
  349. [17:34:29] <jnicol> if (b == "G") return "C";
  350. [17:34:29] <firedrake969> or I could've done that :P
  351. [17:34:30] <jnicol> return "A";
  352. [17:34:31] <jnicol> }
  353. [17:34:32] <jnicol> return true;
  354. [17:34:37] <firedrake969> oops
  355. [17:34:40] <firedrake969> Disrupted it, sorry
  356. [17:34:50] <jnicol> :) didnt take the blank line comments
  357. [17:35:11] <Eli-Fisker> :)
  358. [17:35:12] <hoglahoo> right, there's an escape for it but will have to google :)
  359. [17:35:26] <machinelves> blank line numbers please?
  360. [17:35:27] <firedrake969> What i get: GCGAAAACGCGCGAAAUCGCGCGAAAGCGCGCGAAACCGCGCGAAUACGCGCGAAUUCGCGCGAAUGCGCGCGAAUCCGCGCGAAGACGCGCGAAGUCGCGCGAAGGCGCGCGAAGCCGCGCGAACACGCGCGAACUCGCGCGAACGCGCGCGAACCCGC
  361. [17:35:30] <TomoeUzumaki> guys, I emailed someone and asked him to call me
  362. [17:35:32] <firedrake969> with spaces in between...
  363. [17:35:37] <TomoeUzumaki> but I forgot to give him my number.
  364. [17:35:47] <jnicol> let me try to post it again
  365. [17:35:54] <jnicol> locks = "xxxxxooxxx";
  366. [17:35:54] <jnicol> sequence = "GCGAAAACGC";
  367. [17:35:54] <jnicol> out("");
  368. [17:35:54] <jnicol> while (sequence != "done") {
  369. [17:35:54] <jnicol> outln(sequence);
  370. [17:35:54] <jnicol> sequence = getNextSequence(sequence, locks);
  371. [17:35:54] <jnicol> }
  372. [17:35:54] <jnicol> out("");
  373. [17:35:54] <jnicol> function getNextSequence(sq, lk) {
  374. [17:35:54] <jnicol> i = lk.length;
  375. [17:35:54] <jnicol> while (--i > 0) {
  376. [17:35:56] <jnicol> if (lk.substr(i,1) == "o") {
  377. [17:35:57] <jnicol> base = sq.substr(i,1);
  378. [17:35:57] <jnicol> sq = sq.substr(0,i) + getNextBase(base)
  379. [17:35:58] <jnicol> + sq.substr(i+1,sq.length-i);
  380. [17:36:01] <jnicol> if (base != "C") { return sq; }
  381. [17:36:02] <jnicol> }
  382. [17:36:03] <jnicol> }
  383. [17:36:03] <jnicol> return "done";
  384. [17:36:05] <jnicol> }
  385. [17:36:06] <jnicol> out("");
  386. [17:36:06] <jnicol> function getNextBase(b) {
  387. [17:36:07] <jnicol> if (b == "A") return "U";
  388. [17:36:08] <jnicol> if (b == "U") return "G";
  389. [17:36:09] <jnicol> if (b == "G") return "C";
  390. [17:36:10] <jnicol> return "A";
  391. [17:36:11] <jnicol> }
  392. [17:36:11] <jnicol> out("");
  393. [17:36:14] <jnicol> return true;
  394. [17:36:34] <jnicol> the out(""); is where I want the blank lines to be
  395. [17:36:53] <jnicol> but I think leaving in the out should not hurt anything
  396. [17:37:04] <hoglahoo> works fine with or without
  397. [17:37:12] <Eli-Fisker> http://prntscr.com/2s901r
  398. [17:37:16] <Eli-Fisker> Got it like this
  399. [17:37:42] <firedrake969> Can someone evaluate it?
  400. [17:37:46] <firedrake969> I have a really weird result.
  401. [17:38:12] <mat747> eli - http://prntscr.com/2s90a1
  402. [17:38:13] <Eli-Fisker> Now there are two bases unlocked
  403. [17:38:15] <firedrake969> 16 lines
  404. [17:38:26] <firedrake969> I get the same thing, mat.
  405. [17:38:30] <Eli-Fisker> I get what Mat has
  406. [17:38:30] <machinelves> output: http://prntscr.com/2s90et
  407. [17:38:33] <firedrake969> Ok, thanks
  408. [17:38:35] <jnicol> what result do you get fire?
  409. [17:38:36] <firedrake969> That explains it.
  410. [17:38:38] <firedrake969> Same as them
  411. [17:38:47] <firedrake969> Just didn't notice the two unlocked bases
  412. [17:38:55] <Eli-Fisker> This all the variants of two unlocked bases
  413. [17:39:04] <firedrake969> Yeah
  414. [17:39:08] <Eli-Fisker> All the possible combos
  415. [17:39:17] <jnicol> correct 2 unlocked bases :)
  416. [17:39:33] <jnicol> there will be more :)
  417. [17:39:44] <jnicol> I also changed the calling of getNextSequence to be in its own loop (line 4)
  418. [17:40:06] <jnicol> Now I would like to display only the unlocked bases and not the entire sequence
  419. [17:40:10] <hoglahoo> I didn't realize the evaluation is so slow
  420. [17:40:27] <firedrake969> So we could return sq.substr
  421. [17:40:27] <firedrake969> ?
  422. [17:40:42] <jnicol> did you get a timeout hog?
  423. [17:40:48] <hoglahoo> no it's good.
  424. [17:41:08] <jnicol> mine ran in .009 seconds
  425. [17:41:19] <hoglahoo> I ran all 4
  426. [17:41:24] <firedrake969> 0.012
  427. [17:41:47] <Eli-Fisker> Hogla, ah
  428. [17:42:00] <jnicol> delete all previous code and copy the following lines into the scripting window:
  429. [17:42:05] <jnicol> locks = "xxxxxooxxx";
  430. [17:42:05] <jnicol> sequence = "GCGAAAACGC";
  431. [17:42:05] <jnicol> out("");
  432. [17:42:05] <jnicol> while (sequence != "done") {
  433. [17:42:05] <jnicol> displayUnlockedBases(sequence, locks);
  434. [17:42:05] <jnicol> outln("energy = 0 kcal");
  435. [17:42:05] <jnicol> sequence = getNextSequence(sequence, locks);
  436. [17:42:05] <jnicol> }
  437. [17:42:05] <jnicol> out("");
  438. [17:42:05] <jnicol> function displayUnlockedBases(sq, lk) {
  439. [17:42:06] <firedrake969> Oh, yeah
  440. [17:42:06] <jnicol> for (i=0; i<lk.length; i++) {
  441. [17:42:07] <jnicol> if (lk.substr(i,1) == "o") {
  442. [17:42:08] <jnicol> out(sq.substr(i,1));
  443. [17:42:09] <jnicol> }
  444. [17:42:10] <jnicol> }
  445. [17:42:11] <jnicol> out(", ");
  446. [17:42:12] <jnicol> }
  447. [17:42:13] <jnicol> out("");
  448. [17:42:14] <jnicol> function getNextSequence(sq, lk) {
  449. [17:42:15] <jnicol> i = lk.length;
  450. [17:42:16] <jnicol> while (--i > 0) {
  451. [17:42:17] <jnicol> if (lk.substr(i,1) == "o") {
  452. [17:42:17] <firedrake969> *facepalm* sorry
  453. [17:42:18] <jnicol> base = sq.substr(i,1);
  454. [17:42:19] <jnicol> sq = sq.substr(0,i) + getNextBase(base)
  455. [17:42:19] <jnicol> + sq.substr(i+1,sq.length-i);
  456. [17:42:21] <jnicol> if (base != "C") { return sq; }
  457. [17:42:22] <jnicol> }
  458. [17:42:23] <jnicol> }
  459. [17:42:24] <jnicol> return "done";
  460. [17:42:25] <jnicol> }
  461. [17:42:26] <jnicol> out("");
  462. [17:42:27] <jnicol> function getNextBase(b) {
  463. [17:42:28] <jnicol> if (b == "A") return "U";
  464. [17:42:29] <jnicol> if (b == "U") return "G";
  465. [17:42:30] <jnicol> if (b == "G") return "C";
  466. [17:42:30] <jnicol> looks like it got cut
  467. [17:42:30] <jnicol> return "A";
  468. [17:42:33] <jnicol> }
  469. [17:42:33] <jnicol> out("");
  470. [17:42:34] <jnicol> return true;
  471. [17:42:49] <jnicol> hello?
