0	  Midland  Hub  for  Trials  Methodology  Research,  Institute  of  Cancer  and  Genomic  Sciences,  Universityof   Birmingham,  United  Kingdomb Department  of  Medicine,  Royal  Marsden  Hospital,  London  SW3   6JJ,  United  Kingdomc Institute  of  Applied  Health  Research,  University  of  Birmingham,  United  Kingdomd Research  Institute  for  Primary  Care  and  Health  Sciences,  Keele  University,  United  Kingdome Department  of  Histopathology,  Royal  Brompton  and  Harefield
1	 assess
2
3	  transcript:5(cid:3)TCGTCTCCCGGGTGACTG3(cid:3)and5(cid:3)TTCTCTTGATGCGGCGATGAG  3Intron-spanning  primers Reference  gene(s) ␤-Actin ␤-Actin ␤-Actin ␤-Actin  and
4	  funding  to  theRoyal  Marsden  Hospital  NIHR-Biomedical  Research  Centre;  Thiswork  was  funded  by  the
5	  repair  by
6	  isoform  expression  and
7	  and
8	 mutations(typically D816V) that are present in virtually all adults(93%) with indolent and aggressive forms of systemicmastocytosis82e84; a
9	 inhibitor therapy inchildren with acute lymphoblastic leukemia and
10	 copy number GAIN (copy numberratio 25);
11	 and
12	 and
13	 and
14	 in a transgenic mouse model results in rapid devel-opment of NSCLC, confirming oncogenicity of this driver mutation∗ Corresponding author at: 263 Farmington Avenue, Farmington,
15	 pathway in NSCLCThe human epidermal growth factor receptor 2 (HER2 or
16	 receptor lacks a known ligand,being activated by homodimerization or heterodimerization withthe other
17	 mutations are usuallymutually exclusive with EGFR, KRAS, and
18	 concentrationswith IHC and FISH used to assess tissue
19	 mutations, there was no difference in overall survivalbetween these patients compared to those with
20	 dual ISH
21	kinase domain mutation results in constitutive phosphorylation and activationof HER2 and
22	   activating   mutation,and   we   compared   these   patients   to  70   patients   who   were   pan   negative   (no   detectable   mutation   bythe   SNaPshot   assay   and
23	  muta-tions  occur  with  increased  frequency  in  patients  that  have  neversmoked;
24	  mutations  have  demonstrated  better  overallsurvival  (OS)  than  patients  with
25	  in  patients  without
26	  inpatients  with
27	  (D)  in
28	  (F)  in
29	 Sex   (W  vs  M)  Smoking  (Y  vs  N)
30	  mutations  wereassociated  with  both  decreased  PFS  and
31	  mutations  had  a  worseprognosis  in  terms  of  PFS  and
32	  or  response  to  chemotherapywhen  comparing  patients  with
33	  and
34	  and
35	  wild-typenon-small  cell  lung  cancer  segregated  according  to
36	 mutation status,
37	 mutation status(60 patients with available data),
38	 trended to be associated with longer
39	 (positive
40	 ¼ hazard ratio; IQR ¼interquartile range; LDH ¼ lactate dehydrogenase; NLR ¼ neutrophil to lymphocyte ratio;
41	 ¼ hazard ratio;IHC ¼ immunohistochemistry; NFA ¼ nonesmall-celllung cancer favor adenocarcinoma;NLR ¼ neutrophil to lymphocyte ratio;
42	 trended to be associated withlonger
43	 wasreported to be associated with the absence of
44	 and
45	 couldnot fully restore the malignant phenotypes induced by
46	 and
47	 was positively correlatedwith the progression of breast cancer and promoted the tumorigenesisindependent of
48	 shared high structural and functional homologies with
49	 has been reported to regulate
50	 and
51	 and
52	 and phosphorylated
53
54	 rearrangement, patients with
55	 rearrangement waspreviously assessed by Vysis ALK Break Apart FISH Probe Kit (Abbott Molecular, Abbot Park, IL, USA) and
56	/
57	/
58	 and
59	 IHC and FISHhave been also tested which suggested that ROS1 IHC is highly sensi-tive, but less specific compared with
60	 and
61	 and
62	 break-apart probe and gold/aqua color com-bination for
63	 and
64	 and
65	 and
66	 and
67	 and
68	 and
69	 and
70	/
71	 and
72	 mutations and
73	, epidermal growth factor receptor gene;
74	 mutations and
75	  and
76	 by miR-9600 remarkably inhibited protein expression of cyclin E, cyclin D1, phosphorylated-Rb (p-Rb), and
77	 were suppressed by the overexpression of miR-9600 and downregulation of
78	 was amplified from human genomic
79	 and
80	 kinase domain mediate
81	 maintains self-renewal and tumorigenic potential of glioblastoma stem cells by activating
82	 activates
83	 following standard anthracycline/cytarabineebasedImportantly,remission induction alone is not sufficient for long-termdisease controlIn a recent EuropeanGroup for Blood and Marrow Transplantation analysis ofpatients with AML relapse after reduced-intensity condi-tioning Allo
84	 after first-line cytoreductive therapy for relapsed AML afterAlloSCT demonstrated improved
85	 (gemtuzumab ozoga-micin), CD25 (denileukin diftitox), and
86	 andEBUS on Outcomespatients who did not undergo PET,
87	 mutations who were treated at ShizuokaCancer Center, where patients experienced
88	-guided biopsy Echo-guided needle biopsyAbbreviations: CT ¼ computed tomography; EBUS-TBNA ¼ endobronchial ultrasound-guided transbronchial needle aspiration;
89	mples were frozen within 30 minutes of sampling and storedat
90	-TKI treatmentbefore rebiopsy, mo(range)TKI-free interval,d (range)TKI treatmenthistory immediatelybefore rebiopsyYesNoPrevious EGFR-TKItreatment (total)GefitinibErlotinibOthersBeyond-
91	 ¼ epidermal growth factor receptor;
92	G BR1925RADIANT26ADJUVANT27MAGRIT28Abbreviations: CI ¼ confidence interval; CT ¼ chemotherapy; DFS ¼ disease-free survival; ECOG ¼ Eastern Cooperative Oncology Group;
93	 repair by
94	 is better than
95	 can recognize and combine with
96	 mutations and
97	 and
98	 tests included theAmplification Refractory Mutation System (ARMS) and direct sequen-cing, and
99	 = anaplastic lymphoma kinase; CI = confidence interval; ECOG = Eastern Cooperative Oncology Group;
100	 and
101	 mutations between Caucasian andAfrican-American individuals,
102	 after
103	 mutation maycontribute to de novo resistance by enhancing EGFR-
104	 domains into the opened form, making it easierto heterodimerize with
105	 and
106	 and
107	 mutant lung cancer cell lines iden-tifies spectrum of
108	  and
109	  breakpoint locus  with  red  and  green  fl uorescent
110	  and
111	 (cfDNA) or liquid including 31·6%
112	  or  amplifi cation  of
113	 and
114	 and
115	 and
116	 and
117	 and
118	 secondary mutation and
119	 in non-small cell lung cancer is associatedwith Hedgehog signalling pathwayYe Gua,b,1, Xiaojuan Peia,b,c,1, Yansong Rena,b,1, Kaican Caid,1, Kang Guoa,b, Jiaye Chena,b,Weizhao Qina,b, Mingdao Lina,b, Qian Wanga,b, Na Tange, Zhiqiang Chenge, Yanqing Dinga,b,Jie Lina,b,⁎a Department of Pathology, Nanfang Hospital & School of Basic Medicine, Southern Medical University, 1838 Guangzhou Avenue, Guangzhou 510515,
120	 and
121	 polyacryla-mide gel, transferred onto PVDF (polyvinylidene fluoride) membranes(Immobilon P; Millipore, MA), and blotted according to standardmethods(1:500,#SAB55022, Sigma Aldrich); vimentin (1:500, #V6630, SigmaAldrich); β-actin (1:5000, #a5441, Sigma Aldrich);
122	 (1:500, #2428, Cell Signalling, MA);and
123	 (#3538, Cell Signalling,MA), and
124	 were observed in H322-
125	 and
126	 expression was mainly localized to thecytoplasm while
127	 in A549 cells led toincreased
128	 [35], alsodid not show evident change in
129	 silenced A549 cells results in increased
130	 relative to
131	 expression in
132	 mutation showed higher
133	 mutations are frequentlydetected in CRC and sporadic PTC [52,53], in which elevated
134	 is not commonly mutated inprostate cancer, breast cancer, and ovarian cancer [54,55], in whichdown-regulation of
135	 in carcinogenesis may be associatedwith context- or tissue-specific molecular profiles, such as the muta-tional status of the
136	 receptorson another transmembrane protein, Smoothened (SMO),therebytriggering a cascade that leads to the activation of
137	 andHip1, are also targeted by the
138	 expression in
139	 interacts with
140	 co-immunoprecipitates with
141	 antibody orcontrol IgG and detected with
142	 in the cytoplasm and presence of
143	 in A549 cells leads to increased
144	 expression level related with
145	 and
146	 and
147	 in A549 cells leads to increased
148	 in thecytoplasm has been observed in ovarian cancer cells and CRC cellsbefore [18,45], it is possible for TUSC3 to interact with
149	 promotescolorectal cancer progression and epithelial-mesenchymal transition (EMT) throughWNT/beta-catenin and
150	 and
151	 and
152	 damage andprotective autophagy mediated by
153	   biosensor   based   on   3Dgraphene-Ag   nanoparticles   for   sensitive   detection   of   CYFRA21-1   innon-small   cell   lung   cancerMei   Chen a,1,   Yuanyuan   Wang a,1,   Huilan   Su b,   Li   Mao b,   Xinni   Jiang a,   Tao   Zhang a,∗,Xiaozhen   Dai a,∗a Department  of  Biomedical  Sciences,  Chengdu  Medical  College,  Chengdu,  Sichuan  610500,
154	   solutionically  adsorbed
155	  is  a  phenothiazine  dye  that  iswell-known  to  be  used  as  indicator  in  the  development  of  an  elec-trochemical
156	 ¼ Asian/Pacific Islander;American/Alaskan native;
157	 was able to activate Wnt/b-catenin signaling, and that depletion of TCF4or
158	 in A549 and Calu-3 cellsmarkedly induced transcription of Wnt/b-catenin downstreamincluding Axin2, DKK1, MMP7,
159	 or
160	 and
161	 ¼ anaplastic lymphoma kinase; ECOG ¼ Eastern Cooperative OncologyGroup;
162	 driver mutations had an
163	 mutation had an
164	 trans-location or
165	 ¼ hazard ratio; IC ¼ tumor-infiltrating immune cells; ITT ¼ intention-to-treat; NE ¼ not estimable;
166
167	 (clone 1B6, Leica)
168	  or
169	  in  the
170	 and the firstexon of
171	 and ROS-1 areconsidered so far standard of care, there are many other additionalactionable genetic aberrations such as MET, HER2,
172	: epidermal growth factor receptor; wt: wildtype; DoR:duration of response; vs: versus; PFS: progression free survival;
173	 and
174	 ex14 skipping NSCLC (42% PD-L1 positive) with a RR of16% and median PFS and
175
176	 mu-tations and
177	 and
178	 and
179	   (46%)   and
180	   mutations   were   significantly   associated   with   ade-nocarcinoma,   female   gender   and   never/light-smoking   history;
181	   muta-tions  were   most   prevalent   in   current   smokers   and  ERBB2,   ERBB4,   PIK3CA,   NRAS,   NOTCH1,   FBWX7,   PTENand
182	   mutations   but   a  lower   frequency   of
183	   mutations   occurred   frequently   with   other   gene   mutations,   most   commonly   with   KRAS,   MET,EGFR  and
184	  or
185	   amplificationor
186	  was  the  most  frequently  mutatedgene,  followed  by
187	  and
188	  mutations(codon  12/13)  were  seen  together  with  many  other  gene  muta-tions  and  also  with
189	  Gly13Cys;  EGFRLeu858Arg,  Ala871Thr  and  Gly735Ser;
190	   Asn375Ser  in  four  cases,  andGly719Ala  with
191	  mutations  (Ser605Asn  or  Gly466Val)  alsoharbored  activating
192	  and
193	  mutations  were  detected  in  33%  of
194	  and  one  21  bp  in-framedeletion  in
195	  and
196	  and
197
198
199
200
201
202	  mutations  and
203	  and
204	  and
205	  and
206	  mutations  wereseen  together  with  KRAS,  and  five  with
207	  +
208	  and
209	  and
210	  and
211	   and
212	  and
213	  [42–44]  and
214	  are  seen  more  fre-quently,  and  those  in
215	  were  the  most  frequent  (46%)  and  theytended  to  occur  along  with
216	  and
217
218	 as a Direct Target of miR-34cThe transmembrane receptor tyrosine kinase, AXL, is a target ofmiR-34a36,37 that has been recently shown to play a key role in ac-quired resistance to
219	 with EGFR inhibi-tors, although effective for most patients, is hampered by occurrenceresistant clones due to de novo or increased expression of alternativeRTKs, including
220	 levels induce acquired resistanceto treatment with
221	 and
222	 and
223	  or
224	  or
225	 or
226	 and
227	 mutations,9 cell lines with
228	 and
229	 or
230	 or
231	 mutant,
232	 mutant cell lines were higher than for
233	 mutant cell lines were higheron PC2 compared to the other two groups, while on PC3 only
234	 mutant or
235	 score distributions for control,
236	 unveiled proteins contributing to proteome diversity andfurther revealed distribution differences for NSCLC cell line groups, thistype of analysis does not identify protein expression differences specificfor genomic aberrations such as oncogenic
237	 orthe
238	 or
239	 mutant cell lines, and in case of
240	 mutant (A) or
241	 and
242	 gene as well as KRAS, hepatocytegrowth factor receptor (MET ),
243	 and
244	 and
245	 and Retino-blastoma 1 (RB1) are a pre-requisite in its development withfurther associations with
246	 or activation of bypass signalling pathways includingEGFR,
247	 gene (chromosome 6q) also encodes an RTK within theinsulin receptor subfamily and shares many similarities to
248	 mutations are common inNSCLC and are widely accepted to be mutually exclusive withEGFR mutations and
249	 aberrations in Caucasian NSCLC patients the detection ofa
250	 and
251	 or
252	 and
253	 +/–
254	 damage and considering the frequency of functional loss ordysregulation of key DNA damage response (
255	 double strand breaks (DSBs) initiallydetected by damage sensing proteins such as MRN (MRE11-RAD50-NSB1) or
256	 isthe primary responder to DSBs whilst
257	 inhibitorsto early phase clinical evaluation as a mono- and combinationtherapy with
258	 and total
259	 inhibition may prevent replication and increasebreaks at fragile sites in the
260	 and
261	 Damage Sensing by the
262	 and
263	 for cell cycle, whichresults in activation of CDK2/CyclinE and Rb phosphorylation topromote
264	 and
265	 and
266	 and
267	 and
268	 translating in activity in ALK G1202R, while lack ofactivity in the corresponding
269	 and
270	 fusion partners in NSCLC (see next chapter), fromthe firstly described and most common
271	 and
272	 and
273	 FISH interpretation in NSCLCare identical to those created for
274	 rearrangement and the possi-bility of using transcript-based methods in a single-tube assay todetect several oncogenic fusions in ALK, RET, ROS1 and
275	 testing into a practical algorithmIn light of the availability of specific inhibitors, ROS1 rearrange-ment should be tested simultaneously with
276	 rearrangement is generally mutually exclusive with othergenetic alterations in NSCLC, but a subset may concurrently harborEGFR,
277	 mutations and in line withALK rearrangements,
278	 fusion with a
279	 active site and S1986Y/F substitutionsappear to induce crizotinib resistance by both preventing its accessto the enzyme active site and by increasing kinase activity, the lat-ter event reported for the corresponding
280	 mutationsresponsible forresistance to crizotinib (G2032, D2033 andS1986) can be object of nucleotide substitutions in
281	 mutant forms have been robustly docu-mented [90,91], allowing to adopt it for
282	 and Q61K
283
284
285	,
286	 and
287	 and
288	 or NTRKfusions, as well as increased
289	 inhibitor demonstratingclinical efficacy in phase II trials [116], inhibits native
290	 inhibitorTAE684 showed synergy with gefitinib when the resistance tothe first compound was driven by
291	 G595R and
292	 G1202R, its pre-clinical inefficacy against
293	 as a ‘‘druggable” receptor tyrosine kinase:lessons learned from inhibiting the
294	 and
295	 and
296	 and
297	 and
298	 mutationor
299	 family members confers resistance to
300	 in parentalNSCLC cells, including H292 (EGFR wild-type), H1993 (
301
302	 andmiR-449a loss might be closely related to
303	 amplification(H1993-Gef) and
304	 loss contributes to erlotinibresistance in
305	 methyltransferase 1 by EBV latent membrane protein 2A leadsto promoter hypermethylation of
306	 detection, recurrence, DFS, and
307	 mapping technology, true pN0 patientsmay be spared a complete
308	 and DFS for pN0 patients inboth the
309	 staging in patients with NSCLC andshowed that patients with pathologically negative SLNshave a statistically significant lower recurrence rate andimproved
