SHARE
TWEET

Sequence 2

a guest Oct 14th, 2012 58 Never
Not a member of Pastebin yet? Sign Up, it unlocks many cool features!
  1. GCCGTGTAAAATCGATGAATAAACTGAGTTGCGTTAGCTTCTTTGCTCCCCGCCTGTGACCCTAGTCGGGAGGCCGAGCCACATGTCAGCGGACGCAAATACTACTCACCAGACGGGGTATAAGTACTGTGCAACATTGAACACCTTCGCCTCAAGCTGCACTCAGGAGTGTAGTGAGGATATTCCCTCTGGGCCCGCGAAGACAAAGGCATCCACTTCCGGACTGCATTACGTAGGAAGGTACAACCGGTTGGAGCAGATACCCTCGTAGCAAGTTCATGCGCAATGTCGTCGCATATGTATTCGTGAAACCCGATTGACTAGAGTATTTGTTACTCGTATGATAAAACCTCCCCATCCGCCTAGAAAATTGTTGACCTGCCATGGTTCTAAGATATACCGCCCCAACTGCTTATCACTAGCGAATGATCTCCACAGCTCGGGAATGTAAGGATCGTTTACGTTGTCCACCTATAGCCGCCGGTAGAATTAGTGGGTGTTGTGCTATCCCGCGCTTGTAGCCTCCTCGACCCGTGGAAGCGTCTCCGCACAACCCGGTTCAGCGCACCCTATTAACCTAGAAACCGTTCCGGGCTGTTCAGTCATTGCGAGGGCTTGAAGGGGAGACATCTTACTACGCCATCCTGCTCCAAGAACCACAGTTTTAAGAGCGGTCTTCATCCTCATTATTTCGGTGCCCGGAGTTCATCTTGCTAAAACAGTCTCACTACCAGACCCGCTCCATTCCTTATGTGGCCACCACTCCCCCATCGTCATGTTAAGGATTCATTCTAAGGATTCATTTTGGAACGCGGCAAAGGGCTTTCGGAACCAACGATCAATGCGCACCGTAATGAGTTCAGACAGCCACATTTTCTCATAACTCTTAAGACCAAAATCTGAGAAGCTATGTGTCCCACCCCTCTTCGCGACCTGGGTGGTCCGATGGCCAGCGAAAGGTTTATGGTCACGGCTTTCAACCTTGAACAAACAACCAGGGCCACACAGGATTAATCTGGCGACGAAATAAACCGAGGCCAGAGGTACTCGGCACGTAACCGCTCGTTATCATTTAGCGCGTCCTCGGTTCTGAACCAGGTACGGGTTATGACTCCTTTTGATCCCAGGCCGAACGCTTATGAGAGAAAACGAAAGAAAAGTGATTACAATTGTCATGAGTATTAGAGCCGTGAAATCCATGCCGCTTGAATTGTGAGGGTCGGAGTATTTTTTGGGGAGAATTCGTCTCATCAGGAGGGCTACACCAATCCACTGCGCTGGAAGGACCTCGCGTTAGTAGTCAGGATCTCTGTACCTTACAAATTGTAACGACCGGCGTCCTTAATCTTCTATTATTGTAAACATATTGTTGAACGCCCTCGCACATTCGCTATTCACGCTCACATTGCGTGCACGTGTTGGCTAACCGGGCGGCTTCTGTTCATCCAGAATCCGCATACAGTGGCATAATTACCGTCTTGGGTGGGTACTACTGTGTATACCAATGAAGTTTAAGCCGCTCCGATCTGCCCCCATTGCAGAAGCCCGCAGGCAACCTTCTTCAGCAGGGATGCGCATAGATGGGCGCACTAAGAACGGCCACATCCGTGGCGAATCCGGAAGAGACTTCCCCACGGGTAGCCTCCCTATATGGACATGCTCGGCCAGACAGTGCTGCCGGACGTAAAGGCATATATCTAGATCGCCACCAGTTAATTGGATACCTACCCAGTGTTCAAGGACACATGCGCGGTAGCACTCAATTTATCGCAGACTCTTTAGGCGAACACCTGCCCCCCTCTAACGAGGTGTAACACTTTCCTTGCGGCGGTAGTATAGTTGACAGTATTCGCTAGTTTGCCACGAGCCTGTATCGCTCTCAACAATTTTTGCAAGGTAGTGACGTCAGTCGCTTTTCAGCTTGCCTAATCGGGCGTGAGTCACTGTAACTACCGTAAGCTACCACATGCCCGAACCGTTGGAGCGACAGAACGTAGATT
RAW Paste Data
Pastebin PRO Summer Special!
Get 40% OFF on Pastebin PRO accounts!
Top