  472. [17:42:59] <hoglahoo> uh oh.
  473. [17:43:12] <machinelves> cut off at: for (i=0; i
  474. [17:43:14] <hoglahoo> i< doesn't work
  475. [17:43:18] <jnicol> did anyone else lose chat?
  476. [17:43:28] <hoglahoo> the < buggers the chat, john
  477. [17:43:44] <firedrake969> Chat broke
  478. [17:43:47] <hoglahoo> eterna is looking for code
  479. [17:43:56] <firedrake969> chat broke for me, yayz
  480. [17:44:00] <jnicol> I cant type in chat anymore
  481. [17:44:07] <firedrake969> chat broke for me
  482. [17:44:08] <JohnDoe1> Linkbot, activate self destruct code 1A-2B-3.
  483. [17:44:08] <hoglahoo> refresh the page I guess
  484. [17:44:10] <firedrake969> ...
  485. [17:44:24] <firedrake969> chat broke
  486. [17:44:29] <firedrake969> can anybody see this?
  487. [17:44:43] <hoglahoo> we need to clear out the 20-line history, then refresh will work
  488. [17:44:53] <hoglahoo> need about 7 more I think
  489. [17:44:54] <hoglahoo> 6
  490. [17:44:54] <hoglahoo> 5
  491. [17:44:54] <hoglahoo> 4
  492. [17:44:55] <hoglahoo> 3
  493. [17:44:56] <hoglahoo> 2
  494. [17:44:56] <hoglahoo> 1
  495. [17:45:03] <hoglahoo> test
  496. [17:45:11] <hoglahoo> test
  497. [17:45:12] <hoglahoo> tes
  498. [17:45:13] <hoglahoo> test
  499. [17:45:14] <firedrake969> If somebody can read this, comment on the latest player puzzle :L
  500. [17:45:19] <Eli-Fisker> Did chat break?
  501. [17:45:20] <hoglahoo> there
  502. [17:45:21] <firedrake969> The chat's completely broken for me
  503. [17:45:29] <hoglahoo> should be fine now if folks refresh
  504. [17:45:39] <JohnDoe1> Linkbot, activate self-destruct code: 1A-2B-3
  505. [17:45:55] <jnicol> I'm back
  506. [17:46:03] <machinelves> *poof*
  507. [17:46:13] <jnicol> should we try that again?
  508. [17:46:19] <machinelves> yes please!
  509. [17:46:19] <firedrake969> chat fixed
  510. [17:46:20] <hoglahoo> no
  511. [17:46:24] <jnicol> in pieces?
  512. [17:46:25] <firedrake969> yay
  513. [17:46:29] <hoglahoo> the left arrow needs to be escaped
  514. [17:46:35] <firedrake969> I had to completely clear all eterna cookies
  515. [17:46:36] <hoglahoo> less than symbol
  516. [17:46:44] <hoglahoo> if you paste from client anyway
  517. [17:47:00] <jnicol> whats the escape key?
  518. [17:47:21] <firedrake969> Can you rewrite the script?
  519. [17:47:37] <hoglahoo> one sec &lt;
  520. [17:47:38] <JohnDoe1> upper left hand corner
  521. [17:47:47] <jnicol> I can prefix the left arrow
  522. [17:48:05] <hoglahoo> &lt;
  523. [17:48:27] <firedrake969> &lt;
  524. [17:48:28] <firedrake969> ?
  525. [17:48:38] <JohnDoe1> Unplug and plug back in!
  526. [17:48:40] <hoglahoo> hopefully John will see it
  527. [17:49:06] <hoglahoo> come back John :)
  528. [17:49:10] <hoglahoo> lol
  529. [17:49:15] <jnicol> hello
  530. [17:49:25] <firedrake969> Hi
  531. [17:49:29] <hoglahoo> use the ascii &lt;
  532. [17:49:35] <JohnDoe1> Who, me?
  533. [17:49:50] <JohnDoe1> 1011001011010100101101
  534. [17:49:51] <firedrake969> jnicol
  535. [17:50:03] <jnicol> I'm replacing the arrows now, hold on
  536. [17:50:55] <firedrake969> Ok
  537. [17:52:14] <JohnDoe1> ←↑→↓
  538. [17:52:36] <machinelves> hey, i have to go, jnicol thank you so much! i look forward to seeing the rest of this class later, and i really like your patient teaching style! hope you all have a good day :)
  539. [17:52:44] <hoglahoo> machinelves: see you later
  540. [17:52:55] <Eli-Fisker> Bye Machine, see you
  541. [17:52:58] <machinelves> bye! :D
  542. [17:52:59] <jnicol> ok, I'm going to try to copy this again, cross your fingers
  543. [17:53:03] <firedrake969> Ok
  544. [17:53:05] <mat747> bye machine
  545. [17:53:08] <hoglahoo> wait a moment
  546. [17:53:09] <jnicol> bye machine
  547. [17:53:11] <firedrake969> ?