310	 versus MLNS alone because allpatients underwent MLNS or a formal
311
312	 is indicativeof more advanced disease and advocates for a change toa neoadjuvant approach or a possible change in surgicalresection with a subsequent radical
313	 and
314	 and in G2/M phase checkpointalthough its role in the
315	-siRNA formula-tion using different weight combination of mixture of EGFR-targeted CS and
316	  protein  (EGFR-TKIs)  for  patients  har-boring  mutations  in  the  EGFR  gene,  and  anaplastic  lymphomakinase  (
317	  at  2  years  in  patientstreated  with  an  EGFR–TKI  (96%  versus  90%,
318	  mutation  status  wasdetermined  in  350  patients  and  its  presence  was  not  found  to  be  asignificant  prognostic  factor  for  either  DFS  or
319	  tumor  expression  and
320	 monoclonal antibody therapyFor  metastatic  NSCLC,  a  phase  III  trial  of  cisplatin/vinorelbinealone  or  with  cetuximab  has  demonstrated  a  statistically  significantlonger
321	 and/or hypermetabolicon
322	 Z computed tomography; EBUS Z endobronchialultrasound; NSCLC Z non-small cell lung cancer; IMRT Z intensitymodulated radiation therapy;
323	 and
324	 GCA CA-3′ and reverse,5′-AAC GCT TCA
325	 and
326	 and
327	 and
328	 expression and then induced the expression of their down-stream pathway protein Caspase-3, BCL-2,
329	 and
330	 and (A)
331	 3′-UTR, mutant PTEN 3′-UTR, (B)
332	 is also an important
333	 and
334	 and
335	 and
336	 and
337	 for
338	 (adjusted
339	 (clone: RPA-T4)labeled with
340	 (+) or PD-1+ cells in whole gated
341	 (+), ROR-yt (+) or FoxP3 (+) cells in whole gated
342	 and
343	 and
344
345	 such as L858R or delL747-S752 have beennoted to confer enhanced advantages to
346	 can also activate the PI3K pathway bybinding to hepatocyte growth factor (
347	 L1196M,
348	 resistance mutation (T790M),Brigatinib and other second generation
349	 amplification,
350	 amplification,
351
352	 (by ATO) and
353	 tyrosine kinase inhibitorsgefitinib/erlotinib and to
354	 amplification leads to gefitinib resistance in lung cancerby activating
355	 of the chest and upper abdomen, and
356	 or
357	 ¼ pulmonaryartery;
358	 and
359	 and
360	   expression   in   patientswith   advanced   non-small-cell   lung   cancerAnna   Li a,b,1,   Fei-Yu   Niu a,b,1,   Jie-Fei   Han a,b,   Na-Na   Lou a,b,  Jin-Ji   Yang b,   Xu-Chao   Zhang b,Qing  Zhou b,   Zhi   Xie b,   Jian   Su b,   Ning   Zhao a,b,   Ying   Huang b,   Yi-Long   Wu b,∗a Southern  Medical  University,  Guangzhou,
361	   expression   was   analyzed   in158   patients   who   were   negative   for  the  common   driver   genes,   including   EGFR,   ALK,
362	  resistance  by  combininga
363	   amplification  is  rare,  MET   IHC  acts  as  the  mostrobust  predictor  of
364	   expression  was  analyzed  of  158patients  who   were  negative  for  the  common  driver  genes,  includ-ing  EGFR,  ALK,
365	   immunohistochemistryMET   protein  expression  was  evaluated  by  immunohistochem-istry  (IHC)  using  a  CONFIRM  anti-total  c-MET  rabbit  monoclonalprimary  antibody  (SP44,  Ventana  Medical  Systems,  Tucson,  AZ,USA,  #7904430)  and  an  ultraView  Universal
366	   +  P
367	  and
368
369	  in  patients  with  or  without  the
370	  between  the  wild-type
371	   targeting  enhancedthe  effects  of  irradiation  and  chemical  agents  against  malignantcolon  cells  harboring  a
372	   amplification  leads  togefitinib  resistance  in  lung  cancer  by  activating
373	   expression  plays  differing  roles  innon-small-cell  lung  cancer  patients  with  or  without
374	 (ab9485, rabbit polyclonal,Abcam), phos-MEK, MEK, phos-
375	 pathway, we examined the expression and phosphory-lation levels of the MAPK signaling molecules MEK,
376	 conjunct
377	 or
378	 and
379	 and possible
380	 stratified by
381	 or
382	 exposure, could promote PDL-1independent tumor resistance, associated
383	 and
384	 and
385	 mutations and
386	 and
387	 and
388	 and
389	 and
390	–TKIs is very complex andincludes, among others, EGFR secondary mutations, such as T790Mmutation [4,5],
391	 upon gefitinib treatmentAccumulating evidence indicates that the
392	 and
393	 or
394	 improved on
395	 and
396	 and
397	 [13], MALAT-1 [14],BCAR4 [15], lncRNA 00511 [16], PDIA3P [17], and
398	 through regulation of
399	 and
400	 and
401	 and lncRNA
402	 30UTR, SNAIL 30 UTR,
403	 or lncRNA
404	 inhibits
405	 can inhibit the expressionof
406	 and
407	 may contribute importantly to tumor metastasis andmay be related to
408	 inhibits the expression of miR-367 and miR-141by acting as a miRNA spongeTo understand the machanisms by which lncRNA XIST affectsthe expression of
409	 and
410	 enriched by
411	 30-UTR (position of 858e864)wild type construct, but did not significantly in cells transfectedwith the SNAIL 30-UTR (position of 443e449) or
412	 transcriptwhich has a full length of 19280 bp (left panel), and on the
413	 to detect the lncRNA
414	 30-UTR, and the predicted miR-367 binding sites of SNAIL and
415	 inhibits the expression of
416	 wassignificantly downregulated in cells in which lncRNA
417	 may influence TGF-b-induced EMT by upregulating the expression of
418	 on TGF-b-induced EMT may depend, to some extent,on the expression of
419	 and
420	 downregulated the
421	 and eachof the miR-367 and miR-141, which supports a role for lncRNA XISTin EMT induction by regulation of miR-367/miR-141-
422	 is not the onlyregulator of
423	 acts as an oncogene inlung cancer by epigenetically repressing
424	 family members, TNFAIP8 or TIPE1, weredescribed as an oncogene in human cancers, such as breast cancer,lung cancer and
425	 and disease-freesurvival (DFS) based on NRI and
426
427	 hasbeen reported to play an essential role in the cellular response togenotoxic stress-induced
428	 expression and
429	 repair factors,
430	 and
431	 overexpression in radiation-resistantlung carcinoma cells activates
432	 knockdown induces cell cycle arrest or apoptosis depending on the
433	 damage-responsive signalinduced by
434	 knockout shifted the phenotypes ofA549 cells induced by
435	 or
436	 knockout not only promotesthe ALKBH3knockdown-induced
437	 gene status is a critical factor for the phenotypicoutcome of
438	 gene status affected the phenotypes induced by
439	 gene status affects the phenotypesassociated with
440	 status may beassociated with the phenotypes induced by
441	 knockdown induced
442	 knockdown promoted
443	 gene is a critical determinantfor the phenotypes induced by
444	 knockdown in A549 cells withwild-type
445	 and
446	 and apoptosis are induced by
447	 as the difference in area underthe
448	  UTOX þ
449	 and U
450	 and
451	 and
452	 separation was performed on an Agilent DB-5
453	 increased the phosphorylation of
454	 signaling mediated by
455	 inhibitor MK2206impaired
456	 significantlyincreased
457	 activated
458	 promoted lung cancer formation (15staining ofImmunohistochemicalformalin-fixed paraffin-embedded metastatic tumors confirmed the expression of phos-phorylated
459	 activated
460	 increased
461	 antibody(eBioscience, San Diego, CA) and PE-conjugated
462	 activator; hBVR is an ERK nuclear transporter and is requiredfor
463	 mutations and
464	 mutations and
465	 mutations but more effective inpatients with
466	  and
467	  and
468	  +−K-RAS
469	  and
470	 for both arms was therefore assumed tomatch the OS observed in the non-squamous NSCLC patientsenrolled into the
471	 data, wemodeled OS based on data from a larger phase III trial investigatingthe role of pemetrexed
472
473
474	  mutation  and  5%  an
475	  was   extracted  from  areas  of  fresh  formalin-fixed,paraffin-embedded  tumor  sections  using  a  QIAmp  DNA  minikit  (Qiagen,  Hilden,  Germany)  and  analyzed  for
476	  are  more  likely  Asian,  females  [19],never  smokers  and  with  an  adenocarcinoma  subtype  of  tumor  [20],whereas
477	  and
478
479	 strongly correlated with the progressive phenotypes of NSCLCs and
480
481	 to RASSF6 contains Ras-association (RA) domain inthe C-terminus (C-terminal RASSF), whereas
482	 expres-sion was frequently observed in NSCLCs, which correlates withlymph node metastasis, pleural invasion,
483	 (Hs00415584 m1) and
484	 expression wasnormalized with an internal control,
485	 expression group showed a significantly worse prognosis in
486	 significantly associated withinvasive/metastatic character, non-adenocarcinoma histology,and
487	 expres-sion was significantly infrequent in the tumors with
488	 expression and
489	 expression was found tobe independently associated with non-adenocarcinoma histology,lymph node metastasis, pleural invasion and wild-type
490	 expression group was significantly associated withworse prognosis in
491	 expression with diseaseprogression and
492	 expression andKRAS mutation or
493	 hypermethylation not a main cause of
494	 expression group also showed a correlation withwild-type
495	 and
496	 and
497	 andNORE1: identification and cloning of two human homologues of the putativetumor suppressor gene
498	 was down-regulated using small-hairpin RNA against target sequence  (5′-CAGCGACACTAGAGGGACA-3′) located 151 bp downstream of
499	 after down-regulation of
500	 and increases p53 degradation,20 sug-gesting an opposite function of
501
502	 mucin interacts with and stabilizes the
503	  activates
504	 (serum amyloid A1)[19–21] and
505	 and
506	 TKdomain was evaluated in tumor-derived
507
508	 pathway, and additionalSNPs should be analyzed, including
509
510	 pathway predict efficacy of cetuximab in wild-type
511	 and breast cancer risk among
512	 methylation and oncogen-ic potential of
513	 gene is associated with exon skipping in a
514	 and
515	 is known to be involved in both
516	 and
517	/
518	 and
519	 and cisplatin sensitivitySimilar to the
520	 through
521	 and
522	 and
523	 family associated with cisplatin sensitivity iscurrently lacking, butfurther investigation is warranted,especially with regard to the
524	 and
525	 repair by
526	 A313Gand
527	 and
528	  regulates  cancer  cell  motility  byantagonising  inhibition  of
529	  andNotch  signalling  identifies  a  key  role  for
530	 for
531	 for
532	 for
533	 and
534	 was also down-regulated both in SCC and in AC tissue; and
535	 and
536	 and
537	 and
538	 (B); miR-21-5p targeted
539	 expression reverses A549 cell-growth inhibition induced by
540	 is the substrate of
541	 re-expression inglioblastoma inhibits migration through attenuation of non-canonical
542	 mitigatesmultidrug resistance by inhibiting
543	 can interact with
544	 mutations, resulting abnormal
545	 enhanced the catalytic activity of
546	 and
547	 (si-TINCR#1, si-TINCR#2 and si-TINCR#3) and
548	 interacts with
549	 was enriched in the pulldown with
550	 activates
551	 kinase activity assayshowed that
552	 did notaffect the stability of
553	 interacts with
554	 and
555	 and qPCR was used to identify
556	 enrichment in 95D cells transfected with full-length (FL) or different Flag-tagged
557	 pulled down with sense-, anti-sense probes or differenttruncated forms of
558	 on
559
560	 influencedMAPK pathway, we next investigated several genes associated withcancer cell growth and invasion, such as CCND1,
561	 and
562	 acts through
563	 as an activator of
564	 proteins are located downstream ofmembrane-bound RAS, a small G protein and acts as a core kinasein
565	 domain can be regarded asBRAF-specific region (
566	 and
567	 proto-oncogenes are critically involved in humancancer and a wide range of human tumors displays high fre-quencies of
568	 by releasing the inhibition by the N-terminal region lead-ing to increased
569	 interactswith
570	 leading to aberrantly activated
571	 forces
572	 accelerates
573	 promoter mutations and diverse activating mu-tations in the
574	 protein kinases in
575	 and
576	 or
577	 is activated byATG7 and conjugated to
578	 mutations still account for thevast majority of patients while a minority contain either KRASor
579	 and
580	 (E) that are fusedto
581	 translocated NSCLC,
582	 and KIF5B, and both were identified as an
583	 translocated to the exon in
584
585	 and
586	 exerted its oncogenic functions in NSCLC throughmiR-339-5p-mediated regulation of
587	 exerted its oncogenic effects in NSCLCvia miR-339-5p-mediated
588	 served as an endogenouscontrol to normalize LIN01510 and
589	 and
590	 expression and miR-339-5p or
591	 positively regulates
592	 positively regulates
593	 knockdown remarkably suppressed
594	 expression was inversely cor-related with miR-339-5p expression in NSCLC tissues; whereasLINC01510 expression was positively correlated with
595	 positively regulates
596	 knockdownon
597	 positively regulates
598	 positively regulated
599	 exerted its oncogenicroles in NSCLC through miR-339-5p-mediated modulation of
600	 pro-motes hepatocellular carcinoma development by
601	 andincreased
602	 and
603	 and
604	 and
605	 ¼ hazard ratio;
606	 ¼ adenocarcinoma; B ¼ bevacizumab;
607	 ¼ epidermal growth factor receptor; NA ¼ not applicable; NSCLC ¼ nonesmall-cell lung cancer;ORR ¼ overall response rate;
608	 as first-line treatment, the combinationtherapy demonstrated a negative effect on OS, with an
609	 data favored theanti-VEGF/VEGFR plus
610	 was observed in the first-linesetting in which the control groups in the 2 included studies wereVEGF pathway inhibitors plus
611	 compared with EGFR-TKI monotherapy or
612	 in first-line treatment comparedwith bevacizumab plus
613	 plus bevacizumab inpatients with an
614	 plus V
615
616	 FISHor IHC test results as predictive biomarkers of the PFS and
617	 benefit and the
618	 mutation is a promising biomarker of PFS and
619	 76% 24%
620	 or
621	  was  higher  in  stage  Iand  III–IV  NSCLC  with
622	  for  NSCLC  with
623	  expression  was  significantlycorrelated  with  higher
624
625	 in patients with
626	 for patients with de novo
627	 since osimertinib initiation in patients with
628	 since diagnosis in patients with
629	 G12 mutation (n = 1) and
630	 mutation (n = 1),KRAS G12 mutation (n = 1) and
631	 images, genetic profiling ofplasma ctDNA showed the acquisition of multiple new mutations, in-cluding
632	 and moderate copynumber gain of
633	 of pre-existing
634	 exon 20 alterations are in-frame insertions/duplications [1] and clustered at the loop region (Ala767-Val774)closely after the C-helix of EGFR kinase domain, which is essential forregulating the
635	 Q305X,
636	 and
637	 or
638	 vector augments inflammation in epi-thelial cells via EGFR-dependent regulation of
639	 mutation status was analyzed in archival  tumor  and/or  circulating  tumor
640	 mutation,
641	 muta-tions were treated with sorafenib; of these, five achieved
642	 mutation-positive tumors and 64% for patients with
643	 and
644	 mutations, those receiving sorafenib had significantly longer
645	, (B) PFS, (C) OS for patients with epidermal growth factor receptor (
646	  mutations,  with  an  increase  in median
647	, although the OS outcome may have  been  biased  by  poststudy  treatment  with
648	 mutations in circulating tumor
649	 ¼ mean standardized uptake value of bone marrow;
650	 showedsignificant positive correlation with serum
651	 ¼ mean standardized uptake value of bone marrow;
652	 ¼ mean standardized uptake value of bone marrow;
653	 was significantly correlated with serum
654	 ¼ mean standardized uptake value of bone marrow;
655	 level, and NLR weresignificant prognostic factors for predicting RFS and
656	 wasmore strongly associated with prognosis than the BLR, along withFDG
657	 of BM (BM SUV) waspositively correlated with serum
658	 (1:20; clone 3G3; BioLegend), CD49b(1:40; clone DX5) and
659	 (1:500); p-AKT (1:500);Bcl2 (1:1000);
660	 and