  548. [17:53:19] <hoglahoo> if chat stalls for you folks, just wait about 20 seconds and reload the page
  549. [17:53:19] <jnicol> waiting
  550. [17:53:23] <hoglahoo> ok continue :)
  551. [17:53:33] <JohnDoe1> ↑↑↓↓↔↔BA Enter
  552. [17:53:40] <jnicol> locks = "xxxxxooxxx";
  553. [17:53:41] <jnicol> sequence = "GCGAAAACGC";
  554. [17:53:41] <jnicol> out("");
  555. [17:53:41] <jnicol> while (sequence != "done") {
  556. [17:53:41] <jnicol> displayUnlockedBases(sequence, locks);
  557. [17:53:41] <jnicol> outln("energy = 0 kcal");
  558. [17:53:41] <jnicol> sequence = getNextSequence(sequence, locks);
  559. [17:53:41] <jnicol> }
  560. [17:53:41] <jnicol> out("");
  561. [17:53:41] <jnicol> function displayUnlockedBases(sq, lk) {
  562. [17:53:41] <jnicol> for (i=0; i<lk.length; i++) {
  563. [17:53:42] <jnicol> if (lk.substr(i,1) == "o") {
  564. [17:53:43] <jnicol> out(sq.substr(i,1));
  565. [17:53:44] <jnicol> }
  566. [17:53:45] <jnicol> }
  567. [17:53:46] <jnicol> out(", ");
  568. [17:53:46] <jnicol> }
  569. [17:53:47] <jnicol> out("");
  570. [17:53:48] <jnicol> function getNextSequence(sq, lk) {
  571. [17:53:49] <jnicol> i = lk.length;
  572. [17:53:51] <jnicol> while (--i > 0) {
  573. [17:53:51] <firedrake969> stalled again
  574. [17:53:52] <jnicol> if (lk.substr(i,1) == "o") {
  575. [17:53:52] <jnicol> base = sq.substr(i,1);
  576. [17:53:55] <jnicol> sq = sq.substr(0,i) + getNextBase(base)
  577. [17:53:55] <jnicol> + sq.substr(i+1,sq.length-i);
  578. [17:53:56] <jnicol> if (base != "C") { return sq; }
  579. [17:53:57] <jnicol> }
  580. [17:53:57] <jnicol> }
  581. [17:53:58] <jnicol> return "done";
  582. [17:53:59] <jnicol> }
  583. [17:54:01] <hoglahoo> you pasted the arrow again
  584. [17:54:02] <jnicol> out("");
  585. [17:54:02] <jnicol> function getNextBase(b) {
  586. [17:54:03] <jnicol> if (b == "A") return "U";
  587. [17:54:04] <jnicol> if (b == "U") return "G";
  588. [17:54:05] <jnicol> if (b == "G") return "C";
  589. [17:54:05] <jnicol> return "A";
  590. [17:54:06] <jnicol> }
  591. [17:54:07] <jnicol> out("");
  592. [17:54:08] <jnicol> return true;
  593. [17:55:04] <JohnDoe1> We need Linkbot for this job.
  594. [17:55:12] <jnicol> hello
  595. [17:55:19] <Eli-Fisker> hi
  596. [17:55:26] <firedrake969> back
  597. [17:55:29] <TomoeUzumaki> hello
  598. [17:55:59] <jnicol> locks = "xxxxxooxxx";
  599. [17:56:00] <jnicol> sequence = "GCGAAAACGC";
  600. [17:56:00] <jnicol> out("");
  601. [17:56:00] <jnicol> while (sequence != "done") {
  602. [17:56:00] <jnicol> displayUnlockedBases(sequence, locks);
  603. [17:56:01] <jnicol> outln("energy = 0 kcal");
  604. [17:56:01] <jnicol> sequence = getNextSequence(sequence, locks);
  605. [17:56:01] <jnicol> }
  606. [17:56:01] <jnicol> out("");
  607. [17:56:01] <jnicol> function displayUnlockedBases(sq, lk) {
  608. [17:56:01] <jnicol> for (i=0; i&lt;lk.length; i++) {
  609. [17:56:01] <jnicol> if (lk.substr(i,1) == "o") {
  610. [17:56:02] <jnicol> out(sq.substr(i,1));
  611. [17:56:03] <jnicol> }
  612. [17:56:03] <jnicol> }
  613. [17:56:05] <jnicol> out(", ");
  614. [17:56:06] <jnicol> }
  615. [17:56:06] <jnicol> out("");
  616. [17:56:08] <jnicol> function getNextSequence(sq, lk) {
  617. [17:56:08] <jnicol> i = lk.length;
  618. [17:56:09] <jnicol> while (--i > 0) {
  619. [17:56:10] <jnicol> if (lk.substr(i,1) == "o") {
  620. [17:56:11] <jnicol> base = sq.substr(i,1);
  621. [17:56:13] <jnicol> sq = sq.substr(0,i) + getNextBase(base)
  622. [17:56:13] <jnicol> + sq.substr(i+1,sq.length-i);
  623. [17:56:14] <jnicol> if (base != "C") { return sq; }
  624. [17:56:17] <jnicol> }
  625. [17:56:17] <jnicol> }
  626. [17:56:18] <jnicol> return "done";
  627. [17:56:18] <jnicol> }
  628. [17:56:19] <jnicol> out("");
  629. [17:56:21] <jnicol> function getNextBase(b) {
  630. [17:56:22] <jnicol> if (b == "A") return "U";
  631. [17:56:23] <jnicol> if (b == "U") return "G";
  632. [17:56:24] <jnicol> if (b == "G") return "C";
  633. [17:56:25] <jnicol> return "A";
  634. [17:56:26] <jnicol> }
  635. [17:56:27] <jnicol> out("");
  636. [17:56:28] <jnicol> return true;
  637. [17:56:42] <jnicol> wow, that was painful
  638. [17:56:55] <hoglahoo> yay
  639. [17:58:04] <jnicol> everyone get that?
  640. [17:58:04] <Eli-Fisker> http://prntscr.com/2s96l8
  641. [17:58:08] <Eli-Fisker> Got output
  642. [17:58:22] <JohnDoe1> while (--i &gt; 0) { if (lk.substr(i,1) == "o") { base = sq.substr(i,1); sq = sq.substr(0,i) + getNextBase(base) + sq.substr(i+1,sq.length-i); if (base != "C") { return sq; } } } return "done"; } out(""); function getNextBase(b) { if (b == "A") return "U"; if (b == "U") return "G"; if (b == "G") return "C"; return "A"; } out(""); return true;
  643. [17:58:29] <jnicol> thats what you should get eli :)
  644. [17:58:34] <Eli-Fisker> :)
  645. [17:58:38] <Eli-Fisker> Two bases
  646. [17:58:39] <Eli-Fisker> shown
  647. [17:58:45] <JohnDoe1> :D
  648. [17:58:52] <Eli-Fisker> In all combos
  649. [17:59:00] <jnicol> Notice that in displayUnlockedBases, we are checking each base the same way we did in getNextSequence.
  650. [17:59:12] <jnicol> We now only display a base if it is unlocked (lines 12 and 13)
  651. [17:59:13] <firedrake969> That was quite painful.
  652. [17:59:19] <JohnDoe1> What's going on?
  653. [17:59:26] <jnicol> Also, in line 6, I added a placeholder for where we eventually want to calculate the energy of the sequence.
  654. [17:59:39] <jnicol> John, javascript class
  655. [18:00:03] <jnicol> But first, I am a little concerned that the sequence I chose will not fold properly for all the combinations we need to test.
  656. [18:00:13] <JohnDoe1> WHAT is going on?!
  657. [18:00:32] <jnicol> this is a class to learn about javascript
  658. [18:00:42] <jnicol> Fortunately the developers have provided a library function, fold, that will tell us if the sequence folds properly.
  659. [18:00:45] <JohnDoe1> in the chat?
  660. [18:00:56] <jnicol> yup
  661. [18:01:00] <Eli-Fisker> Yes
  662. [18:01:13] <jnicol> Lib.fold(sequence) takes the sequence as an input and returns the natural fold structure.
  663. [18:01:23] <jnicol> Then we compare this natural fold to what we want as the target fold, and hopefully they match!
  664. [18:01:26] <firedrake969> So would we compare it
  665. [18:01:29] <firedrake969> oh you typed faster :P
  666. [18:01:41] <jnicol> delete all previous code and copy the following lines into the scripting window:
  667. [18:01:51] <biggestlegoheroicafanever> Hello people of Planet EteRNA
  668. [18:01:56] <firedrake969> shh
  669. [18:02:00] <JohnDoe1> {Ask question }
  670. [18:02:02] <firedrake969> or it'll freeze again
  671. [18:02:25] <jnicol> locks = "xxxxxooxxx";
  672. [18:02:25] <jnicol> sequence = "GCGAAAACGC";
  673. [18:02:25] <jnicol> structure = "(((....)))";
  674. [18:02:25] <jnicol> out("");
  675. [18:02:25] <jnicol> while (sequence != "done") {
  676. [18:02:25] <jnicol> displayUnlockedBases(sequence, locks);
  677. [18:02:25] <jnicol> if (Lib.fold(sequence) != structure) {
  678. [18:02:25] <jnicol> outln("misfold :(");
  679. [18:02:25] <jnicol> } else {
  680. [18:02:25] <jnicol> outln("energy = 0 kcal");
  681. [18:02:25] <jnicol> }
  682. [18:02:27] <jnicol> sequence = getNextSequence(sequence, locks);
  683. [18:02:27] <jnicol> }
  684. [18:02:30] <jnicol> out("");
  685. [18:02:30] <jnicol> function displayUnlockedBases(sq, lk) {
  686. [18:02:31] <jnicol> for (i=0; i&lt;lk.length; i++) {
  687. [18:02:32] <jnicol> if (lk.substr(i,1) == "o") {
  688. [18:02:33] <jnicol> out(sq.substr(i,1));
  689. [18:02:34] <jnicol> }
  690. [18:02:35] <jnicol> }
  691. [18:02:36] <jnicol> out(", ");
  692. [18:02:37] <jnicol> }
  693. [18:02:38] <jnicol> out("");
  694. [18:02:39] <jnicol> function getNextSequence(sq, lk) {
  695. [18:02:40] <jnicol> i = lk.length;
  696. [18:02:41] <jnicol> while (--i > 0) {
  697. [18:02:42] <jnicol> if (lk.substr(i,1) == "o") {
  698. [18:02:43] <jnicol> base = sq.substr(i,1);
  699. [18:02:43] <jnicol> sq = sq.substr(0,i) + getNextBase(base)
  700. [18:02:44] <jnicol> + sq.substr(i+1,sq.length-i);
  701. [18:02:46] <jnicol> if (base != "C") { return sq; }
  702. [18:02:47] <jnicol> }
  703. [18:02:48] <jnicol> }
  704. [18:02:49] <jnicol> return "done";
  705. [18:02:50] <jnicol> }
  706. [18:02:51] <jnicol> out("");
  707. [18:02:52] <jnicol> function getNextBase(b) {
  708. [18:02:53] <jnicol> if (b == "A") return "U";
  709. [18:02:54] <jnicol> if (b == "U") return "G";
  710. [18:02:55] <jnicol> if (b == "G") return "C";
  711. [18:02:56] <jnicol> return "A";
  712. [18:02:57] <jnicol> }
  713. [18:02:58] <jnicol> out("");
  714. [18:02:59] <jnicol> return true;
  715. [18:03:12] <jnicol> Notice that line 7 compares the natural fold to our desired target fold.
  716. [18:03:14] <firedrake969> Is it done?
  717. [18:03:26] <jnicol> yes
  718. [18:03:26] <hoglahoo> I got a sadface output
  719. [18:03:42] <Eli-Fisker> haha. me too
  720. [18:03:43] <firedrake969> because it's a misfold
  721. [18:03:55] <Eli-Fisker> It is intended
  722. [18:03:58] <JohnDoe1> what are you coding?
  723. [18:03:59] <Eli-Fisker> :)
  724. [18:04:07] <Eli-Fisker> Nice detail, John
  725. [18:04:20] <jnicol> for AG and GG there are misfolds :(
  726. [18:04:31] <firedrake969> and CG
  727. [18:04:35] <JohnDoe1> where is this?
  728. [18:04:43] <jnicol> Unfortunately, not all of the sequences folds as we would like.
  729. [18:05:04] <jnicol> John, you can go to http://eterna.cmu.edu/web/script/create/
  730. [18:05:14] <firedrake969> yayz
  731. [18:05:17] <jnicol> and copy the code into the scripting window
  732. [18:05:23] <firedrake969> out(Lib.energyOfStruct(sequence,structure));
  733. [18:05:34] <firedrake969> Add that right below outln("energy = )";
  734. [18:05:39] <firedrake969> and remove the 0 kcal
  735. [18:05:41] <jnicol> So, an easy way to fix this is to select a sequence with a longer stem to prevent misfolds.
  736. [18:05:56] <jnicol> and lets also test all 256 combinations in the tetraloop
  737. [18:06:38] <jnicol> delete all previous code and copy the following lines into the scripting window:
  738. [18:06:45] <JohnDoe1> how do I load in what youre working on?
  739. [18:06:54] <jnicol> outln("GC closing tetraloops");
  740. [18:06:55] <jnicol> sequence = "CGCUGAAAACAGCG";
  741. [18:06:55] <jnicol> structure = "(((((....)))))";
  742. [18:06:55] <jnicol> locks = "xxxxxooooxxxxx";
  743. [18:06:55] <jnicol> out("");
  744. [18:06:55] <jnicol> while (sequence != "done") {
  745. [18:06:55] <jnicol> displayUnlockedBases(sequence, locks);
  746. [18:06:55] <jnicol> if (Lib.fold(sequence) != structure) {
  747. [18:06:55] <jnicol> outln("misfold :(");
  748. [18:06:55] <jnicol> } else {
  749. [18:06:55] <jnicol> outln("energy = 0 kcal");
  750. [18:06:56] <jnicol> }
  751. [18:06:57] <jnicol> sequence = getNextSequence(sequence, locks);
  752. [18:06:58] <jnicol> }
  753. [18:06:58] <jnicol> out("");
  754. [18:07:00] <jnicol> function displayUnlockedBases(sq, lk) {
  755. [18:07:01] <jnicol> for (i=0; i&lt;lk.length; i++) {
  756. [18:07:02] <jnicol> if (lk.substr(i,1) == "o") {
  757. [18:07:03] <jnicol> out(sq.substr(i,1));
  758. [18:07:04] <jnicol> }
  759. [18:07:05] <jnicol> }
  760. [18:07:05] <jnicol> out(", ");
  761. [18:07:08] <jnicol> }
  762. [18:07:08] <jnicol> out("");
  763. [18:07:09] <jnicol> function getNextSequence(sq, lk) {
  764. [18:07:10] <jnicol> i = lk.length;
  765. [18:07:11] <jnicol> while (--i > 0) {
  766. [18:07:12] <jnicol> if (lk.substr(i,1) == "o") {
  767. [18:07:13] <jnicol> base = sq.substr(i,1);
  768. [18:07:14] <jnicol> sq = sq.substr(0,i) + getNextBase(base)
  769. [18:07:15] <jnicol> + sq.substr(i+1,sq.length-i);
  770. [18:07:16] <jnicol> if (base != "C") { return sq; }
  771. [18:07:17] <jnicol> }
  772. [18:07:18] <jnicol> }
  773. [18:07:19] <jnicol> return "done";
  774. [18:07:20] <jnicol> }
  775. [18:07:20] <jnicol> out("");
  776. [18:07:22] <jnicol> function getNextBase(b) {
  777. [18:07:23] <jnicol> if (b == "A") return "U";
  778. [18:07:24] <jnicol> if (b == "U") return "G";
  779. [18:07:25] <jnicol> if (b == "G") return "C";
  780. [18:07:25] <jnicol> return "A";
  781. [18:07:27] <jnicol> }
  782. [18:07:28] <jnicol> out("");
  783. [18:07:29] <jnicol> return true;
  784. [18:07:35] <jnicol> ok
  785. [18:08:09] <jnicol> John, are you able to copy this code into the scripting window?