661	 and LAMP1axesHyang Sook Seol a,b,†, Yoshimitsu Akiyama c,†, Shu Shimada c, Hee Jin Lee a, Tae Im Kim b,Sung Min Chun a,b, Shree Ram Singh d,*, Se Jin Jang a,b,*a Department of Pathology, University of Ulsan College of Medicine, Asan Medical Center, Seoul 138-736, South Koreab Asan Center for Cancer Genome Discovery, University of Ulsan College of Medicine, Asan Medical Center, Seoul 138-736, South Koreac Department of Molecular Oncology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo 113-8519, Japand Basic Research Laboratory, Center for Cancer Research, National Cancer Institute, Frederick, MD 21702, USAA R T I C L
662	 and
663	 inhibitors, and 3 μM 5-aza-2′-deoxycytidine(AZA) as a
664	 (IRAK-2 sense 5′ CAGCAACGUCAAGAGCUCUAAUU 3′ anti-sense 5′ UUAGAGCUCUUGACGUUGCUGUU 3′) and
665	 inhibitor) and TSA (an
666	 and
667	 and
668	 and
669	 and
670	 and
671	 and
672	 and
673	 and
674	 and
675	 and
676	 and
677	 and
678	 and
679	 and
680	 family playsa key role in NF-κB signaling,
681	 and
682	 and
683	 and
684	 positive patients, only one has
685	 and
686	 >20/<20 9/47, ECOG-ps 0/1/220/24/12, TNM stage I/II/III 1/ 29/ 26,
687	 while the corresponding lipoproteins arerecognized  by
688	 in the extracellular fraction was examined by Western blot-ting using anti-azurin antibody and PCR using primers for
689	 with other genes in the databaseClone #Homology to known sequencesIdentity %Reference12345678910111213141516171819202122232425PAO1 sequence section 523–529Bacteriophage
690	  andother TLR-like
691	  contributed  to  such  cytotoxicitythrough activation of the
692	  dependent  and  requires  the  extrachromosomal  CpG-rich
693	 mediated by typeI
694	 (57%),
695	 imaging characteristics, Nonesmall-cell lung cancer, Progression pattern,
696	 imaging features and genetic muta-tions of NSCLC, such as those in
697	 mutation and werenegative for
698	 (n ¼ 12; 57%),
699	 for 9 patients and
700	 or
701	 fusion partner genes have been identified;(w70%),KIF5B wasfollowed by
702	 (57%) and
703	 and
704	 and
705	 molecular phenotype in non-small celllung cancer:
706	 or
707	 amplification, PIK3 catalytic-alpha (PIK3CA)mutations, phosphatase and tensin homolog loss, RAS-mitogen-activated protein kinase (MAPK) pathway activation (KRAS-mutant, BRAF-mutant, MAPK1/AKT3), fibroblast growth factor(FGF)2-FGF receptor 1 autocrine loop, EMT,
708	 inhibitor combinations, EMT:
709	 and the IGF-1 receptor, although the inhibition ofthe IGF-1 receptor is less potent than the inhibition of
710	-TKI (erlotinib) is restricted to patients unfit for other treatments (V, C)Second-Line Treatment of EGFR-Mutated Disease After an EGFR TKI treatment, osimertinib is the standard of care for patients with T790M-positive tumors (I, A) For those with T790
711	 fluorescence in situ hy-bridization (FISH)+ and immunohistochemistry (IHC)-Score ≥ 200 as predictive biomarkers for the selection ofpatients who would be most likely to derive a clinical benefit from treatment with
712	plus cetuximab compared to CT alone; the
713	 099 trial [27] compared cetuximab plus carboplatin andtaxane with
714	 FISH+ patients with squamous cell carcinoma (SCC),first-line
715	 FISH-positive and unselected histology patients, first-line
716	 for the treatment of metastatic colorectal cancer,but is not recommended for use in patients whose tumors have muta-tions in codons 12 or 13 of
717	 [41] trials, that the addi-tion of EGFR-mAbs to
718	 copy number, EGFR mutation and
719	 signal AND EGFR/CEP7High trisomyratio < 2 AND < 10% of cellsdisplaying ≥ copies of EGFRLow polysomy ≥ 40% of cells displaying ≥ 4 copiesof the EGFRHigh polysomyamplificationGeneEGFR/CEP7 ratio ≥ 2
720	 copy number assessed by FISH (positive vs negative) was notpredictive for the efficacy of
721	 mutation status (positive vsnegative) was not predictive for the efficacy of
722	 expression, as determined by IHC, could be considered a tumorbiomarker that can predict survival benefit from the addition of ce-tuximab to first-line treatment: for patients in the high EGFR expressiongroup (IHC-Score ≥ 200),
723	 expressiongroup using the Cox proportional hazards model with adjustment forselected baseline variables resulted in an
724	 expression group, a similarsensitivity analysis resulted in an
725	 was modulated by the
726	 were similar across treatment and
727	 expression group,patients with tumor EGFR mutations may also have derived a survivalbenefit for the addition of cetuximab to
728	 in the high
729	 and
730	 did notsignificantly affect median
731	 did not sig-nificantly affect
732
733	 protein expression, as assessed by IHC, addingcetuximab to
734	 gene copy number by FISH, the addition of cetux-imab to
735	 FISH+ tumors hadsignificantly shorter
736	 gene copy number detected byFISH predicted outcomes in patients with advanced-stage NSCLC re-ceiving cetuximab plus
737	 for IHC+ patientswas significantly longer in the necitumumab plus
738	 expression did not appear to benefitfrom the addition of necitumumab to
739	 copy number gain by FISHshowed a trend for a more favorable survival
740	 FISH+ pa-tients with SCC,
741	 FISH andIHC to identify specific sub-populations of patients which will benefitfrom the addition of an anti-EGFR mAb to first-line standard
742	 plus cetuximab arm and CTalone arm respectively; the 18-months
743	 expression status affects dis-ease control or survival in patients receiving cetuximab with RT, withor without
744	 of pemetrexed and aplatinum-based drug resulted in significantly longer
745	 expressionassessments, with FISH+ and H-Score ≥ 200 as predictive biomarkersfor the selection of patients who would be most likely to derive aclinical benefit from treatment with
746	 receptor inhibition radiosensitizesNSCLC cells by inducing senescence in cells sustaining
747	 and
748	 protein complex serves a crit-ical role in the regulation of mTORC1 activity, through serving as aGTPase-activating protein (GAP) for
749	 or
750	 and/oractivating
751	 complex, comprised of TSC1, TSC2, and
752	 or
753	 and
754
755
756
757
758
759	 and
760	 ¼ Not otherwise specifiedaOther G12 substitutions included G12F, G12L, G12N, G12R, G12S, and G12Y
761	 mutationalstatus was not a significant predictor of the
762	 was not significantly influenced by
763	 ¼ hazard ratio; RECIST ¼ Response Evaluation Criteria In Solid TumorsaOther G12 substitutions included G12F, G12L, G12N, G12R, G12S, and G12Y
764	 ¼ not otherwise specified;
765
766	 amino acid substitutionsand
767	 wild-type non-small-cell lung cancer segregated according to
768	 ¼ hazard ratio;
769	 ¼ hazard ratio;
770
771	 rearrangement, PS 0–1 at the initiation of PMT andPMT continuation were associated with
772	 mutation or
773	 mutation received EGFR-TKI and five patients with
774	 and 12 a
775	 mutation in NSCLC also gained much attention sinceKRAS is a downstream effector of
776	 targeting drugs such as EGFR tyrosine kinase inhibitors(TKI; erlotinib, gefitinib) and monoclonal antibodies directed againstEGFR (cetuximab, panitumumab),
777	 targeting drugs would be ineffective in control-ling tumors with constitutively activated
778	 mutation as a negative predictor of response neitherto
779	 mutation analysis by ARMS/STemplate
780	 mutation analysis by direct sequencingOne hundred nanograms of template
781	 status: A)
782	 and
783	 and
784	 and
785	 and
786	 and
787	  as  a  novel
788	 by
789	 activity and elevated
790	  is  the  direct  target  of
791	  antibodies (UBE3C-Ab) pulled down
792	  were determined  in
793	  reverses
794	  expression  by  transfecting  a  small  RNA mix (siAp, containing three small RNAs targeting different regions of AHNAK) in
795	  and
796	 downregulation, (D) protein levels of
797	 targets
798	  and
799	  by transfection  of  siAp,  chromatin  immunoprecipitation  and  PCR  (ChIP-PCR) assays were performed to confirm recruitment of p53 to the putative
800	 MANUSCRIPT ACCEPTEDACCEPTED MANUSCRIPTand
801	  negatively  correlates  with
802	  protein  levels  was determined in human NSCLC cancer tissues and their adjacent normal tissues, (B) and then their correlation with
803	 and
804	 level is frequently  upregulated,  leading  to  ubiquitination  of
805	  as  a  novel
806	 by
807	 activity and elevated
808	  is  a  new
809	 downregulation by
810	 and higher
811	 were higher in the
812	-overexpressing 95C cells or 95D cells relative to those found in A549 cells  exhibiting  lower  UBE3C  expression,  suggesting  a  negative  correlation between  UBE3C  and
813	 Abs pulled down
814	 forms a physical complex with
815	  using  an  Ab  against endogenous
816	  protein  was  lower  in
817	 protein levels  were  dramatically  decreased  in
818	  and
819	 is a direct substrate of
820	 reverses
821	 deficiency;  however,  this  was  reversed  following  downregulation  of
822	 was also reversed by
823	  downregulation  in  NSCLC  cells  increased  the  expression  of stemness  related  genes,  especially
824	  and
825	 deficiency  were  also  reversed  by
826	  targets
827	 downregulation and treatment with a p53 inhibitor increased  the  mRNA  levels  of
828	 and
829	  and
830	 knockdown improved p53 binding to these regions, whereas
831	 downregulation  derived  by
832	 negatively correlates with
833	 levels were reduced in most NSCLC cell lines, but especially in 95D, A549, and H1355 cells exhibiting high levels of
834	 and low levels of
835	  levels  and  lower
836	 was a novel substrate of
837	  and  low  levels  of
838	  as  a  binding  target  of
839	  downregulation  in NSCLC  tissue,  its  status  as  a
840	 and
841	 suppresses breast cancer invasion and metastasis by altering cell morphology and promoting
842	 regulates
843	 Variables Univariate Analysis
844	 high expression and
845	  by
846	  elevation  and
847	 11%,
848	 exon 19 points specifically to defects in the
849	 and
850	 and
851	  (months) Grade  3/4  adverse  events  (%) PD-L1  expression References Key  findingsAnti-PD-1  agentsNivoulmab Anti-PD-L1  agentsBMS-936559 MPDL3280A I I I Metastatic  cc
852	  rate  were  calculated  to  be  82  and  75%,respectively,  and  the
853	  and  IL-2  have  proven  the  principlethat  immunotherapy  can  be  extremely  effective  for  the  treatmentsof
854	 or
855	 content of the cells at different phases of cell cycle wasmonitored by flow-cytometric analysis using
856	 value of each target gene in each NSCLC cell line wasT (
857	   pathway   and   its   role   in   resistance   toEGFR
858	   TKdomain   [1–3]   and,   more   recently,   crizotinib   for   NSCLCscarrying
859	   kinase   activity   and   for   degradingthe  receptor,   respectively;   (2)   a   catalytic   region   which   con-tains  two   tyrosine   residues   (Y1234   and   Y1235)   that   modulatethe  enzyme   activity;   and   (3)   a   C-terminal   tail,   the   so-calleddocking  site   [15],  which   contains   two   other   tyrosine   residues(Y1349  and   Y1356)   capable   of   recruiting   many   intracellulareffectors,  such   as   the   p85   regulatory   subunit   of   PI3K,   Srcand
860
861	   signaling   activation   and   its   normal   functionUpon   Sema   domain–HGF   binding,   the   MET   receptordimerizes  and   phosphorylation   of   its
862	   signaling   [27],  and   it   has   beenshown  that   these   activated   signaling   pathways   may   be   sen-sitive  to
863	  inhibitors  interfere  with  HGF  binding  to
864
865	   or   HGFR   overexpression   –  usuallydue  to   transcriptional   upregulation   –   aberrant
866	/HGFR   overexpressionHigh   HGF   levels   secreted   by   both   primary   and   metastatictumors (autocrine   mechanism)   and   mesenchymal   cells(paracrine  mechanism)   have   been  ligand-dependent  mechanism   of   aberrant
867	   (transcriptional   factors   involved   intumor  invasion   program),   in   inducing
868	levels  and   HGFR   transcriptional   levels   via   hypoxia-induciblefactor-1␣  (HIF-1␣),   which   renders   the   cells   more   sensi-tive  to   HGF   stimulation   in   the   tumor   invasion   process;therefore,
869	   juxtamembrane   region,   necessaryfor  receptor   downregulation,   contains   a  tyrosine   residue(Tyr1003)  which   is   able   to   bind   to   the   c-Cbl
870	   and
871	inhibition,  and   both   of   them   are   simultaneously   present:   apoint  mutation   in   the   MET   tyrosine   kinase   domain   at   thetyrosine  residue   Y1230,   and   TGF-␣  overexpression,   a   con-dition   that   can   activate   alternative
872	   signaling   activation   can   represent   a  mechanismof   oncogene   expedience   as   a   secondary   event   owing   to   theinterference   of   other   oncogenes   (K-RAS),   pro-inflammatorycytokines,
873
874	  monoclonal  antibodiesMetMab  (onartuzumab) Bevacizumab 4-arm  phase  II  trial MetMab MetMab Platinum-basedchemotherapydoubletsPlaceboPlatinum-basedchemotherapy  doubletPlacebo Erlotinib Placebo 2-arm  phase  II  trial 2-arm  phase  III  trial MET  tyrosine  kinase  inhibitors
875	  mutationPrimary:  PFSARQ  197  +  erlotinib  in  advanced  NSCLC  patients  with  tumorsharboring
876	   was   also   observed   in
877	   tyrosine   kinase   domain   are   currentlyunder  investigation  in   phase   I–II   trials,   such   as   INC-280,
878	   small   molecule   that   inhibits   in   a   veryhighly  selective   manner   the   inactive   form   of   the
879	  1214063
880	  of  the  two  drugs,  administered  aloneor  in  combination;  antitumor  activityOpen-label,  phase  I  dose-escalation  study  to  evaluateMGCD265  administered  without  interruption  in  patientswith  advanced  tumorsPrimary:  safety  and  tolerabilitySecondary:  PK,  PD  and  clinical  responsePhase  I/II  study  combining  MGCD265  with  erlotinib  ordocetaxel  in  patients  with  advanced  tumors  and  advancedNSCLCPrimary:  safety  profile  (phase  I);  antitumor  activity  (PhaseII)Secondary:  PK,  PD  and  antitumor  activity  (Phase  I);  safetyprofile  (Phase  II)Phase  II  trial  in  patients  with  advanced  solid  (except  breastand  prostate)  tumors  and  bone  metastasesPrimary:  effect  on  bone  biomarkers,  such  as  NTx,  CTx  andothersSecondary:  rate  of  SRE;  QoL;  ORR;  correlation  betweenresponse  and
881	  (months)
882	  inhibitor-naive  NSCLC  patients[122]n Median
883	  inhibitor-naive  non-squamousNSCLC  patients  [123]n Median  OS(months)HR CI  95% p Median  PFS(months)HR CI  95% p526 522 ITT  populationErlotinib  +  Tivantinib Erlotinib  +  Placebo
884	   IHC   expression   (2+   or   3+),   the   addition   of   tivan-tinib  did   improve
885	   pathway   can   be   aber-rantly  activated   as   a   consequence   of
886	  depends  on  the
887	  amplification  occurs  withor  without  T790M  mutations  in
888	  meet
889	  amplification  in
890	/
891	  mutations  and
892	  and  lowerexpression  of
893	  (indoleamine  2,3-dioxygenase  1)  and
894	  mutationor
895	  mutation  and  ALKfusion  activate  the  downstream
896	 mutation status than conventional semantic
897	 features and
898	 rearrangements or
899	 mutationor
900	 quality assessmentwas performed by the FFPE DNA Library Prep
901	,another had
902	 mutation and
903	 and
904	 oc-curred in the
905	 K catalytic subunit p110α, encodedby
906	 mutation has a role onlung tumorigenesis as a powerful promoter that is initiated by otheroncoproteins, particularly
907	 and
908	 patients in the unmatched cohort of 51,979 patients,
909	 in the
910	 cohort matched to trimodality therapy patients,
911	 and DFS were both significantly higher inthe patients with low expressing
912
913	 acts as an oncogene innon-small cell lung cancer by epigenetically repressing
914	 and
915	 inhibitor or
916	 is the strongestnatural agonist of TGR5, followed by DCA,
917	 and
918	 and
919	 and
920	 and
921	,
922	 binding activities of
923	 and
924	 target genes, suchas cyclin D1, cyclin E1, p-Rb, c-Myc, CDK4/6, MMP2,
925	 inhibitor ruxolitinib(INCB018424) or siRNA targeting
926	 and 47% expressed
927	 depletiondid not affect cell cycle progression in any of the HBECcell lines, depletion of CDCA3 in each of the NSCLC celllines affected the gross
928	 content profile for a panel of cell lines including three immortalized lungepithelial cell lines (HBEC3, HBEC4, and HBEC5) and seven NSCLC cell lines that were transfected with either a control smallinterfering RNA (siCON) or two small interfering RNAs targeting
929	 functions as part of the SCF ubiquitinligase complex to regulate mitotic entry by controllingthe levels of
930	 inhibitsconstitutivepalmitoylation-dependent degradation of membrane-spanning pro-cancer
931	 and
932	   and
933	  and
934	  and
935
936
937	  and
938	  and
939	  and
940	  and
941	  and
942	  and
943	  andSOX2  genes  in  non-small  cell  lung  carcinoma  with
944	  and
945	  and
946	 represses non-small cell lung cancer cellgrowth and survival via up-regulating NR4A3Meichun Zhanga,b,∗, Jing Wuc, Weinong Zhonga,b, Ziwen Zhaoa,b, Zhaohui Liua,ba Department of Pulmonary and Critical Medicine, Guangzhou First People's Hospital, School of Medicine, South China University of Technology, Guangzhou, Guangdong,510180,
947	 physically binds
948	 is significantly down-regulated in NSCLCtissues and the expression of NR4A3 is positively correlated with the expression of
949	 attenuates the tumor suppressive roles of
950	 represses NSCLC cell growth and survival via up-regulating
951	 and
952	 (Abcam, HongKong, China), β-actin (Proteintech, Rosemont, IL, USA),
953	 and
954	 and
955	 andNR4A3 (Probe Set
956	 expression intensity (Probe Set
957	 and
958	 and
959	 expression intensity (Probe Set
960	 expression intensity(Probe Set
961	 up-regulates the expression of
962	 in
963	 in
964	 binds to
965	 or
966	 stably overexpressed and control H1299 cells with
967	 was measured by qRT-PCR with a primer specific for NR4A3promoter, and the results are presented as percentage of input
968	 stably depleted and control A549 cells with STAT3specific antibody or negative control IgG to immunoprecipitate associated
969	 was measured by qRT-PCR with a primerspecific for NR4A3 promoter, and the results are presented as percentage of input
970	 and
971	 and
972	 and
973	 attenuates the tumor suppressive roles of
974	 in
975	 stably overexpressed and concurrently
976	 stablyoverexpressed and concurrently
977	 stably overexpressed and concurrently
978	 stably overexpressed and concurrently
979	 (209959_at and207978_s_at) for
980	 inNSCLC,
981	 also both displayed positivecorrelation with the expression intensity of
982	 and
983	 up-regulates the expression of
984	 in
985	 knockdown significantlydown-regulated the mRNA and protein levels of
986	 binds to
987	 regulates the expression ofNR4A3 via
988	 speci-fically bound to STAT3, but not
989
990	 to the promoterof
991	 knockdown increased the binding ofSTAT3 to the promoter of
992	 by
993	 reversed the up-regulation of
994	 binds to
995	 attenuates the tumor suppressive roles of
996	 knockdown reversed the decreaseof cell viability caused by
997	 knockdownreversed the repression of cell proliferation caused by
998	 knockdownattenuated cell apoptosis induced by
999	 stably overexpressed and
1000	 knockdown attenuated tumor growth repressioncaused by
1001	 knockdown attenuates the tumor sup-pressive roles of
1002
1003	 as a critical mediator of the tumorsuppressive roles of
1004	 up-regulates
1005	 did not reg-ulates the expression of
1006	 reversed the roles of
1007	 by
1008	 could bind
1009	 binds
1010	 couldalso bind
1011	 reduces the binding ofSTAT3 to
1012	 increasesthe binding of
1013	 to
1014	 reverses the effects of
1015	 did not alter
1016	 alters the occupation of
1017	 and
1018	 and
1019	, reducing the binding of STAT3 to the pro-moter of
1020	  antibody  blotting  with
1021	  was  amplified  by  PCR  withthe  forward  primer:  5(cid:5)-GCG  ACT  GCT
1022	  and
1023	  protein  was   detected  by  western  blotting  with
1024	  protein  was  blotted  with  the  Flag  antibody  with
1025	  knockdown  in  non-small  celllung  cancer  cellsP22077  and  USP7  knockdown  could  not  decrease  MCM2and
1026	 and
1027	 fusions and other oncogenicdriver alterations, including mutations in
1028	 fusions (0%) or
1029	 fluorescence in situ hybridization–positivecase, targeted sequencing failed to confirm a ROS1 fusionbut instead identified a
1030	 (one of 166) and
1031	 mutations in this cohortderived significant clinical benefit from an EGFR inhibitorand did not receive a
1032	 (exon2),
1033	 fusions detected by NGS or PCR,four previously reported ROS1 fusion partners wereidentified:
1034	, EGFR, and
1035	 testing results (FISH positive/NGSnegative) and
1036	 G13D mutation (red) and an
1037	 mutations and
1038	, ATM serine/threonine kinase gene; CTNNB1, catenin beta 1 gene;TP53, tumor protein p53 gene; DNMT3A,
1039	 were notdetected in the tested cases (n ¼ 44, 37, 39, and 44,respectively), indicating that
1040	 fusions co-occurring with
1041	 rearrangement andPIK3CA mutations in five cases, no overlap with otheroncogenic drivers,including
1042	 fusions and ALKfusions or
1043	 IHC is not a validated screeningassay for ROS1 rearrangement and is more complicatedthan
1044
1045	 = Extracapsular extension,
1046	 (G-cross)Tumor:
1047	 cell concentration were in-dependently associated with favorable
1048	 ¼ anaplastic lymphoma kinase; ECOG ¼ EasternCooperative Oncology Group;
1049	 ‘Cell Carcinoma’, cCHRT ‘concurrent chemoradiation’,NA ‘Not Applicable’, NCT ‘No Curative Treatment’,
1050	   and
1051
1052	 805 902  1347  1445  1482  B14  B33  B71  1526  1246  125  1328  Sex Age  (year) Histology Smoke  status Tumor  size  (cm) Lymph  node  status
1053	  promoter  have  been  reported  tofacilitate  the  TERT  transcription  by  creating  de  novo
1054	  and
1055	  or
1056	  mutation  can  generate
1057	  of  patientswith
1058	 94305, USAb Department of Radiation Oncology, Stanford University School of Medicine, Stanford, CA 94305, USAc Institute for Stem Cell Biology and Regenerative Medicine, Stanford University School of Medicine, Stanford, CA 94305, USAd Division of Oncology, Department of Medicine, Stanford University School of Medicine, Stanford, CA 94305, USAA R T I C L E I N F OA B S T R A C TKeywords:Circulating tumor
1059	 andthree subcentimeter enhancing brain lesions on
1060	 is cleared from the plasma through boththe liver and kidneys [51], and ctDNA testing of urine samples has alsobeen shown to detect
1061
1062	 and
1063	 and
1064	 mutation detection in circulating cell-free
1065	 mutations from circulating tumor
1066	 mutations inplasma
1067	 and
1068	 loss in resistant
1069	 profiling reveals heterogeneity of
1070	 mutation in circulating tumorcells and circulating tumor
1071	 mutations in circulating tumor
1072	  (22),
1073	 mutations in samples  which  were  wild-type  for  TP53  alterations  detected high  throughput  platforms  with  the  capacity  to  screen  mul-tiple mutations from
1074	 protein was car-ried out on a section from each ADC and
1075	 cases with adequate tissue were screened for
1076	  than  was  available  and is more labor intensive, the 10 cases wild-type for
1077	 (24%  of  samples),  15
1078	 (12, 27%),
1079	 (six, 15%),
1080	  (two, 5%),
1081	  muta-tion/variant) reported in four of six cases finally classified as NSCLC
1082	 with 22 mutations detected in 20 tumor samples, followed by
1083	  or
1084	 mutations and
1085	 and
1086	 and
1087	 and
1088	TK domainIP3EML4Retaspimycin, ganetespibALKAP26113PI3KHSP90EML4-ALKMutated EML4-ALKCrizotinib ASP3026Alecitinib/CH5424802TGF-αIL-8AREGCancer cell, intracellular spacePLC-γJAKDAGPKCEML4-ALKHSP90ShcGrb2SOSKRAS-GTPRafMEK 1/2ERK 1/2pAKTEverolimusmTORProteins (eg, EGFR ligands)NucleusAurora A kinaseFosSTATMycElk-1Cyclin D1, E
1089
1090	  and
1091	 inhibitors in brain metastasesCeritinibCeritinib  (Novartis),  the  second  ALK-specifi c  tyrosine kinase inhibitor approved by the FDA, also targets IGF-1R, insulin  receptor,  and
1092	  autophosphorylation  and  the downstream
1093	 was 2·69 nmol/L, which surpasses its previously reported IC50 concentrations for
1094	 and
1095	 kinase inhibitionMechanism of actionCeritinib (Novartis)ALK inhibition including activity against L1196M and C1156Y mutationsIGF-1R, InsR, and ROS1 inhibitionIC504·5 nmol/L0·15 nmol/LAlectinib (Roche)ALK inhibition including activity against L1196M, G1269A, C1156Y, and F1174L mutations1·9 nmol/LBrigatinib (Ariad Pharmaceuticals)ALK inhibition including activity against L1196M and G1269S mutationsEGFR and ROS1 inhibition0·62 nmol/LPF-06463922 (Pfi zer)ALK and ROS1 inhibition<0·07 nmol/LTSR011 (Tesaro)ASP3026 (Astellas Pharmaceuticals)X396 (XCovery)ALK inhibition including activity against L1196M mutationNTRK inhibitionALK inhibition including activity against L1196M mutationROS1 inhibition64ALK inhibition including activity against L1196M and C1156Y mutations661 nmol/L3·2 nmol/L<0·4 nmol/LCurrent trials and dataResults from PROFILE 1005, 1007, 1014Improved intracranial control compared with standard chemotherapyMinimal penetration into the CNSPhase 1 trial showing effi  cacy of ceritinib in ALK-rearranged patientsAnimal studies showing CNS to plasma ratio of 15%Seven of 14 patients in ASCEND-1 showed partial or complete intracranial response to ceritinibOngoing phase 2/3 trialsNCT01772797, NCT02040870, NCT018685138, NCT01685060, NCT01947608, NCT01964157, NCT01828112, NCT01828099, NCT02336451ORR of 93% in crizotinib-naive patients4611 of 21 patients showed partial or complete intracranial response to alectinibExtrapolated
1096	 gatekeeper domain)Increased ALK phosphorylation and kinase activity;72 decreased affi  nity to crizotinibC1156Y mutationIncreased ALK phosphorylation and kinase activity721151T insertion and S1206Y mutation (ALK solvent-front region)Decreased affi  nity to crizotinib or decreased affi  nity of ALK to ATP73Other ALK mutationsIncreased ALK activity or decreased crizotinib bindingIncreased ALK fusion copy numberIncreased ALK phosphorylation and kinase activity13Hsp90 inhibitors (NCT01725400, NCT01712217)ALK inhibitors that are eff ective against mutations (eg, alectinib, ceritinib, brigatinib)Target downstream mediators in the ALK/RAS pathwayHsp90 inhibitors (NCT01725400, NCT01712217)ALK inhibitors that are eff ective against mutations (eg, alectinib, ceritinib, brigatinib)Target downstream mediators in the ALK/RAS pathwayHsp90 inhibitors (NCT01725400, NCT01712217)ALK inhibitors that are eff ective against mutations (eg, alectinib, ceritinib, brigatinib)Target downstream mediators in the ALK/RAS pathwayHsp90 inhibitors (NCT01725400, NCT01712217)ALK inhibitors that are eff ective against mutations (eg, alectinib, ceritinib, brigatinib)Target downstream mediators in the ALK/RAS pathwayHigher dose of ALK inhibitorsTarget downstream mediators in ALK/RAS pathwayAnti-
1097	  inhibitor  might  amplify intracranial  penetration,  and  could  be  quantifi ed  by either
1098	  inhibitor,  frequent exams and imaging with
1099	 kinase-induced VM in lung cancer cells isaccomplished by the activation of FAK and
1100	 tyrosine kinase inhibitors (TKIs) (ie, T790 Mmutation,
1101	 abnormalities,PIK3CA,
1102	 necessary for NGS, it234 -Figure 1 Of Patients Who Underwent Next Generation Sequencing Testing for Progression of Disease (N [ 13) the FollowingAbnormality Frequencies Were Noted:
1103	 Translocation (0%), and
1104	 Translocation (0%),
1105	 Translocation (0%), and
1106	 is quantified using the Qubitfluorometric assay (Thermo Fisher Scientific) and further assessedfor quantity and quality using a quantitative polymerase chain re-action (PCR) assay (hgDNA Quantitation and
1107	 and
1108	 and its downstream genes GCLCand
1109	 and its downstream genes (PSMA2,PSMA7 and
1110	 for
1111	 was the onlyprotein tyrosine phosphatase at 6q that contains a
1112	 in malignant glioma cell lines suppressed cell growthand migration by inhibiting
1113	 [13], and
1114	  expression  did  not  receive  any benefi t from the monoclonal antibody onartuzumab, exploratory analyses  indicated  that  those  with
1115	 expression, butdecreasing the P15 and
1116	 was performed by using SYBR-PremixEx Taq™ II (TAKALA, Dalian, China) and
1117	 ex-pression, but upregulating the P15 and
1118	 significantlyincreased paclitaxel sensitivity in
1119	 Hexose-P PFK
1120	 Hexose-P PPPFK ossse-FBP BPPPPDHAP
1121	 (orange),
1122	 contentand
1123	  mutation,
1124
1125	  (Epidermal  Growth  Factor  Receptor);
1126	  for  Response  (95%  CI)HR  for  PFS  (95%  CI)HR  for
1127	  mutation,
1128	 [11,18]; matrixmetalloproteinases, including
1129	 and
1130	 (zero responses in seven patients with STK11mutations) and
1131	 ~
1132	 = progressive disease;
1133	 and
1134	 mod-ulates
1135	 sense, 50-ACAAAGGACTCTCGACCCAAA-3’; AGR2 antisense, 50-GTGGGCACTCATCCAAGTGA-3’; miR-342-3p sense, 50-TCCTCGCTCTCACACAGAAATC-3’; miR-342-3p antisense, 50- TATGGTTGTTCAC-GACTCCTTCAC-3’;
1136	 activity was affected by the depletion of
1137	 couldcounteract the inhibition of AGR2 expression at protein levels bymiR-342-3p and lead to the activation of the
1138
1139	 was found to be directly associated with cellproliferation and migration through
1140	 can stimulate
1141	 is an important oncogene that regulatescell growth and migration through
1142	 regulates
1143	 decreased
1144	 oncoprotein inhibits p38
1145	 is aSMAD4-suppressible gene that modulates
1146	 and
1147	  DipStick Real-time  PCR PicoGreen Real-time  PCR Real-time  PCR Real-time  PCR Real-time  PCR Real-time  PCR Real-time  PCR Real-time  PCR PicoGreen Real-time  PCR Real-time  PCR Real-time  PCR Agilent  2100Bioanalyzer Real-time  PCR NA hTERT NA ␤  actin hTERT NA hTERT ␤  actin ␤  actin ␤  actin NA hTERT
1148	 as a mechanism of acquired resistance to smallmolecule
1149	 ¼ computed tomography;IMRT ¼ intensity modulated radiotherapy; KPS ¼ Karnofsky performance status;
1150	 ¼ computed tomography; IMRT ¼ intensity modulated radiotherapy; KPS ¼ Karnofsky performancestatus;
1151	 ¼ computed tomography; IMRT ¼ intensity modulated radiotherapy; KPS ¼ Karnofsky performancestatus;
1152	 ¼ computed tomography; IMRT ¼ intensity modulated radiotherapy; KPS ¼ Karnofsky performancestatus;
1153	 ¼ computed tomography; IMRT ¼ intensity modulated radiotherapy; KPS ¼ Karnofsky performancestatus;
1154	 ¼ computed tomography; IMRT ¼ intensity modulated radiotherapy; KPS ¼ Karnofsky performancestatus;
1155	 ¼ computed tomography; IMRT ¼ intensity modulated radiotherapy; KPS ¼ Karnofsky performancestatus;
1156	 and
1157	  and
1158	 Inhibitors and
1159	 mutations and 33% (17/52) of patients with
1160	  TKIs  achieve  therapeutic
1161	 concentration of
1162	  deletion  19 mutation who experienced CNS tumor response using high-dose gefitinib that achieved a therapeutic
1163	 levels are seen with other TKIs, including gefitinib and erlotinib, although the penetration rate with
1164	 inhibitors with greater
1165	 and
1166	  and
1167	 and
1168	 and
1169	 ceritinib [Text Word]OR Zykadia [Text word] OR LDK378 [Text word]) AND LungNeoplasms [MeSH Terms] OR Cancer, Lung [Text word] ORNon-Small Cell Lung Cancer [Text word] OR Lung Carcinomas,Non-Small-Cell[Text word] OR
1170
1171	 by both IHC and FISH,
1172	 in lung adenocarcinoma, and
1173	 of NSCLC patientswith
1174	 mutations, gene amplification, and proteinexpression and
1175	 or
1176	 was an open, longitudinal, multicentre, observational,prospective cohort study which started in 2010 and was closed in 2016,when the succeeding project
1177	 scans of the patient’s two metastatic lung lesions before gefitinib therapy (A),
1178	 of the various tissue biopsies are shown below the corresponding
1179	 was used to prepare ampliconlibraries using the Ion AmpliSeq Lung Cancer Panel, which en-compassed 22 cancer-related genes including KRAS, NRAS, BRAF,PIK3CA, EGFR, AKT1, ERBB2, PTEN, STK11, MAP2K1, ALK, DDR2,CTNNB1, MET, TP53, SMAD4, FBXW7, FGFR3, NOTCH1, ERBB4, FGFR1and
1180	 in February 2017, when the
1181	 and GARFT overexpres-sion are well-known mechanisms of acquired
1182	 Analysis and immunoprecipitation assays, wereveal that Rab11-FIP2 directly binds to the