  786. [18:08:31] <jnicol> did everyone run the code?
  787. [18:08:36] <Eli-Fisker> yes
  788. [18:08:37] <hoglahoo> I got a sadface army
  789. [18:08:37] <firedrake969> it's running
  790. [18:08:47] <jnicol> really hog??
  791. [18:08:55] <hoglahoo> yeah
  792. [18:09:00] <firedrake969> I got none
  793. [18:09:03] <Eli-Fisker> I got a ton of 0 KCal output
  794. [18:09:05] <hoglahoo> hmm
  795. [18:09:09] <hoglahoo> maybe I miscopied.
  796. [18:09:13] <firedrake969> same
  797. [18:09:15] <firedrake969> well that's hardcoded
  798. [18:09:20] <jnicol> 0 kcal yes, but should be no sad faces
  799. [18:09:43] <Eli-Fisker> http://prntscr.com/2s9aal
  800. [18:09:53] <jnicol> sad face only displays if there is a misfold
  801. [18:10:16] <jnicol> that is the correct output eli
  802. [18:10:17] <hoglahoo> recopied and pasted into a blank script, same result
  803. [18:10:37] <hoglahoo> maybe will try IE.
  804. [18:10:42] <JohnDoe1> copied
  805. [18:10:46] <firedrake969> Internet Exploder?
  806. [18:10:56] <jnicol> didnt you have a problem with the library call last time also hog?
  807. [18:10:57] <Eli-Fisker> lol, Fire
  808. [18:10:58] <hoglahoo> yeah my script failed in FF before for some reason
  809. [18:10:59] <hoglahoo> yes I did
  810. [18:11:30] <hoglahoo> works a treat in IE
  811. [18:11:41] <jnicol> Good, looks like this is a good sequence to prevent misfolds for all GC closing tetraloops!
  812. [18:11:41] <hoglahoo> oh, object doesn't suppor tthis property or method. weird
  813. [18:11:49] <hoglahoo> hehe
  814. [18:11:54] <jnicol> :)
  815. [18:12:03] <jnicol> Did anyone hit a timeout after clicking Evaluate?
  816. [18:12:07] <firedrake969> in javascript, how do you attack strings to each other?
  817. [18:12:16] <jnicol> Since this code is getting longer, the timeout should be set to higher value.
  818. [18:12:21] <firedrake969> me by like .057 sec
  819. [18:12:26] <jnicol> Setting the timeout to 60 should be good for the rest of this class.
  820. [18:12:40] <jnicol> Now its time to actually calculate the energy for each tetraloop.
  821. [18:12:51] <jnicol> The library call energyOfStruct returns the total energy of the sequence.
  822. [18:13:24] <jnicol> which we used in the preious class
  823. [18:13:24] <firedrake969> Ok
  824. [18:13:24] <jnicol> Lets display the total energy first, then later we will change this to display only the energy of the loop.
  825. [18:13:29] <hoglahoo> ah
  826. [18:13:29] <firedrake969> Can I see if I know a way to?
  827. [18:14:01] <JohnDoe1> GC closing tetraloopsAAAA, energy = 0 kcalAAAU, energy = 0 kcalAAAG, energy = 0 kcalAAAC, energy = 0 kcalAAUA, energy = 0 kcalAAUU, energy = 0 kcalAAUG, energy = 0 kcalAAUC, energy = 0 kcalAAGA, energy = 0 kcalAAGU, energy = 0 kcalAAGG, energy = 0 kcalAAGC, energy = 0 kcalAACA, energy = 0 kcalAACU, energy = 0 kcalAACG, energy = 0 kcalAACC, energy = 0 kcalAUAA, energy =
  828. [18:14:12] <jnicol> delete all previous code and copy the following lines into the scripting window:
  829. [18:14:19] <jnicol> outln("GC closing tetraloops");
  830. [18:14:19] <jnicol> sequence = "CGCUGAAAACAGCG";
  831. [18:14:19] <jnicol> structure = "(((((....)))))";
  832. [18:14:19] <jnicol> locks = "xxxxxooooxxxxx";
  833. [18:14:19] <jnicol> out("");
  834. [18:14:19] <jnicol> while (sequence != "done") {
  835. [18:14:19] <jnicol> displayUnlockedBases(sequence, locks);
  836. [18:14:19] <jnicol> if (Lib.fold(sequence) != structure) {
  837. [18:14:19] <jnicol> outln("misfold :(");
  838. [18:14:19] <jnicol> } else {
  839. [18:14:21] <jnicol> energy = Lib.energyOfStruct(sequence, structure);
  840. [18:14:22] <jnicol> out("total energy = ");
  841. [18:14:22] <jnicol> outln(energy.toFixed(2));
  842. [18:14:23] <jnicol> }
  843. [18:14:24] <jnicol> sequence = getNextSequence(sequence, locks);
  844. [18:14:25] <jnicol> }
  845. [18:14:26] <jnicol> out("");
  846. [18:14:27] <jnicol> function displayUnlockedBases(sq, lk) {
  847. [18:14:28] <jnicol> for (i=0; i&lt;lk.length; i++) {
  848. [18:14:29] <jnicol> if (lk.substr(i,1) == "o") {
  849. [18:14:30] <jnicol> out(sq.substr(i,1));
  850. [18:14:31] <jnicol> }
  851. [18:14:32] <jnicol> }
  852. [18:14:33] <jnicol> out(", ");
  853. [18:14:34] <jnicol> }
  854. [18:14:35] <jnicol> out("");
  855. [18:14:36] <jnicol> function getNextSequence(sq, lk) {
  856. [18:14:37] <jnicol> i = lk.length;
  857. [18:14:38] <jnicol> while (--i > 0) {
  858. [18:14:39] <jnicol> if (lk.substr(i,1) == "o") {
  859. [18:14:40] <jnicol> base = sq.substr(i,1);
  860. [18:14:41] <jnicol> sq = sq.substr(0,i) + getNextBase(base)
  861. [18:14:42] <jnicol> + sq.substr(i+1,sq.length-i);
  862. [18:14:43] <jnicol> if (base != "C") { return sq; }
  863. [18:14:44] <jnicol> }
  864. [18:14:44] <jnicol> }
  865. [18:14:45] <jnicol> return "done";
  866. [18:14:47] <jnicol> }
  867. [18:14:48] <jnicol> out("");
  868. [18:14:49] <jnicol> function getNextBase(b) {
  869. [18:14:50] <jnicol> if (b == "A") return "U";
  870. [18:14:51] <jnicol> if (b == "U") return "G";
  871. [18:14:52] <jnicol> if (b == "G") return "C";
  872. [18:14:53] <jnicol> return "A";
  873. [18:14:54] <jnicol> }
  874. [18:14:55] <jnicol> out("");
  875. [18:14:56] <jnicol> return true;
  876. [18:14:59] <jnicol> ok
  877. [18:15:15] <jnicol> Good! Notice that line 11 has been added to get the energy of the sequence.