1183	 suppressedtumor growth and invasion via
1184	 is epigenetically silenced and associatedwith
1185	 (Ser473) and
1186	 fragments were performed usingthe
1187	 and ROS1,
1188	 inhibitor dabrafenib in combination with thedownstream
1189	 and
1190	 fusions, of both
1191	 than promotes the switch of
1192	 can phosphorylate downstream proteins belonging to
1193	 isoforms, originating from three different genes,can be distinguished in mammals (ARAF,
1194
1195	 mutations generate structural modifications of the protein thatare responsible for permanent activation of
1196	 protein: first, it increases BRAF kinasedomain activity (∼500-fold compared with wild-type one [17]); sec-ondly, it enables BRAF to be active as a monomer when
1197	 and does not inhibit
1198	 contains a
1199	 features inhibitory phosphorylation sites that deregulate
1200	 mutations in NSCLCActivating mutations in the BRAF gene, generally mutually ex-clusive from
1201	 mutants weredetected in large cell carcinomas or NSCLC
1202	 mutantNSCLC compared to unselected (or
1203	 activation as a mechanism of resistance to targeted therapies inNSCLC
1204	 mutations in two out of195 patients who developed acquired resistance to
1205	 gatekeeper resistance mu-tation (T790M) along with
1206	 (allelicfrequency > 3%) has been associated with resistance to the third gen-eration
1207	 mutations in NSCLCBRAF mutations are generally detected using extractive methodsand
1208	 mutationsdetection (together with
1209	 mutant specific primaryantibodies and sensitive clones recognizing
1210	V600E mutation in 21 cases and non-V600E BRAF mutation in 19 cases among 450 EGFR, KRAS, PI3KA,HER2 and
1211	 mutations in NSCLC: liquid biopsyLiquid biopsy in NSCLC is a non-invasive tool for the diagnosticdetection and monitoring of
1212	 detection on liquid biopsies have beendescribed in advanced melanoma patients; digital sequencing of cir-culating tumor
1213	 inhibitors resistance de-velops in a majority of patients, and the most reported resistance me-chanisms lead to reactivation of
1214	 inhibitor to
1215	 inhibitor prevented paradoxical MAPKpathway activation that leads to development of cutaneous squamouscells carcinoma, observed in
1216	 inhibition in
1217	 mutationResponses to vemurafenib/dabrafenibResponses to otheragentsG466VG469AG469LG469RG469VY472CN581SG596RG596VV600DV600GV600KV600MK601EK601NV600_K601delinsETwo NO response (one
1218	 inhibitors reported in clinical studies, either in monotherapy or in combination with
1219	 +
1220	 and
1221	 inhibitors alone or incombination with
1222	 signaling through
1223	 inhibitors can be simplistically divided into mechanismsthat lead to reactivation of
1224	 signaling represents the main mechanism in-volved in secondary resistance to
1225	 splice variants (16%)/BRAF gene amplification (13%), that increase levels of BRAF V600Ehomodimers, or secondary mutations in other genes involved in MAPK/ERK signaling pathway that lead to BRAF-independent reactivation ofERK signaling, such as NRAS/KRAS (20%) or
1226
1227	 G12D mutation,together with nucleotidic substitutions in
1228	 inhibitor to
1229	 homodimers/heterodimers is one of the mainmechanisms of resistance to BRAF inhibitors in melanoma that lead toreactivation of
1230	 inhibitors, that are able to inhibitBRAF mutant cells avoiding paradox activation of
1231	 inhibitors, CCT196969, CCT241161are able to block ARAF,
1232	 inhibitor LLT462 in
1233	 pathway downstream,directly targeting its main effector
1234	 and/or
1235	 and
1236	 inhibitors occasionally harbor BRAFgene mutations but lack mutations in KRAS, NRAS, or
1237	 V600E mutationas resistant mechanism after treatment with third-generation
1238	 and
1239	 mutation in circulating tumor cells and circulatingtumor
1240	 Alterations Detected in Cell-Free
1241	 mutationtesting in cell-free
1242	 in cell-free
1243	 mutation analysis in circulating freetumor
1244	 mutation status in circulating-free
1245	 and
1246	 and
1247	 inhibitor that evades paradoxical
1248	 mutationpredicts sensitivity to
1249	 inhibitors that also target
1250	 inhibitors thatevade paradoxical
1251	 dimer antagonist for the noncanonical
1252	 inhibitor SCH722984 against
1253	 and
1254	 expression correlated with activation markers of themitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) pathwaysonly in cases without Kirsten rat sarcoma viral oncogene homolog (KRAS), epidermal growth factor receptor (EGFR),v-Raf murine sarcoma viral oncogene homolog B (BRAF), anaplastic lymphoma kinase (ALK) and proto-oncogenetyrosine-protein kinase
1255	 expression negatively affected the outcome during EGFR-targeting therapy but wasassociated with more favorable results with programmed death 1/programmed death ligand 1 (PD-L1)-directedtherapy, independent of smoking history, PD-L1 expression or
1256	 TKI,
1257	 with TKI therapy, we supplemented the
1258	 ¼ epidermal growth factorreceptor;
1259	/BRAF muta-tions, KRAS wild type, and no actionable alteration, or EGFR/ALK/ROS1 aberrations, and we found remarkable differences: the KRAS/BRAF-mutated cohort featured only a modestly significant correlationbetween
1260	 Expression on Overall SurvivalIn the full cohort (n ¼ 367), there was no
1261	 differences; neither did analysis of
1262	 in relation to defined lungcancer biologies, we formed 3 subgroups: (1)
1263	 expression had no significant effect on
1264	 Expression on Chemotherapy OutcomesThe
1265
1266	 over all lines of EGFR-directed TKItherapy (Figure 3), which showed a strong trend toward a detrimentof high
1267	 IO incorporating sex, age, smoking history, and KRAS/EGFR mutationalstatus, high
1268	 Mutation, anALK or
1269	 ¼ epidermal growth factor receptor;
1270	 ¼ epidermal growth factor receptor;
1271	 amplification is acknowledged as a resistancemechanism to
1272	 and KRASMutational Status, and High
1273	 ¼ epidermal growth factor receptor;
1274	 as surrogates for
1275	 in KRAS- or BRAF-mutated lung cancersseems to dominate over high
1276	 mutation,
1277	 expressionon
1278	 expressionon
1279	 was not different for first- and second-line chemotherapies, indicating that
1280	 expressionon cumulative
1281	 and PI3K/AKT activation in EGFR-mutated cases we found no additional effect of high
1282	 expressionthat showed as negative for
1283	 expression in advanced or metastatic lung adenocar-cinoma depends on the biological context, and differs betweentreatment modalities: The effect on clinical benefit from chemo-therapy seems negligible, whereas the outcome of
1284	 mutation, high
1285	 amplification leads togefitinib resistance in lung cancer by activating
1286	 over-expression andan
1287	 Expression in NSCLCSupplemental Figure 1 Flow Diagram of Patient Recruitment and Allocation to the Subgroup Analyses Presented in This Reportn = 12n = 892n = 7n = 367n = 2n = 235n = 45n = 30n = 374n = 51n = 121n = 176n = 46n = 121n = 170n = 44Abbreviations: IHC ¼ immunohistochemistry; NGS ¼ next-generation sequencing;
1288	 Expression in NSCLCSupplemental Figure 3 Fluorescent In Situ Hybridization of MET (A) Gene Copy Number and (B) MET Expression in Correlation WithMET Copy Number Gain as Detected Using Next-Generation Sequencing (NGS)Arreebbmmuunn  yyppoocc  eenneegg  TTEEMM5432B300eerrooccss--HHTTEEMM  2001000No CNGMETMET  Copy Number Gain by NGS Copy Number Gain by NGSCNGNo CNGMETMET  Copy Number Gain by NGS Copy Number Gain by NGSCNGe454 -Clinical Lung CancerJuly 2018Supplemental Figure 4 Response of
1289	 ¼ epidermal growth factor receptor;
1290	 and
1291	 Expression for
1292	 ¼ epidermal growth factor receptor; HDPI ¼ highest posterior density interval; IO ¼ immuno-oncology;
1293	 IHCH-ScoreMET IHC3D (%)MET HighExpressionAge atDiagnosisPatient
1294	 Expression Levels of All Patients Diagnosed With the
1295	  K/Akt  and
1296	  K/Akt  and
1297	  is  a  member  ofthe  dual  specificity  protein  phosphatases  (DUSPs),  which  cannegatively specifically  ERK1/2regulate
1298	 (for West-ern blot), Akt, p-Akt (Ser473), mTOR, p-mTOR (Ser2448), P70S6K, p-P70S6K(Thr389), 4E-BP1, p-4E-BP1 (Ser65), ULK1, p-ULK1 (Ser757), cleaved poly (ADP-ribose) polymerase (c-PARP), Bax, p21,
1299	 (BioVision, CA, USA) and
1300	 siRNA (sense 50-GGUCAAAGGACGAA-GAUAATT-30, antisense 50-UUAUCUUCGUCCUUUGACCTT-30),
1301	 presented no remarkable effecton the expression levels of Beclin1 (a protein for autophagicinitiation [30]),
1302	 increased the expressionlevels of LC3-II and
1303	 inhibits the maturation of lysosomal cathepsins but did not alterthe lysosomal pHThe decrease of the lysosomalfunction by disrupting thematuration of lysosomal cysteine proteases, including
1304	 were measured through fluorogenic substrate assayand the results suggested that
1305	 and
1306	 and
1307	 inhibits autophagosome-lysosome fusion and lysosomal
1308	 for 24 h, the enzymatic activities of
1309	 treatment, suggesting that CEP in-hibits the maturation of
1310	 [38], was used to furtherconfirm that
1311	 proteins andaccumulation of GFP-LC3 puncta; 2) failure to further enhance theBAF-induced expression level of LC3-II when
1312	 has not affected the lysosomal pHand the expression levels of SNARE proteins like syntaxin 17,SNAP29 and
1313	 also increases the anti-proliferative effects of erlotinib andgefitinib in NSCLC HCC827 cells with
1314	 for 24 h after with or withoutpretreatment with BAF or knockdown of
1315	 and
1316	 Neuroendocrine  tumor Sarcomatoide  carcinoma
1317	  –  epidermal  growth  factor  receptor;
1318	  mutations  were  only  identified  in  adenocar-cinoma  and
1319
1320	  muta-tions,  but  the  progression-free  survival  (PFS)  and
1321	  mutations  are  associated  with  a  higher  tumorresponse  rate  to  chemotherapy,  but  are  not  a  predictive  biomarkerfor  PFS  and
1322	  were  age  inferior  to  65  years,  female  sex,  tumorstage  <IIIB  and  the  presence  of
1323	  of  an
1324	  mutations  or
1325	  and
1326	 was normalized to
1327	 induces
1328	 increased
1329	 and
1330	 from timeof brain metastasis in NSCLC patients with
1331	 ¼ epidermal growth factor receptor; NSCLC ¼ nonesmall-cell lung cancer;
1332	 from malignant lung tissue showed theT790M resistant mutation, DNA from
1333	D NSCLC With CNS MetastasisPreviousSystemicResponse?Best CNSResponseSD/PRaTime to CNS Response, wkCNS TTP, mo
1334	 brain metastasiswithin 2 weeks, as well as clinical improvement of gait disturbanceFigure 2 Proposed Clinical Schemata of Pulsatile Erlotinib InitiationJoan How et alAbbreviations: CNS ¼ central nervous system;
1335	   mutations   in   circulating
1336
1337	  muta-tions  (assessed  by  PCR)  [4]  or
1338	  [9–13],  or
1339	  from  circulating  tumor  cells  and  plasma,and  analysis  of
1340	  extracted  from  both  cfDNA  and  CTCs  was   tested  forthe  presence  of  the  corresponding
1341
1342	  mutations  in  the  liquid  biopsiesKRAS-mutated
1343
1344	  mutated  plasma
1345	  and
1346	  mutation  in  circulating  tumor  cells  andcirculating  tumor
1347	 was synthesized and qRT-PCR was performed usingSYBR Green PCR Core reagent kit (Applied Biosystems, Foster City,CA, USA) and carried out using an
1348	 mRNA was quantified by measurin
1349	 forward: 50-CCCATCACGGACAGCCTCAG-30;FOXD3 reverse: 50-TAGGCTGTTCTTGGGCTTGC-30;
1350	 wasinvolved in ectopic
1351	 modulates migrationthrough direct transcriptional repression of
1352
1353	 knowdown with NOX4-siRNAsignificantly reduced the expression of GSTα2, Txnrd1 and
1354
1355	 is an importantregulator of Nrf2-mediated GSH production and redox state incardiomyocytes [24], this study found that NOX4 could also stimulateexpression of Nrf2-targeted GCLM,
1356	 = hazard ratio;
1357	 mutation or the
1358	 and
1359	 and
1360	 and
1361	 or C2 to
1362	 orC2 and
1363	 (g/dL)Hgb % change C1 to C2PLT change C1 to C2 (109/L)PLT % change C1 to C2ANC change C1 to C2 (109/L)ANC % change C1 to C2Hgb change C2 to
1364	 oftherapy included delays in subsequent cycles of therapy  7 days,reasons for delay in treatment, reasons for hospitalization and lengthof stay between C1 to
1365	 and from C2 to
1366	 and C2 to
1367	 or C2 to
1368	 or C2 and
1369
1370	 and
1371	 scans,
1372	 and
1373	 status did not impact upon
1374	 and
1375	 and
1376	 mutations appeared to cor-relate with smoking history [19–21] and with concomitant
1377	 and
1378	 status and other mutationsEGFR,
1379	 and
1380	 mutations were mutallyexclusive with
1381	 status, inversely, wasstatistically significant associated with
1382	 mutations,13 (16%) were co-mutated in
1383	 and
1384	 and
1385	 and
1386	 and
1387	 between
1388	 and
1389	 and
1390	 status did notcorrelate with
1391	 and
1392	 compared to the KRAS-mutatedgroup without
1393	 mutationaland functional status modulate responses to
1394	 andTP53 with
1395	 and
1396
1397	 ¼ epidermal growth factor receptor;
1398	mNSCLC patientsharboring common EGFR mutations in both trials, with a trendtoward improved
1399	 was significantly improved with afatinib inpatients with
1400	 Mutations (Del19/L858R) in LUX-Lung 7Yi-Long Wu et alA BAbbreviations: EGFR ¼ epidermal growth factor receptor;
1401
1402	 ¼ hazard ratio;
1403	 as a resistance biomarker of clinical
1404
1405	 [46], Tie-1[47] and
1406	 was initially identified as one of 231 lncRNAsconnected with HOX loci, where it could represent 40 kb in-transtranscription of the
1407	 and polycomb proteinsSUZ12 and
1408	 to the negative Groucho /
1409	 may promote proliferation ofNSCLC cancer cells by regulation of P15 and
1410	 decreases
1411	 isconnected with the mutation stage of
1412
1413	 could promote NSCLC progression via miR-101-3p and
1414	-ASIn NSCLC cells, HOXA11 antisense RNA (HOXA11-AS) may interactwith
1415	 antisense
1416	 is expressed as a result of
1417	 interacts with chromatin
1418
1419	 mainly in-hibits NSCLC cell proliferation and induces apoptosis, whereas
1420	 increases the proliferation of human breast cancercells by upregulating
1421	 -binding cassette; BWS, Beckwith-Wiedemann syndrome; BMP, bone morphogenetic proteins; CSC, cancer stem cells; CAF, cancer-associated fibroblasts; CML, chronic myelogenousleukemia; COX-2, cyclooxygenase-2; DC, dendritic cells; Pol ŋ,
1422	 - binding cassette(ABC) transporter proteins;
1423	 signaling maintains Lgr5 stem cells homeostasisand prevents premalignant hyper proliferation via
1424	 2 -NFκB signaling regulates the stem cell related gene,
1425	 genes from fibroblastsinduces CAFs that secrete exosomes enriched in ADAM10, leading toincreased expression of
1426	 (insulin like growth factor) type 1 receptor and sub-sequently increases
1427
1428	 inhibitionthough a
1429	 antibody specifically designed toinhibit CD44 -
1430	 antibody, R05429083, designed to target a glycosylated epitope,has been shown to have dual action by targeting the CSCs and expandingABC transporter targeting agents• Dendritic cell based vaccinations(cid:129) PD-1 axis agentsTrastuzumabFAK inhibitorsSTAT inhibitors(cid:129) Anti – CD44 mAbs(cid:129) Peptides –
1431	 inhibitorsHedgehogWnt(cid:129) NSAIDS(cid:129) COX2 Inhibitors(cid:129) Anti – frizzled mAbsCompetitive antagonists to
1432	 was identified as one of thetop hits, together with
1433	 and p-AKT and targeted CSCs in
1434	 promotes migra-tion and invasion of breast cancer cells via cytoskeletal reorganization and adhesiondecrease: An
1435	 mediates resistance of cancer stem cells to
1436	 adhesive activity, induces FAK and
1437	 and
1438	 and its peptide derivative, AD-01:Regulation of
1439	 and
1440	 and
1441	 pathway by targeting the extra-cellular domain of
1442	 mutations and
1443	 mutations as wellas
1444	 mutations and
1445	 biology, assesses the utility of
1446	  biology,  assess  the utility of
1447	 genes encode four  highly  related  protein  isoforms  (HRAS,
1448	 result in the activated GTP-bound  form  of
1449	  guanine  nucleotide  exchange factor  son  of  sevenless  homologue-1  (SOS1)  and