  878. [18:15:27] <firedrake969> So what does it do?
  879. [18:15:53] <firedrake969> the toFixed
  880. [18:16:01] <jnicol> that is the mfe, (energy) that each sequence folds to
  881. [18:16:17] <jnicol> if you go to puzzlemaker and put in each sequence
  882. [18:16:18] <firedrake969> So what does energy.toFixed(2) do to the energy?
  883. [18:16:31] <jnicol> that is the energy that will display in the energy box
  884. [18:17:00] <jnicol> javascript is bad at rounding floating point numbers
  885. [18:17:04] <hoglahoo> seems to work when I'm logged in as opposed to not logged in, with IE
  886. [18:17:04] <firedrake969> So it rounds to the hundredth
  887. [18:17:05] <firedrake969> ?
  888. [18:17:09] <jnicol> so toFixed rounds it to 2 decimals
  889. [18:17:16] <firedrake969> And I have a suggestion
  890. [18:17:28] <firedrake969> You set a task, we work on it for ~5 minutes, and then you show the code
  891. [18:17:54] <jnicol> thats a good class for next time, thanks!
  892. [18:18:17] <jnicol> The method I used to calculate each loop energy was to find the loop energy when all unlocked bases are set to A.
  893. [18:18:24] <jnicol> and use that loop energy as a starting point reference to calculate all other tetraloop energies.
  894. [18:18:27] <firedrake969> So that we can try what we've learned
  895. [18:18:33] <jnicol> So for a GC closing pair with all tetraloop bases set to A, the loop energy is 4.5 kcal.
  896. [18:19:05] <hoglahoo> did that last one take anyone else 161 seconds to evaluate :P
  897. [18:19:15] <firedrake969> No :P
  898. [18:19:19] <firedrake969> Like I said, Internet Exploder :3
  899. [18:19:39] <jnicol> 6 seconds for me
  900. [18:19:55] <Eli-Fisker> Around 10 for me
  901. [18:20:00] <hoglahoo> lawl.
  902. [18:20:03] <firedrake969> 15 for me\
  903. [18:20:08] <firedrake969> Cool
  904. [18:20:22] <hoglahoo> oh well, at least it ran. or walked, as the case may have been
  905. [18:20:25] <firedrake969> I found a way to compare the energies from all As to the various ones
  906. [18:20:30] <firedrake969> firstEnergy = Lib.energyOfStruct(sequence,structure);
  907. [18:20:35] <firedrake969> energy = (Lib.energyOfStruct(sequence, structure)) - firstEnergy;
  908. [18:20:50] <firedrake969> Add the first one below line 4, and the second one at line 12.
  909. [18:21:06] <firedrake969> The first is an addition, the second a replacement
  910. [18:21:18] <jnicol> thats exactly what we are going to do next fire!
  911. [18:21:24] <firedrake969> lol
  912. [18:21:24] <hoglahoo> oo clap clap
  913. [18:21:28] <firedrake969> thanks
  914. [18:21:44] <jnicol> delete all previous code and copy the following lines into the scripting window:
  915. [18:22:00] <jnicol> outln("GC closing tetraloops");
  916. [18:22:01] <jnicol> sequence = "CGCUGAAAACAGCG";
  917. [18:22:01] <jnicol> structure = "(((((....)))))";
  918. [18:22:01] <jnicol> locks = "xxxxxooooxxxxx";
  919. [18:22:01] <jnicol> loopenergy = 4.5;
  920. [18:22:01] <jnicol> out("");
  921. [18:22:01] <jnicol> ref_energy = Lib.energyOfStruct(sequence, structure) - loopenergy;
  922. [18:22:01] <jnicol> while (sequence != "done") {
  923. [18:22:01] <jnicol> displayUnlockedBases(sequence, locks);
  924. [18:22:01] <jnicol> if (Lib.fold(sequence) != structure) {
  925. [18:22:01] <jnicol> outln("misfold :(");
  926. [18:22:02] <jnicol> } else {
  927. [18:22:03] <jnicol> energy = Lib.energyOfStruct(sequence, structure) - ref_energy;
  928. [18:22:04] <jnicol> out("loop energy = ");
  929. [18:22:05] <jnicol> outln(energy.toFixed(2));
  930. [18:22:06] <jnicol> }
  931. [18:22:07] <jnicol> sequence = getNextSequence(sequence, locks);
  932. [18:22:08] <jnicol> }
  933. [18:22:09] <jnicol> out("");
  934. [18:22:10] <jnicol> function displayUnlockedBases(sq, lk) {
  935. [18:22:11] <jnicol> for (i=0; i&lt;lk.length; i++) {
  936. [18:22:12] <jnicol> if (lk.substr(i,1) == "o") {
  937. [18:22:13] <jnicol> out(sq.substr(i,1));
  938. [18:22:14] <jnicol> }
  939. [18:22:15] <jnicol> }
  940. [18:22:15] <jnicol> out(", ");
  941. [18:22:18] <jnicol> }
  942. [18:22:18] <jnicol> out("");
  943. [18:22:19] <jnicol> function getNextSequence(sq, lk) {
  944. [18:22:20] <jnicol> i = lk.length;
  945. [18:22:21] <jnicol> while (--i > 0) {
  946. [18:22:22] <jnicol> if (lk.substr(i,1) == "o") {
  947. [18:22:23] <jnicol> base = sq.substr(i,1);
  948. [18:22:24] <jnicol> sq = sq.substr(0,i) + getNextBase(base)
  949. [18:22:25] <jnicol> + sq.substr(i+1,sq.length-i);
  950. [18:22:26] <jnicol> if (base != "C") { return sq; }
  951. [18:22:27] <jnicol> }
  952. [18:22:28] <jnicol> }
  953. [18:22:29] <jnicol> return "done";
  954. [18:22:30] <jnicol> }
  955. [18:22:31] <jnicol> out("");
  956. [18:22:32] <jnicol> function getNextBase(b) {
  957. [18:22:32] <jnicol> if (b == "A") return "U";
  958. [18:22:33] <jnicol> if (b == "U") return "G";
  959. [18:22:36] <jnicol> if (b == "G") return "C";
  960. [18:22:36] <jnicol> return "A";
  961. [18:22:37] <jnicol> }
  962. [18:22:38] <jnicol> out("");
  963. [18:22:39] <jnicol> return true;
  964. [18:22:44] <jnicol> ok
  965. [18:23:24] <jnicol> just like fire said, we are calculting a reference enrgy and using that to subtract from the total energy to get each loop energy
  966. [18:24:00] <jnicol> Line 7 calculates the reference energy, which is just the energy of the stem pairs.