1450	 to
1451	 status (%)Author/trial (year)aKRAS resultsMutation Wild-typePFSb,
1452	 of patients with
1453	  mutations  was  a  negative  prognostic  factor for
1454	 was prognostic for
1455	 between
1456	  mutation  on  benefit  from  ACT  with respect to
1457	  subtype  suggests  no  benefit for
1458	 Mutation for
1459	 is downstream from
1460	 was also significantly shorter in the
1461	 TKI therapy  to  best  supportive  care  assessed
1462	 between treatment arms according to
1463	 mutation status and response to
1464	 and
1465	 mono-clonal  antibodies  cetuximab  and  panitumumab  in  patients with
1466	  status  and response rate, PFS, or
1467	 inhibitorsRAS activates the RAS-MEK-ERK pathway, and there has  been  considerable  interest  in  drugs  targeting  MEK  for
1468	  and
1469	 mutant NSCLC mouse models also have shown tumor  shrinkage  with
1470	 mutant NSCLC85 did not demonstrate a significant improvement in
1471	  amplification  is  a  potential mechanism  of  resistance  to
1472	 and
1473	 and
1474	 mutated tumors reported less optimistic results with median PFS and
1475	 muta-tion and
1476	 in differential survival benefit from
1477	 status to be used to affect
1478	 mutations in advanced colorectal can-cer predict a lack of benefit from
1479	 or the use of alternative cellular path-ways for post-translational modification of
1480	 relays
1481	  and  related  signaling  pathway  genes  in  lung  adenocarcinomas identifies a novel somatic kinase domain mutation in
1482	 and
1483	 and
1484	 and
1485	 AND
1486	 and
1487	 and
1488	 on clinical outcome of
1489	  mutations  as  predictive biomarker in patients with
1490	 and
1491	) versus DOC plus pla-cebo as second-line treatment for advanced
1492	 (n ¼ 61), or
1493	 of an additional cohort of 82 patientswith
1494	 were not different between patients with
1495	 (predominantlepidicgrowth with invasion <5 mm), and
1496	 oflepidic adenocarcinoma are close to 100%,18,19 and theirincidence have been increasing recently possibly due tothe spread of
1497	 to AIS or
1498	 andKEAP1, mutations in KRAS, amplification of MET, and rearrangementsof
1499	 and FGGRs, as well as in-activating mutations in CDKN2A, PTEN, KEAP1, MLL2, HLA-A, NFE2L2,NOTCH1 and
1500
1501	 has a sensitivity and specificity of 67% and 100%for the identification of SqCC; and
1502	  is  initiated  at  the  site  of  DNAdamage  by  the  early  (sensor)  protein  kinases:  ataxia  telangiecta-sia  mutated  (
1503	  DSBs  can  be  character-␥-H2Ax  foci;  downstream  effectors  of  theized  by  the  detection  of
1504	  is  important  in  the
1505	  or  DNA-PKcs  leadsto  radiosensitization  while  inhibition  of
1506	  inhibits
1507	  damage  response  to  DNA  damaging  agents  over  time:  Representative  immunoblots  (A)  show  the
1508	  inhibition  on
1509	  inhibition  on
1510	  Repair  40  (2016)  35–46treatment  impacts  the
1511	  activation  in  IR-treated  H460  cells(cid:2)-H2Ax  foci  is  dependent  onTo  investigate  the  mechanism  of  the
1512	   as  measuredby  Western  blotting  for  phosphorylated
1513	  compet-␮Mitive  inhibitor  of
1514	  is  essentialto  the  early
1515	  sensitization  to  CDDP  and  combination  CDDP-IRtreatment  is  independent  of  early
1516	  inhibition  by  VE-821  did  not  alter  theearly
1517	  andChk2  phosphorylation  was  observed  in  all  cells  24  h  after  treatmentwith  VE-821,  along  with  a  decrease  in  total  Chk1,  which  suggestslate  activation  of  the  ATM-dependent
1518	  and
1519	  inhibitor  VE-821  at  a  dose  resulting  in  lowsingle-agent  toxicity  resulted  in  selective  synergy  in  H460  cellstreated  with  CDDP  and  CDDP-IR  with  only  a  moderate  decreasein  survival  in  those  treated  with  IR  alone,  consistent  with  an  ATR-dependent
1520	  inhibition,  which  further  supports  a  mech-anism  by  which  CDDP  radiosensitization  is  due  to  impaired  DSBrepair  and  independent  of  the  impact  of
1521	  and
1522	  damage  caused  by  reduced
1523	  inhibition  broadly  sensitizes  ovarian  cancer  cells  tochemotherapy  independent  of
1524	  damaging  therapy  bythe  selective
1525	 based on the preoperative
1526	  recep-tors  on  the  T  cells  leads  to  the  activation  of
1527	  also  reduces
1528	  expression  is  consti-tutive  on  regulatory  T  cells  (Tregs)  and  is  induced  in
1529	  and
1530	 None BSC Toxicity PFS CTLA-4I II  III  I  II  PD-1I  I  II  III  III  I  I  I  I/II  II/III  PD-L1I  I  IB  II  II  II  III  IB  LAG3I  KIRI  I  CD27I  ALK/
1531	  and
1532	  is  an  inducible  T-cell  co-stimulator  structurally  and  functionallyrelated  to
1533	   and
1534	   and
1535	   and
1536	  and
1537	  or
1538	  and
1539	  and
1540	  (䊐)  and
1541	  and
1542	  and
1543	  and
1544	  and
1545	  or
1546	  and
1547	  and
1548
1549	  or
1550	  to  form  homodimerswith  itself  or  heterodimers  with
1551	  and
1552	  and
1553	  and
1554	  and
1555	  (䊐)  and
1556	  (䊐)  and
1557	  and
1558	  (䊐)  and
1559	  (䊐)  and
1560	  and
1561	  have  not  been  identified,  whereasnumerous  ligands  activate  the
1562	  and
1563	  and
1564	 mutations, 1
1565	 mutation or
1566	 mutation statusPositive
1567	 mutation or
1568	 werepositively associated with
1569	 [9] and
1570	 [18],
1571	 or
1572	 and
1573
1574	 is required for lung cancer cell proliferationThe discrepancy of IRX5 in association with
1575	 family member
1576	 samples isolated from cells treatedwith BaP confirmed the downregulation of
1577	 and CCNE1, CCND1,
1578	 and different sizes of
1579	 promoter-luciferase reporter construct and
1580	We analyzed the correlation between IRX5 and G1 phase regulatorsusing the UCLA Gene Expression Tool Celsius [57], and found that IRX5expression was associated with
1581	on
1582	 induced
1583	 failed to regulate
1584	 is a target gene of
1585
1586	 is a ubiquitously expressed homeodomain
1587	 is regulated by Shh[69] and HoxB4 [70] and involves in
1588	 which encodes Cyclin D1 and has a critical role in carci-nogenesis [76–78], was a target gene of
1589	 expression of immunosuppressive protein
1590	 kinasedomain mediate
1591	 that Stabilizes
1592	 as atumor suppressor in human breast cancer with a role in
1593	 and
1594	 and
1595	  and
1596	  (covering  all  potential  variants  of  oncogenic  fusion transcripts  containing  ALK)  [20]  was  assessed,  together with 3 other factors of insulin receptor superfamily (IGF1,
1597	 and
1598	 or
1599	 can shuttle polycyclic aromatic hydrocarbons  to  the  nucleus  and  enhance  oxidative
1600	 and
1601	  (PGR),
1602	 and
1603	 receptor tyrosine kinase is a metastasis suppressor  that  is  frequently  silenced  by  promoter
1604	 and
1605	 WereSeen, Although Mutations in
1606	 and exon deletions inSTK11 (exons 3-5),
1607
1608	 had a shorter median
1609	-directed targeted therapy and very fewreceived combined BRAF and
1610	 and
1611	 ascommonly co-mutated gene alongside
1612	 , and
1613	 and
1614	 , and
1615	 ,  and
1616	 ToppGeneSuit P-value  Haplotype P-value
1617
1618	 encodes an estrogen receptor implicated in hormone bind- ing,
1619	  encodes  the  multifunctional  protein  TGF- β1,  which combines with epidermal growth factor receptor (
1620	 ,  which  is  also  referred  to  as  ASK1  (apoptosis  signal- regulating kinase 1), is a member of the MAP3K family and is in- volved in a number of pathways, such as the
1621	 and
1622	 (P
1623	 (P ==differentially in GSE27262;
1624	 and cytokine-cytokine receptor pathways (differen- tiation); and Hippo, Ras, and
1625	 , and
1626	 , and
1627	 methylation analyses in lung adenocarcinomas: Association with EGFR,
1628	 and
1629	 amino acid substitutions and
1630	 and decreased presence of
1631	 triggers
1632	 is able to induce the degradation ofboth wild-type and mutants
1633	 fragment containing the sequenceof the third intron of the
1634	 role [21,22], weshow that higher LRIG1 expression, in iT1#1 and iT1#10, correlateswith decreased
1635	signaling via the transcriptional activation of at least two targetgenes: EGFR itself and
1636	 was tested for the presence of the
1637	 is required to sustain
1638	 study using tumor bearing mice, H3255 cells expressingL858R mutated
1639	 tracers detecting
1640	 and
1641	, a member of the RAF kinasefamily, lies downstream of
1642	 signaling contributes to insensitivity ofB
1643	 and
1644	 regulates zinc finger E-box bindinghomeobox 1 expression by sponging miR-150 and promoteing cell invasionin non-small-cell lung cancer☆Hong-Yan Zhang, Fu-Shuang Zheng, Wei Yang, Ji-Bin Lu⁎MARKDepartment of Thoracic surgery, Sheng Jing Hospital of China Medical University, Shen Yang 110004,
1645	 indirectly regulated
1646	 may inhibit
1647	 affected the expression of
1648	 was associated with
1649	 expression wassignificantly up-regulated in
1650	 regulated
1651	 promoted the invasion of lung cancer cells through miR-150-mediated regulation of
1652	 was associated with
1653	 was positively associated with that of
1654	 regulated
1655	 could alleviate therepression of both protein and mRNA expression of
1656	 could enhance the expression of
1657	 and
1658	   exon   14   skipping   alterations   in   non-small   celllung   cancer:   The   Why,   the   How,   the   Who,   the   Unknown,   and   theInevitableThanyanan   Reungwetwattana a,   Ying   Liang b,   Viola   Zhu c,d,   Sai-Hong   Ignatius   Ou d,∗a Division  of  Medical  Oncology,  Department  of  Internal  Medicine,  Faculty  of  Medicine,  Ramathibodi  Hospital,  Mahidol  University,  Bangkok  10400,  Thailandb Department  of  Medical  Oncology,  Sun  Yat-sen  University  Cancer  Center,  State  Key  Laboratory  of  Oncology  in  South  China,  Collaborative  Innovation  Centerfor   Cancer  Medicine,  Guangzhou  510060,  Chinac Long  Beach  Veterans  Administration  Hospital,  Long  Beach,
1659	ex14  alterations,  includ-ing  MET   Y1003  mutation,  are  based  on
1660	  to  the
1661	   is  activated  by
1662	   (half  inhibitory  concentration  [IC50],8–11  nM),
1663
1664
1665	   1214063)Tepotinib  (EMD1214063,  MSC2156119J;  Merck) is  anotheroral,  ATP-competitive,  and  highly  selective
1666	   activation  was
1667	ex14  alterationsand  MET   Y1003  mutations  in  cell  lines  with  acquired  resistance  tosavolitinib  mediated  by
1668	   receptors  in  the  active  (phosphorylated)  confor-mation,  increasing  the  Michaelis  constant  (Km,  the  concentrationof  substrate  that  permits  the  enzyme  to  achieve  half  the  Vmax,  themaximum  rate  of  the  reaction)  of
1669	  amplifi-cation  as  a  resistance  mechanism  to
1670	  ex14  mutations  and  resistance  to  METi  throughdecoupling  from
1671	  inhibits
1672	  mutational  analysis  was  performedusing  SCORPIONS  and
1673	   (mean Sex  Male  Female DM
1674	   (mean Sex  Male  Female  DM
1675	  status  had  ashorter  PFS  and
1676	  mutation,elderly  patients  had  non-inferior  PFS  but  a  shorter
1677	 augments cell killing and tumor response from agents thatcause
1678	 reactscovalently with the aldehydes at
1679	 sites in
1680	 sites, which remain unrepaired afterreaction with
1681	 and
1682	 in LUAD and ES ofM
1683	 were significantly associated with
1684	 in LUAD,
1685	 andAT of
1686	 and
1687	 and AT of POLR2L,
1688	 and
1689	 and AT PSI values of
1690	 and AT PSI values of
1691	 and AT PSI values of
1692	 and AT PSI values of
1693	 or
1694	 and
1695	 mutations, although nodifference in
1696	 was automatically extracted from tumortissue, and
1697	 ¼ complete response;
1698
1699	 (2-year OS,
1700	 Promotes Non-small-cellLung Cancer Cell Proliferation and Invasionby Epigenetically Silencing
1701	 represses the tumor suppressorsEGR1 and
1702	 may act as an oncogene inNSCLC by silencing
1703
1704	 RNA levels were normalized to
1705	 and
1706	 protein levels were detected in H1299 and H1975 cells after transfection with
1707	 significantly increased the expressionof
1708	 contributes to NSCLC byrepressing
1709	 also significantly increasedEGR1 and
1710	 and
1711	 Epigenetically Represses
1712	 regulates the potentialtargets
1713	 RNA could bind with
1714	 or LSD1 is involvedin the silencing of
1715	 expression was increased in H1299cells transfected with si-EZH2 (Figure 6D), whereas
1716	 and
1717	 could directlybind to
1718	 con-tributes to NSCLC cell proliferation, migration, and invasion,partly by recruiting
1719	 and
1720	 expression in H1299 and H1975 cells after transfection with
1721	 protein levels were detected in H1299 and H1975 after transfection with
1722	 and
1723	 and
1724	 Represses
1725	 and H3K27me3 occupancy in the
1726	 and
1727	 and
1728	 and
1729	 regulates NSCLCcell proliferation and invasion in a manner dependent on repressingEGR1 and
1730	 or
1731	 expression was inversely corre-lated with
1732	 regulates NSCLC cell prolifer-ation and invasion in a manner partly dependent on the silencing ofEGR1 and
1733	 Exerts Oncogenic Function Partly Dependent on Silencing of
1734	 and
1735	 and
1736	 cells,
1737	 exerts oncogenic function in a mannerpartly dependent on the repression of
1738	 andRHOB expression by interacting with
1739	 RNA accumulates in the nucleus, andRIP assays revealed that it could directly bind with histone methyl-transferase
1740
1741	 could recruit
1742	 recruited by the pseudogene
1743	 Midiprep or Midiprepkits (QIAGEN), transfected using X-tremeGENE
1744	 using the CycleTESTPLUS
1745	 decreases the malignancy of human non-small cell lung carcinoma byregulating
1746	 was chosen over
1747	 ¼ chemokine (C-C motif) ligand 27;CTACK ¼ cutaneous T cell attracting chemokine;
1748	 in
1749	 gene on 20 tu-mor samples and for the
1750	 TTA
1751	 or
1752	 5847, Stanford,
1753	 37130-001 Alfenas, MG, Brazilb Departamento de Ciências Biomédicas, Universidade Federal de Alfenas, CEP 37130-001, Alfenas, MG, Brazilc Departamento de Química,
1754	 by flow cytometry in A549 cellstreated with complex (3), considering that ATM (ataxia telangiectasiamutated) is a kinase protein critically involved in the
1755	 phosphorylates several key proteinsthat act as
1756	  and
1757	   and
1758	,  AKT  and
1759	  and
1760	  and
1761	,  AKT  and
1762	   and
1763	  protein  levels  and  down-regulated
1764	 chest and abdomen and
1765	  and
1766	 scan
1767	  between  baseline  and  postchemotherapy
1768	  and/or
1769	 rs2853533 vari-ant
1770	 for
1771	 rs3788189 polymorphism which was associated with
1772	  and
1773	 rs2853533 SNP which was associated with inferior
1774	 monoclonal antibody, in combina-tion with cisplatin/gemcitabine was recently associatedwith an
1775	 and
1776	 G2032R mutation is the strongest mutation which isanalogous to the
1777	 is very similar to
1778	 and
1779	 and
1780	 and
1781	 and
1782	 and ALK, the
1783	 G2032R mutation is ananalog of the
1784	 as a 'druggable' receptor tyrosine ki-nase: lessons learned from inhibiting the
1785	 [4] or centralphotopenia seen on F18-fluoro-deoxyglucose (FDG)
1786	 without corresponding cavitation on
1787	 scans were a mixture of PET onlyand hybrid PET-
1788	 = epidermal growth factor receptor,
1789	  agonists,  poly  (I:C)  andTLR2/1  agonist,  Pam3CSK4  (1 ␮g/ml);  the
1790	  responses  in  multiple  cell  typesIn  order  to  highlight  any  differences  in
1791	  stimulation  on
1792	  agonists  LPS  or  LPS  serotype  0111:B4  (1 ±  the  TLR1/2  agonist  Pam3CSK4  (1 ␮g/ml),
1793	   mouse  lung  fibroblasts  wasincreased  in  response  to  TLR2,
1794	  inhibition  on  PGE2,  IL-8,  and  IP-10  release  from  human  lung  fibroblasts  stimulated  with
1795	  inhibitor,  diclofenac  (10
1796	  and
1797	  and
1798	  and
1799	  inhibition  on  PGE2,  IL-8  and  IP-10  release  fromhuman  lung  fibroblasts  stimulated  with
1800	  agonist,  C12iEDAP  (1 ␮g/ml),  imiquimod  (1 ±  Pam3CSK4  (1 ␮g/ml),  Poly  (I:C)  (10 ␮g/ml),  LPS  (1 ␮g/ml),  FSL-1  (1 that
1801	  and
1802
1803	  agonist,  imiquimod,and  the  gram-negative  peptidoglycan  mimetic  and
1804	  and
1805	  andTLR4  to  activate
1806	  to  dominate  in  lung  parenchyma  furtherhighlights  the  sensitivity  of  lung  fibroblasts  to
1807
1808	  in  fibroblast
1809	  (adjusted
1810	  mRNA  is  sig-nificantly  upregulated  in  NSCLC  tumors  compared  with  normallung  tissues,  whereas  the  expression  of
1811	  methylation  and  oncogenicpotential  of
1812	 Tyrosine KinaseInhibitors Display HighPrevalence of
1813	 or
1814	 amplifications,
1815	 Alterations and
1816	 intron 31, while the colored portion represents the sequencing reads of
1817	 and RB1,the
1818	 and
1819	 (20%, n = 3),
1820	 amplification, five SR patientsharbored SCNA for ERBB2, MET, AKT2, or
1821
1822	 V1064 fs and
1823	 alterations and morefrequent
1824	 and other genes in
1825	 profiling reveals heterogeneity of
1826	 V384D polymorphism associates with poor response to
1827	-mutant lung cancersassociated with resistance to EGFR kinase inhibitors and characterization of
1828	   mutationALK   fusion
1829	 3
1830	  of  the  second  patient  with
1831	  fusion-positiveNSCLCs,  and  they  observed  two
1832	-TKI  for  EGFR  mutated  NSCLC  or
1833	  and
1834	  and
1835	  and
1836	 and
1837	  ex14  patients  are  often  older than  those  with
1838	 ex14 positive calls can be confidently made in both “Pass” and “At Risk”
1839	 (53 breakpoints),
1840	 (PD-L1),
1841	 fusions and
1842	 and
1843	  and
1844	 and
1845	 and
1846	 mutations and
1847	 = overall survival, DSS = disease-specific survival, DFS = disease-free survival,
1848	 images andthen transferred to the coregistered
1849	 Parameters with Any Grade and Grade 3 Radiation EsophagitisGrade 3
1850	 changes correlatingwith tumor response have been described, but no formalstudies correlating change in
1851	 or
1852	 AGG
1853	 CAT
1854	 (1:1000, Abcam, USA), Caspase-3 (1:1000, Abcam)and
1855	 and
1856	  methyltransferasesDNMT1,  DNMT3A,  and
1857	  and
1858	  methylation,  of  which
1859	  and
1860	  and
1861	  activated
1862	  to  propagate  signals  in  the  cell  throughPI3K-AKT-mTOR  pathway  and
1863	  with
1864	  interacts  with  GRB2-SOS  and  activates  the
1865	  is  the  predominant  downstream  target  of
1866	  regulates  the  expression  of  OCT4,
1867	  increased  thelevel  of
1868	  inhibitors,DNMT  inhibitors,  and
1869	  inhibitors,  entinostat  specifically  inhibitsHDAC1  and
1870	  mutation  assay  were  othertarget   mutation  assays  such  as  PD-L1  assay  in  2  patients,
1871	  and
1872	 N F OA B S T R A C TArticle history:Received 28 April 2015Received in revised form 30 August 2015Accepted 3 September 2015Keywords:RYBPApoptosisChemotherapyNon-small cell lung cancerPatient survivalRing1 and
1873	 and YY1-binding protein (RYBP)is a newly identified member of
1874	 expression is an independent predictorof a poor prognosis in patients with
1875	 positively regu-lates the levels and function of p53 and is involved in cell cycleprogression and cellular response to
1876
1877	 and
1878	 expressionis associated with better survival of patients with hepatocellular carcinoma(
1879	 (41%) and
1880	 or
1881	  expression  group  had  significantlylonger  disease-free  survival  (DFS)  and
1882	  gene  was  more  frequently  observed  amongclassical  high-risk  ALL  group  and  was  also  significantly  andindependently  associated  with  a  shorter  DFS  and
1883	  induced  by  TNF-alpha  and  inhibited  cell  proliferation  and  invasion  by  phosphorylating
1884	  and
1885	 at 1 year in the matched cohort was 95% and 88%, and 87% and 84% in the
1886	 after matching between
1887	 rateswere 87% (95% CI, 72%-94%) and 68% (95% CI, 51%-79%) inthe
1888	 rate for theentire study population was 28%; 25% in the
1889	 and
1890	 and
1891	 and
1892	-mutation-positive lung cancer cells undergo apoptosis following EGFR knock-down, or pharmacological inhibition of
1893
1894	 was identified as a downstream target of
1895	 TKI re-sistant cells, due to either EGFR Thr790Met point resistant mutationor
1896	 and
1897	 and SFKs activation and down-regulates
1898	 and
1899	 or
1900	 and
1901	 or
1902	 and
1903	 and
1904	 or
1905	 and
1906	 or
1907	 and SFKsin PC9 and H1975 cells treated with an
1908	 and
1909	-mutation-positive patients treatedwith an EGFR TKI (Cohort 1) for AXL,
1910	 and
1911	 and
1912	 and
1913	 and
1914	 or
1915	 and
1916	 and
1917	 and CDCP1can affect clinical outcome to
1918	 and
1919	 TKIs in Cell CultureWe have reported the combinatorial efficacy of gefitinib orosimertinib with TPCA-1 (
1920	 and Src-YAP1 contribute to innate resis-tance to
1921	 or
1922	 enhances the anti-tumor effect of
1923	 phosphorylation but increasedor not ablated STAT3, paxillin and
1924	 or
1925	 phosphorylation were diminished when
1926	 inhibitionalone increases
1927	 and
1928	 and
1929	-mutation-positive NSCLC patientstreated with EGFR TKI, we show that a risk-model combining
1930	 and
1931	 and
1932
1933	-mutation-positive NSCLC patients and the use of atool kit to optimize EGFR mutational screening by incorporatingCDCP1 and
1934	 activating mutations located in the tyrosine kinase domains and mainly in the form of a base-pair deletion at exon 19 (ΔE746_A750) ora point mutation at exon 21 (Leu858Arg) enhance cell growth and invasion via tyrosine phosphorylation and lead to the activation of mitogen-activated protein kinase (MAPK), signaltransducer and activator of transcription 3 (STAT3) and
1935	 mediates
1936	 undergoes phosphorylation-induced homo-dimerization, leading to nucleartranslocation,
1937	 with erythropoietin-producinghepatocellular receptor A2 (EphA2), the complement C1r/C1s, Uegf, Bmp1 (CUB) domain-containing protein-1 (CDCP1) or
1938	 induces novel
1939	 gene amplification or
1940	 family kinases andfocal adhesion kinase with the loss of the amplified, mutated
1941	 revealednew brain lesions, and a
1942	 1 or 2 [MAP kinase  kinase  1  or  2]  inhibitors,  anti-
1943	 mutation detection in circulating 7 8 9 cell-free
1944	 , an eQTL for LKB1 , was consistently associated with chemotherapy response and
1945	  for
1946	 ,  Kang  YR ,  Choi
1947	 genetic rearrangements havebeen linked to mutations in other oncogenes such as
1948	 inhibitor MK-2206when combined with paclitaxel and carboplatin in
1949	 and
1950	 inhibits cell proliferation, migration andinvasion while promotes apoptosis by downregulating
1951	 and
1952	 or
1953	 and
1954	 was positively correlatedwith
1955	 and
1956	 and
1957	 knockdown suppressed tumor growth in NSCLC in vivo by upregulatingmiR-144 and downregulating
1958	 inhibited cell proliferation, migration, invasion and promoted apoptosis bydownregulating
1959	 and
1960	 and
1961	 (si-DLX6-AS1),siRNA against
1962	 and
1963	 overexpression reversed the effects of
1964	 and
1965	 and
1966	 upregulated
1967	 knockdown suppressed tumor growth in NSCLC in vivo by upregulating miR-144 and downregulating
1968	 (C), miR-144 (D), and
1969	 overexpression reversed the effects of
1970	 led to a loss of
1971	 expression dis-tinctly abrogated the inhibitory effect of
1972	 abated the inhibitory ef-fect of
1973	 upregulated
1974	 upregulated
1975	 knockdown suppressed tumor growth in NSCLC in vivoby upregulating miR-144 and downregulating
1976	 and
1977	 was highly expressedindicated the poor prognosis of hepatocellular carcinoma (
1978	 was revealed to be upregulated in renalcell carcinoma (
1979	 functioned as a ceRNA to absorbmiR-203a and thereby regulated matrix metalloproteinase-2 (MMP-2)expression in
1980	 was positively associatedwith
1981	 over-expression reversed the effects of
1982	 acted as a ceRNA of miRNA to regulate
1983	 re-versed the inhibitory effect of miR-144 on
1984	 knockdown suppressedtumor growth in NSCLC in vivo by upregulating miR-144 and down-regulating
1985	 and
1986	 and
1987	 and
1988	 knockdown decreased tumorgrowth in NSCLC in vivo through increasing miR-144 and reducing
1989	 gene inhibited the expressionof miR-1183, which could disinhibit the
1990	 has consistently been demonstratedto be more sensitive than
1991	 im-aging of the brain have not been completed, therefore
1992	 ¼ graded prognostic assessment; KPS ¼ Karnofsky performance status; NSCLC ¼ nonesmall-cell lungcancer; PS ¼ performance status;
1993	 imaging at standard andhigh dose, contrast-enhanced
1994	 vs contrast-enhanced
1995	 and
1996
1997
1998	 ¼ hazard ratio; NSCLC ¼ nonesmall-cell lung cancer;
1999	 mutations, or even never-smoking patientswithout a known EGFR mutation or
2000	 expression is associated with poor prognosis in pa-tients with
2001
2002	 gene (chromodomain helicase
2003	 TTT GC-3′5′-CGA
2004
2005	 chromatin remodelling enzymes andthe
2006	   inhibitors   afatinib,   erlotiniband   osimertinib,   the
2007	  inhibitorsand  also
2008	 acts as an oncogene in non-small cell lungcancer by epigenetically repressing
2009	 could simultaneously interact with
2010	 [30],
2011	 represses
2012	 RNA levels in immunoprecipitates with
2013	 protein is determined by western-blot when knockdown of
2014	 indeed binds with
2015	 repressed
2016	 on expression of
2017	 knockdown increased the expression of
2018	 represses
2019	 increased mRNA levels of
2020	 is partly involved in the oncogenic function of
2021	 simultaneously recruits
2022	 play key roles in
2023	 repressed
2024	 through recruiting
2025	 mediated the oncogenic effects ispartially through its epigenetically silencing of the
2026	 and
2027	 repressesKLF2,
2028	 and
2029	 promotes gastriccancer cells proliferation by epigenetically repressing
2030	 and
2031	 Signatures in
2032	 regulates
2033	 antibodyBiological Samples779 blood platelet samplesChemicals, Peptides, and Recombinant ProteinsOptiPrep Density Gradient MediumMultiplate TRAPtestRNALater solutionCritical Commercial AssaysmirVana miRNA isolation kitSMARTer Ultra Low RNA Kit for IlluminaSequencing version 3Truseq Nano
2034	 and thepresence of chromosomal aberrations are events strictlylinked, since the presence of MN in dividing cells isthe result of chromosome breakage due to unrepairedor mis-repaired
2035	 andthe other assays, it should be considered that the greatertechnical and methodological variations in the historicalSCE and
2036	 and
2037	 translocation, t(14;18), relatedto follicular lymphoma, hybrid TCR␤/␥ gene, inv(7),and
2038	  inhibited
2039	  protein
2040	 and
2041	  and  reduced  the  expression  of  Bcl-2,  cyclin  D1,  and
2042	 and
2043	 mutations and
2044	 and
2045	 mutations, 4
2046	 G12A,
2047	   protein   expression   are   correlated   in   non-small   cell   lung   cancer:Implications   for   tumor   progression   and   escapeHai-ying   Fu a,1,   Chun   Li b,1,   Wei   Yang a,   Xiao-dong   Gai b,   Ting   Jia a,   Yan-ming   Lei c,   Yi   Li a,∗a Department  of  Immunology,  Norman  Bethune  College  of  Medicine,  Jilin  University,  Changchun,  Jilin  130021,
2048	   induces   activation   of   Tregs,   we   also  hypothesized   that
2049	   and
2050	   expressionwas   closely   related   with   lymph   node   metastasis   and   TNM   staging,   whereas
2051	   and
2052	   and
2053	  and
2054	  and
2055	  and
2056	  (1:100)  or
2057	  or
2058	  and
2059	  and
2060	  and
2061	  expression  positivelycorrelated  with
2062	  and
2063
2064	  and
2065	  and
2066	  and
2067	  signal  pathway  may   participatein  regulation  of
2068	  signaling  pathway  may   be  related  to
2069	  and
2070	  and
2071	  and
2072	  and
2073	  and
2074	  is  a  noveltranscriptional  repressor  for  the  breast  cancer  oncogene
2075
2076	 mRNA levels; B, quantitative RT-PCR analysis of TIMP1,
2077
2078	 promotes breast cancermigration and invasion whereas the overexpressionof
2079	 pathway and also in the modulationof
2080	 and
2081	 CGC CTG GCT AACCAG ATG
2082	 (ZEB1 and ZEB2), SNAIL(SNAIL1 and SNAIL2) and
2083	 and
2084	 activatesmechanisms maintaining genome integrity, which are similar to thoseacting in CSCs, namely efficient
2085	 damage,
2086	 or
2087	 geneby
2088	 and
2089	 was associated with EMT features inerlotinib-resistant tumour samples and occurred either through itsoverexpression or via upregulation of
2090	 induced nuclear trafficking ofEGFR through activation of
2091	 and
2092	 and
2093	 was identified as a part of a gene set regulated by thetranscription cofactors
2094	 and bothfactors co-occupy the
2095	 may activate
2096	 ligand
2097	 (catalyses H3K27 methylation), or H3K9methyltransferases
2098	 turns into a transcriptional activator by interacting with
2099	 promotes
2100	 loss in resistant
2101	 di-versifies
2102	 and
2103	 recordand were assumed to have a
2104	 implied the ultimatecommitment of apoptotic cell death after drug-induced
2105	 and poly(ADP-ribosyl)ation in the early stages of apoptosisand
2106	  inhibitor,  simvas-tatin  or  nystatin,  an  inhibitor  of  lipid-raft  mediated  endocytosis,a  reduction  in  exosomes  internalization  was  observed  in
2107	  and
2108	  spanning  allchromosomes  with  mutated
2109	  expressionin  cells  was   analyzed  by  mRNA  fluorescence  in  situ  hybridization(FISH)  and  compared  to
2110
2111	  mRNA  FISH  analysis  andimmunohistochemical
2112	  expression  corre-lated  strongly  with  expression  of  MSR1,
2113	  positive  cells  and  consecutive  FISH  labeling  of
2114	  expression  in  the  whole  cancer  tissue  inour  study  correlated  with  the  expression  of  MSR1,
2115	  and
2116	 mutation type, site of LT, metastatic status at initialTKIs, and time from first
2117	 mutation type, sites of LT, and time from first
2118	 TKIs have beenidentified, and the most common etiologies are the development ofthe T790M missense mutation and
2119	 ¼ epidermal growth factorreceptor;
2120	 ¼ epidermal growth factor receptor;
2121	 ¼ epidermal growth factor receptor;
2122	 mutation type, sites of LT, and timefrom first progression to LT were prognostic factors for
2123
2124	 and
2125	 scan, 1 patient due to the re-sampling that caused a separation of the original volume, 14 patientsbecause of WHO-PS score higher than 2, 67 patients had cM0-stage and109 patients had an
2126	 scan, 2 patients due to the resampling that caused a separationof the original volume, 1 patient due to missing survival data, 6 patientsdue to a M-stage of zero, 5 patients with an
2127	 lower than the median of the signaturecohort (n = 92) had a significant better
2128	 was as wellprognostic for
2129	 = hazard ratio, CI = confidence interval,OS = overall survival,
2130	 = hazard ratio, CI = confidence interval,OS = overall survival,
2131
2132	 and
2133	 and
2134	 radiogenomic characterization of EGFR,K-RAS, and
2135	 suppresses
2136
2137
2138
2139
2140
2141
2142
2143	 did notaffect the efficacy or toxicity of
2144	 use was not a significant factor for either PFS or
2145	 did notaffect the efficacy or toxicity of erlotinib and gefitinib in patients with advanced NSCLC harboring
2146	 with
2147	 users and AS non-users group were notstatistically significant, whereas the AS non-users group showed abetter
2148
2149	 ¼ Gastric acid-suppressing medication; ECOG ¼ Eastern Cooperative Oncology Group;
2150	 administrationalso tended to serve as prognostic factors for
2151	 exon 19 deletions wereidentified as statistically significantly independent prognostic fac-tors for
2152	 Users Group(%) (n [ 47)AS Non-UsersGroup (%)(n [ 83)P-Value3 (6)26 (56)12 (26)4 (8)2 (4)29 (62)41 (91)
2153	 did not clinically affect the efficacy of gefitinib and erlotinibin patients with advanced NSCLC harboring
2154	 are mainly excreted via urine without being metabolized byeither
2155	-TKIs in patientsharboring EGFR mutations is crucial with the effect of
2156
2157	 mutations; however, noapparent impact of
2158	 non-users group presented with a longer
2159	 ¼ Gastric acid-suppressing medication;
2160	 ¼ Gastric acid-suppressing medication;
2161	 did not affect the efficacy ortoxicity of erlotinib and gefitinib in patients with advanced NSCLCharboring