  967. [18:24:00] <jnicol> In line 13, we subtract out the stem pair energy and are left with the energy of the loop.
  968. [18:24:00] <JohnDoe1> how do yuo use this?
  969. [18:24:17] <jnicol> copy the code into the scripting window, John :)
  970. [18:24:18] <firedrake969> I just added an easier, text-based way to see whether energy raised, lowered, or didn't change
  971. [18:24:53] <jnicol> This is finally what we want to see, each combination of the tetraloop, and the energy of that loop!
  972. [18:24:56] <firedrake969> It's a three-way if/else if/else check
  973. [18:25:04] <jnicol> did it work for everyone?
  974. [18:25:10] <firedrake969> if (energy &lt; 0) { outln("Energy is lower!"); } else if (energy &gt; 0) { outln("Energy is higher!"); } else { outln("Energy didn't change!"); }
  975. [18:25:12] <Eli-Fisker> yes, here
  976. [18:25:14] <hoglahoo> still evaluating.
  977. [18:25:27] <firedrake969> If you copy/paste that, it's cool :3
  978. [18:25:27] <jnicol> we'll wait for you :)
  979. [18:25:28] <mat747> yes
  980. [18:25:41] <firedrake969> It tells you via text whether energy raised, lowered, or didn't change
  981. [18:25:47] <hoglahoo> done
  982. [18:26:10] <jnicol> thats a goodexercise fire, helps to understand the code and functions better
  983. [18:26:14] <hoglahoo> so, everything lower than 4.5 is a boost sequence, and everything higher is a what
  984. [18:26:17] <Eli-Fisker> Fire where do you add it?
  985. [18:26:24] <jnicol> bust?
  986. [18:26:28] <hoglahoo> nice
  987. [18:26:40] <jnicol> I would like to make one more update to the code to show how it can be used for also displaying internal loops.
  988. [18:26:50] <jnicol> delete all previous code and copy the following lines into the scripting window:
  989. [18:27:15] <firedrake969> @Eli inside the else, right under outln(energy.toFixed(2));
  990. [18:27:22] <Eli-Fisker> Thx Fire
  991. [18:27:26] <JohnDoe1> I'm gonna do [Unsolvable] Possibly unsolvable series 3 - HgcG RNA . 0 solved 1200reward 28 Feb 2011 jeehyung
  992. [18:27:41] <firedrake969> It's impossible, John.
  993. [18:27:45] <firedrake969> np, Eli
  994. [18:28:02] <jnicol> sorry, needed to remove some comments, so it didnt break chat
  995. [18:28:29] <jnicol> here we go
  996. [18:28:32] <jnicol> outln("GC closing tetraloops");
  997. [18:28:32] <jnicol> sequence = "CGCUGAAAACAGCG";
  998. [18:28:32] <jnicol> structure = "(((((....)))))";
  999. [18:28:32] <jnicol> locks = "xxxxxooooxxxxx";
  1000. [18:28:32] <jnicol> loopenergy = 4.5;
  1001. [18:28:32] <jnicol> displayEnergy(sequence, structure, locks, loopenergy);
  1002. [18:28:32] <jnicol> out("");
  1003. [18:28:32] <jnicol> outln("AU closing tetraloops");
  1004. [18:28:32] <jnicol> sequence = "CGCUAAAAAUAGCG";
  1005. [18:28:32] <jnicol> structure = "(((((....)))))";
  1006. [18:28:32] <jnicol> locks = "xxxxxooooxxxxx";
  1007. [18:28:32] <JohnDoe1> who cares about impossibility, RNASSD did it
  1008. [18:28:35] <jnicol> loopenergy = 5.3;
  1009. [18:28:35] <jnicol> displayEnergy(sequence, structure, locks, loopenergy);
  1010. [18:28:36] <jnicol> out("");
  1011. [18:28:37] <jnicol> outln("AU-AU closing for 1-1 loops");
  1012. [18:28:38] <jnicol> sequence = "GCAAAGCGAAAGCUAUGC";
  1013. [18:28:39] <jnicol> structure = "(((.(((....))).)))";
  1014. [18:28:40] <jnicol> locks = "xxxoxxxxxxxxxxoxxx";
  1015. [18:28:40] <jnicol> loopenergy = 1.7;
  1016. [18:28:41] <jnicol> displayEnergy(sequence, structure, locks, loopenergy);
  1017. [18:28:42] <jnicol> out("");
  1018. [18:28:43] <jnicol> function displayEnergy(seq, struc, lck, eng) {
  1019. [18:28:45] <jnicol> ref_energy = Lib.energyOfStruct(seq, struc) - eng;
  1020. [18:28:46] <jnicol> while (seq != "done") {
  1021. [18:28:47] <jnicol> displayUnlockedBases(seq, lck);
  1022. [18:28:48] <jnicol> if (Lib.fold(seq) != struc) {
  1023. [18:28:49] <jnicol> outln("misfold :(");
  1024. [18:28:50] <jnicol> } else {
  1025. [18:28:51] <jnicol> eng = Lib.energyOfStruct(seq, struc) - ref_energy;
  1026. [18:28:52] <jnicol> outln(eng.toFixed(2));
  1027. [18:28:53] <jnicol> }
  1028. [18:28:54] <jnicol> seq = getNextSequence(seq, lck);
  1029. [18:28:55] <jnicol> }
  1030. [18:28:56] <jnicol> }
  1031. [18:28:57] <jnicol> out("");
  1032. [18:28:58] <jnicol> function displayUnlockedBases(sq, lk) {
  1033. [18:28:59] <jnicol> for (i=0; i&lt;lk.length; i++) {
  1034. [18:29:00] <jnicol> if (lk.substr(i,1) == "o") {
  1035. [18:29:01] <jnicol> out(sq.substr(i,1));
  1036. [18:29:02] <jnicol> }
  1037. [18:29:03] <jnicol> }
  1038. [18:29:04] <jnicol> out(", ");
  1039. [18:29:05] <jnicol> }
  1040. [18:29:05] <jnicol> out("");
  1041. [18:29:08] <jnicol> function getNextSequence(sq, lk) {
  1042. [18:29:08] <jnicol> i = lk.length;
  1043. [18:29:09] <jnicol> while (--i > 0) {
  1044. [18:29:10] <jnicol> if (lk.substr(i,1) == "o") {
  1045. [18:29:11] <jnicol> base = sq.substr(i,1);
  1046. [18:29:11] <jnicol> sq = sq.substr(0,i) + getNextBase(base)
  1047. [18:29:13] <jnicol> + sq.substr(i+1,sq.length-i);
  1048. [18:29:13] <jnicol> if (base != "C") { return sq; }
  1049. [18:29:15] <jnicol> }
  1050. [18:29:17] <jnicol> }
  1051. [18:29:18] <jnicol> return "done";
  1052. [18:29:19] <jnicol> }
  1053. [18:29:20] <jnicol> out("");
  1054. [18:29:21] <jnicol> function getNextBase(b) {
  1055. [18:29:22] <jnicol> if (b == "A") return "U";
  1056. [18:29:22] <jnicol> if (b == "U") return "G";
  1057. [18:29:23] <jnicol> if (b == "G") return "C";
  1058. [18:29:23] <jnicol> return "A";
  1059. [18:29:25] <jnicol> }
  1060. [18:29:26] <jnicol> out("");
  1061. [18:29:26] <jnicol> return true;
  1062. [18:29:38] <firedrake969> the bots don't always follow rules.
  1063. [18:29:40] <jnicol> ok, copy but dont runit
  1064. [18:29:47] <hoglahoo> JohnDoe1: RNASSD didn't stabilize it, it tricked eterna into accepting its sequence as a solve using a method the game doesn't provide for us
  1065. [18:29:53] <mat747> what about a google doc
  1066. [18:30:10] <mat747> that we could copy from
  1067. [18:30:23] <firedrake969> that would be awesome
  1068. [18:30:42] <jnicol> first remove line 12
  1069. [18:30:56] <Eli-Fisker> Or perhaps a pastebin link
  1070. [18:30:59] <JohnDoe1> http://eterna.cmu.edu/sites/default/files/chat_screens/129002_1392337857.png
  1071. [18:31:00] <jnicol> JohnDoe line
  1072. [18:31:26] <JohnDoe1> does linkbot do tricks?
  1073. [18:31:31] <jnicol> comment out lines 6 and 13
  1074. [18:31:34] <hoglahoo> not really
  1075. [18:31:51] <jnicol> by putting 2 slashes before the displayEnergy
  1076. [18:31:55] <hoglahoo> // comment out like this?
  1077. [18:32:01] <jnicol> correct
  1078. [18:32:17] <firedrake969> So what does the code do?
  1079. [18:32:37] <jnicol> In this last version of the code, I have put the while loop that displays the energy into its own function, displayEnergy
  1080. [18:32:46] <jnicol> This way, we are able to make one call from the main program to display the energy of all combinations for any type of loop; hairpins, 1-1, 1-2, 2-2
  1081. [18:32:52] <hoglahoo> say when, for eval
  1082. [18:33:05] <jnicol> Lines 6 and 13 have been commented out, but can easily be uncommented to show the tetraloop energies of all GC and AU closing pairs.
  1083. [18:33:14] <jnicol> not yet :)
  1084. [18:33:43] <jnicol> Line 15 through 20 demonstrate the energies of a 1-1 loop.
  1085. [18:34:00] <jnicol> ok click evealuate
  1086. [18:34:11] <jnicol> or however its spelled
  1087. [18:34:34] <hoglahoo> that went a little more quickly, yay.
  1088. [18:35:21] <jnicol> Notice that some results show misfolds, but looking deeper, we see that the misfolds are caused by valid pairs across from each other.
  1089. [18:35:33] <jnicol> in the 1-1 loop
  1090. [18:36:00] <firedrake969> Yeah
  1091. [18:36:24] <Eli-Fisker> Ah
  1092. [18:36:32] <TomoeUzumaki> hello
  1093. [18:36:37] <jnicol> uncomment the other lines to see the GC closing pair and AU closing pair energies for all those tetraloops
  1094. [18:36:59] <Eli-Fisker> http://prntscr.com/2s9i7k
  1095. [18:37:06] <jnicol> that is how you can you scripting to generate energy charts
  1096. [18:37:20] <LFP6> Hey everyone
  1097. [18:37:35] <firedrake969> hi LF
  1098. [18:37:42] <hoglahoo> thanks jnicol
  1099. [18:37:42] <Eli-Fisker> John, how do I uncomment the other lines?
  1100. [18:37:45] <jnicol> thank you eli, thats the correct results for the 1-1 loops that are closed by AU pairs
  1101. [18:38:02] <jnicol> delete the 2 slahes before them
  1102. [18:38:21] <jnicol> I know this class was a little more intense, but I thank everyone that followed along, and I hope you are now confident enough to try to generate other loop energies!
  1103. [18:38:27] <firedrake969> How long is it supposed to take? :P
  1104. [18:38:53] <jnicol> well i commented the code so that just 1 at a time should be run
  1105. [18:39:15] <jnicol> running all 3 will take around 30 seconds
  1106. [18:39:24] <jnicol> for hog, 5 minutes
  1107. [18:39:24] <LFP6> Hi Drake, Eli, Hog, Jnicol
  1108. [18:39:30] <LFP6> :)
  1109. [18:39:32] <firedrake969> hi LF
  1110. [18:39:32] <Eli-Fisker> Hi LFP
  1111. [18:39:33] <jnicol> hi LFP6
  1112. [18:39:39] <LFP6> How long until class is over?
  1113. [18:39:44] <firedrake969> I thinnk it's done
  1114. [18:39:45] <jnicol> Congratulations to all that have graduated the Energy Chart class :) We should have badges made for this.
  1115. [18:39:51] <jnicol> done!
  1116. [18:39:53] <firedrake969> Did anyone save a transcript?
  1117. [18:39:54] <Eli-Fisker> :)
  1118. [18:40:00] <firedrake969> That'd be hog's job :P
  1119. [18:40:12] <mat747> John - thanks
  1120. [18:40:27] <Eli-Fisker> Thx for the class
  1121. [18:40:27] <firedrake969> Thanks, jnicol!
  1122. [18:40:27] <LFP6> Hey Mat
  1123. [18:40:28] <hoglahoo> I have one if nobody else does, but the format is goofy
  1124. [18:40:32] <jnicol> thanks to all for helping me with the technical problems :)
  1125. [18:40:52] <Eli-Fisker> I have one too
  1126. [18:40:59] <LFP6> Question: What is the next step for EternaU now that we got the devs' green light?
  1127. [18:41:41] <firedrake969> have someone get a dev package and try implementing it
  1128. [18:41:47] <mat747> Hi LFP
  1129. [18:41:59] <firedrake969> @Eli--could you upload it to Google Docs and give me a link?
  1130. [18:42:33] <Eli-Fisker> I need to edit it a bit down first
  1131. [18:42:37] <firedrake969> Sure
  1132. [18:42:44] <mat747> lfp - what green light
  1133. [18:42:46] <firedrake969> Can you do the raw chatlog first?
  1134. [18:43:15] <Eli-Fisker> I will upload it in the WIKI when I got it stiched together
  1135. [18:43:19] <firedrake969> Ok
Advertisement
Add Comment
Please, Sign In to add comment
Advertisement
Public Pastes
Advertisement
We use cookies for various purposes including analytics. By continuing to use Pastebin, you agree to our use of cookies as described in the Cookies Policy.  OK, I Understand
Not a member of Pastebin yet?
Sign Up, it unlocks many cool features!