2162	 mutations with co-administration of
2163
2164	 did not affect the efficacy or toxicity oferlotinib and gefitinib in patients with advanced NSCLCharboring
2165	 providesdata that can guide expectations for clinicians treating advancedNSCLC patients harboring
2166	 expression of 25% or higher significantly lower
2167	 expression, platin-based adjuvant chemotherapy hadshowed a detrimental effect on DFS and
2168	 as a stratum, inde-from pathological disease stage, statistical analysispendentshowed that adjuvant chemotherapy had detrimental effect inFOXP3 high group on DFS and
2169	 (over 25%) significantly correlated withshorter
2170	 and DFS in patients with the low stainingintensity of
2171	 and DFS for the
2172	 staining intensity had significantly shorter DFS and
2173	  +  BSC  group  N  =  53 BSC  group  N  =  53
2174	 G796D mutation was detected in an OSI-resistant patient, and OSI could not inhibit the EGFR G796D-driven proliferation of cells and the activation of
2175	 or
2176
2177	 Y27C,
2178	 inhibitor or trastuzumab emtansine (T-DM1), an antibody-drug conjugate composed by
2179	 V600E inhibitor [35], PI3K inhibitor,SFK inhibitor, FAK inhibitor, an antagonist of integrin avb3 andavb5, siRNA of
2180	 and
2181	 inhibitor AZD9291 isassociated with increased dependence on
2182	   inhibitors   appears   tobe   similar   in   patients   with
2183	   mutations   impactthe  activity   of
2184	)  mutations  andanaplastic  lymphoma  kinase  (
2185
2186	   inhibitorsmay   not  be  limited  to
2187	  TKItherapy,  and  in
2188	  pathway  that  is  regulatedby
2189	  proteins  there  are  additional  MAP3Ks  including  MAP3K8(TPL2/COT)  and
2190	  and
2191
2192	  signaling  network  includes  a  MAP3K  including  BRAFand
2193	  (TPL2/COT)  and
2194	  or
2195	   inhibitors  have  significant  efficacy  withtumors  that  do  not  have  activating
2196	  or
2197	  and
2198	   inhibitors  in
2199	   inhibitors  in  combination  with  chemotherapySelumetinib  is  an  oral,  selective  inhibitor  of  the  MEK1/MEK2kinases,  and  preclinical  data  using
2200	  mutant  NSCLC  raises  concerns  about  the  pairingof
2201	   inhibitorsand
2202	   inhibitors  in
2203	   inhibitors  in  NSCLChave  been  focused  on  patients  with
2204
2205	  inhibitors  prime  wild-type  RAF  to  activate  the
2206	  inhibitor  with  activity  in  models  of  acquired  resistance  to
2207	  mutationpredicts  sensitivity  to
2208	 and
2209	 or
2210	  mutant  lung  adenocar-cinoma  patientKeywords:Non-small  cell  lung  cancerMeningeal  carcinomatosisIntrathecalEpidermal  growth  factor  receptorPanitumumabTo  the  editorIntrathecal  (IT)  chemotherapy  has  been  the  mainstay  treatmentfor  patients  with  meningeal  carcinomatosis  (
2211
2212	   and  cerebrospinalfluid  (CSF)  cytology  confirmed  the  diagnosis  of
2213	   from  HER-2positive  breast  cancers  obtaining  good  responses  [2–5]  but  no  anti-
2214	 must be maintained for optimal mitochondrialoxidative phosphorylation and
2215	 is necessary formitochondrial oxidative phosphorylation and
2216	 and
2217	 and CCRT [mean ( standard devia-tion) or median (þ interquartile range) in the case of askewed distribution] were tested using unpaired t-testsWe used data from the DLCA-R to investigate whetherdisease and treatment characteristics that were not recor-ded within the
2218	 diagnosedin 2011, 780 patients from the
2219	 and the
2220	 and
2221	 2 Days Postoperatively MANUSCRIPT ACCEPTEDACCEPTED MANUSCRIPTFigure 1MANUSCRIPT ACCEPTEDACCEPTED MANUSCRIPT Abbreviations and Acronyms: ALK= Anaplastic lymphoma kinase ALK-positive = Anaplastic lymphoma kinase gene rearrangement positive
2222	 binding protein; Elk1,
2223	 muta-tion type, treatment regimens and cytokine levels for their associationswith PFS and
2224	 mutation analysisTotal
2225	 in serum of NSCLC patients with
2226	 level in serum of NSCLC patients with
2227	 levels duringafatinib treatment was independently associated with significantlyimproved PFS and
2228	 curves according to the pretreatment level of IL-6 in serum of NSCLC patientswith
2229	 curves according to the pretreatment level of VEGF in serum of NSCLC patients with
2230	 curves according to thepretreatment level of
2231	 curves according to the change of VEGF level in serum of NSCLC patients with
2232	 curves according to the change of
2233	 of heterogeneous mutant
2234	  and
2235	  and
2236	  and
2237	 by secretion of growth factors
2238	 forward, 5′-GACTCATGACCACAGTCCATGC-3′; and reverse, 5′-AGAGGCAGGGATGATGTTCTG-3′;
2239	 identified by MALDI-TOF/TOF
2240	 secreted by CAFs synergistically induce the expression and phosphorylation of
2241	 secreted by CAFs synergistically induce the expressionand phosphorylation of
2242	 and IGF-1 secreted byCAFs were responsible for increasing in the expression and phosphor-ylation of
2243	 inhibitors occasionally harbor
2244	 ¼ docetaxel; 5-FU ¼ 5-fluorouracil;
2245	 is more accurate than
2246	 gene and
2247	 and
2248	 is involved in
2249	 7, DEP domain containing 7; SULT1C2, sulfotransferase family 1Cmember 2; TM4SF4, transmembrane 4 L six family member 4; CHEK1, checkpoint kinase 1; IL1RN, interleukin 1 receptor antagonist;
2250	 and
2251	 with
2252	 and
2253	 4/6 inhibitors sensitize
2254	 Foundation Trust, Wilmslow Road, Manchester, M20 4BX, UKc Cancer Research UK Lung Cancer Centre of Excellence, London and Manchester, UKd Department of Oncology, University College of London Hospital and UCL Cancer Institute, London, UKReceived 30 November 2017; received in revised form 21 March 2018; accepted 13 May 2018Available online 9 June 2018KEYWORDS
2255	 mutations in mice using either chemicaland/or environmental induction or genetic modificationhas been shown to induce cancers such as lung adeno-carcinoma and melanoma, with perhaps the most well-characterised lung cancer model demonstrating thatlung-specific
2256	 is the most frequently mutated inmelanoma, whereas
2257	 has been blighted byconflicting results regarding its prognostic relevance aswell as unsuccessful clinical trial programmes, mostrecently evidenced by the large phase III SELECT-1trial, which showed no improvement in progression-free or overall survival with the addition of selumeti-nib, an oral small molecule
2258	 Z mutation of
2259	 mutation in lung adenocarci-noma has recently been characterised as a predictor ofnegative benefit for patients with
2260	 mutation inhibitors tothe clinic (discussed below) over the next few years, theopportunity to exploit the predictive potential of KRASmutation will undoubtedly assume increasing relevancein a manner that may be analogous to the successesachieved with
2261	 mutantadenocarcinoma into three major subgroups (co-muta-tion with aberrations in LKB1,
2262	 mutant isoformswhen designing and delivering clinical trials: farnesyla-tion was concluded to be of particular relevance toHRAS-driven cancer (with alternative mechanisms ofmembrane association/activation employed in thecontext of
2263	 mutant cancer cell lines, offeringpotential novel targets that include BCL-XL, TANKbinding kinase-1 and
2264	 arecurrently being tested in the clinic for treatment of 2nd to3rd line NSCLC patients with
2265	 mutant cancerthat match the success of
2266	 and
2267	 and
2268	 and m-TOR signalling output in
2269	 inhibitors synergistically inhibits lung cancerwith
2270	 byhydrocarbon-stapled
2271	 staining (OptiView DAB IHC Detection Kit,Ventana), and a second incubation with anti-CD68 antibody for 32′ at36 °C followed by
2272	 and
2273	 and
2274	 analysis islimited because
2275	 mutation in one (8%) of 13, and
2276	  mutations,6
2277	 “AZD9291” AND “non-small cell lung cancer” OR “NSCLC” AND “EGFR mutations” AND “liquid biopsy” OR “circulating tumor
2278	 Cys797Ser mutation,
2279	  mutations  (including  Cys797Ser)  and ALK,  ROS1,
2280	  or
2281	  Cys797Ser  mutation,
2282	 mutation detection in circulating cell-free
2283
2284
2285	  AGC  AAC
2286
2287	  CTA  TGA  CTT
2288	  (n  =  6,  *P <then  activates  caspase3 with
2289	 extractedfrom the FFPE tissue sections obtained from 200 patients withNSCLC was screened using the cobas
2290	 and Laboratory-developed TestsHaruhiko Nakamura et alPNA-LNA P
2291	 tests and multiple LDTs that are widelyused to detect
2292	 tests are “Scorpion-ARMS” ther-ascreen
2293	 Mutation AssayIn the present study, the analytic performance of the cobas EGFRassay as an
2294	 assay missed 2 cases carrying the L858R mu-tation, likely owing to the decreased percentage of mutated
2295	 assay isreliable only when more than 5% mutant
2296	 assay as an
2297	  or
2298	 staining determined the
2299	 Z hazard ratio;IMRT Z intensity modulated radiation therapy;
2300	 with non-proton therapy, with an
2301	 protein, with lessfrequent mutations including MET, BRAF, PIK3CA, HER2mutations and
2302	 mutation and
2303	 rearrangements and 9e13 months inpatients with
2304	 and
2305	-targeted treatments also developthrough a variety of mechanisms, including ALK mutationsand upregulation of EGFR/HER1,
2306
2307	  and
2308	  mutations  inresistance  to
2309	 knock-down did not affect
2310	 is considered an important enzyme in energymetabolism,34–36 and
2311	 on the production of main energymetabolites were catalyzed by
2312	 depletionsuppressed the enzymatic activity of
2313	 depletion might affect lipid metabolismcatalyzed by
2314	 seems to be associatedwith cancer cell metabolism through the regulation of
2315	 regulates
2316	 and
2317	 also interacts with
2318	 pathway modulatingenergy metabolism through
2319	 (siBMP4-1, 1012726;Transfection of siRNAs and miRNAssiBMP4-2,The siRNAs1012728; and siBMP4-3, 1012733)and
2320	 pathway either enhances or inhibits the Wnt pathway dependingon the
2321	 76% 24%
2322	 to
2323	 or PFSbetween T790 M mutation positive and negative groups even thoughmore than 50% of patients with T790 M positivity were treated with 3rdgeneration
2324	 while receiving
2325	 amplification leads to gefitinib resistance in lung cancerby activating
2326	 (24%),
2327	 (1%),
2328	 23%,
2329	 rearrangements 6% and
2330	 mutations in 39%, and nomutations of
2331	 concentrations have been shown to increase with pulsed highdose weekly erlotinib, with intracerebral response after failure ofstandard doses, suggesting that brain metastases may remainsensitive to
2332	 + NSCLC,includ-ing patients resistant to crizotinib with and without resistanceTable 2Selected studies and trials studying the activity of
2333	 inhibitors, HER2inhibitors or
2334	 containing 1% RNAase A at 37 °C for20 min before total cellular
2335	 or
2336	 and
2337	 or
2338	/
2339	 adducts and generation of reactive oxygen speciesresulting in mutations of vital genes such as p53,
2340	 and
2341	 or
2342	 and
2343	 and
2344	 and
2345	 or
2346	 was one potential targetof miR-99b, and
2347	 and
2348	 and
2349	 and
2350	 or
2351	 and
2352	 and
2353	/
2354	 Serono, Blueprint Medicines, Ignyta, Loxo Oncology, and Foundation Medicine; and has served on advisory boards for Genentech/Roche, Pfizer, Novartis, Ariad Pharmaceuticals, Daiichi Sankyo, Taiho, EMD Serono, Blueprint Medicines, Ignyta, Loxo Oncology, and Foundation Medicine, for work in non-small-cell lung cancer, including development of alectinib and other
2355	 fragments of the BIMdeletion polymorphisms identified by PCR were isolated via theQIAquick® Gel Extraction Kit (Qiagen) and inserted into a cloningvector using the TOPO®TACloning® Kit (Invitrogen, Carlsbad,
2356	  was  involved  in  the  regulation  of  chemo-sensitivity  of  the  NSCLCcell  to  DDP  through  regulation  of
2357	  could  compete  with
2358	  and  miR-21  was  required  in  the  regulation  ofNSCLC  chemo-sensitivity  to  DDP  through
2359	  exerts  a  suppressive  effect  ontumor  through
2360	  or
2361	  regulated  NSCLC  chemo-sensitivity  to  DDP-based  therapythrough
2362	  competed  with
2363	  pathway  has  close  association  with  chemo-sensitivity  of  many  kinds  of  cancers  [24,32,33],  which  inspiredus  to  investigate  whether
2364	  could  regulate  NSCLC  chemo-resistanceto  DDP  through
2365	  regulated  NSCLC  chemo-sensi-tivity  to  DDP-based  therapy  through
2366	  regulated  NSCLC  chemo-sensitivity  to  DDP-based  therapy  through
2367	  pathway  related  factors,  PTEN,  Akt  and  p-Akt,  in  response  to
2368	  and
2369	  and
2370	  regulation  of  NSCLC  sensitivity  toDDP  through
2371	  and  promotes  NSCLCgrowth  and  invasion  [34],  we  further  investigated  if  miR-21  wasinvolved  in  the  process  of
2372	  competed  with
2373	  and
2374	  and  IgG  were  performed  using  Western  blot  and  detection  of  miR-21  or
2375	  and
2376	  expression  and  miR-21expression,  between  GAS5  expression  and
2377	  regulation  of  NSCLC  sensitivity  to  DDP  through
2378	  wasinvolved  in  the  sensitivity  of  the  NSCLC  cell  line  to  DDP  throughregulation  of
2379	  mRNA  in  NSCLC  tissues  and  their  correlations  with
2380	  and  miR-21,  between  GAS5and
2381	  has  been  regarded  asa  major  regulator  of  chemo-sensitivity  of  cancers,  including  breastcancer,  glioma,  colorectal  cancer,  as  well  as  NSCLC  [32,33,37,38],which  inspired  us  to  propose  that
2382	  was  down-regulated  while  p-Akt  wasup-regulated  by  si-
2383	  affect  the  chemo-sensitivity  throughregulation  of
2384	  regulating  the  sensitivity  of  NSCLC  to  DDP  through
2385	  and  the  30UTR  of
2386	  acts  as  a  ceRNA  for  miR-21  topromote
2387	  could  regulate
2388
2389	 and
2390	 scan on June 14,2016 registered dimensional stability of lung localizations, whereasintracranial disease response was showed in brain
2391	 rearrangement, 4 of them(4%) were
2392	 are currently approved or under study in additionaloncogene-driven lung cancers harboring molecular activations ofROS1, MET, or
2393	 and
2394	 of
2395	 volumeand mean
2396	 of
2397	 and
2398	 on
2399	 of
2400	 on
2401	 of VATwas significantly higher than the
2402	 of
2403	 of
2404	 of
2405	 volume,
2406	 volume were significantly associated with
2407	 volume showed better
2408	 and
2409	 volume failed to show a sig-nificant association with
2410	 and
2411	 and differences of role be-tween SAT and
2412	 mutations areusually heterozygous and occur in exons between 18 and 21, corre-sponding to the intracellular
2413	 TKIs, such as afatinib, were developedhoping that they could overcome the resistance through covalentlybinding C797 position in the EGFR at the lip of the
2414
2415	 partic-ularly in patients with common
2416	 TKI therapy is superior to sequen-tial therapy of first- or second-generation EGFR TKI followed by third-generation EGFR TKI in terms of
2417	 mutations better with veryhigh sensitivity, and also find other mutations or genetic aberrations si-multaneously which might be predictive for EGFR TKI therapy, for ex-ample,
2418	 method, reported that those with T790M mutationshowed a RR to first-generation
2419	 mutation,
2420	 TKI with other TKIs targeting thiskind of alternate kinase, such as
2421	 TKI resistance due to BIMpolymorphism might be overcome through combination with
2422	 co-mutation, which was identified simultaneouslythrough next-generation sequencing (NGS), a highly sensitive and mul-tiplex method, might also play a modulator of
2423	 mutation but wild-type
2424	 co-mutation was found in 62% outof 95 patients and when treated with erlotinib, patients with wild-typeTP53 had longer PFS than those with TP53 co-mutation (wild-type vsmutation, not reached vs 16 months,
2425	 and
2426	 TKIs and HSP90 inhibitorsor
2427	 TKI therapy, without knowing thebiomarker status or
2428	 TKI therapy, we need moresufficient data or solid evidence of
2429	 TKI; 2) a tumor that harbors EGFR muta-tion known to be associated with drug sensitivity or objective clinicalbenefit from EGFR TKI therapy as defined by documented
2430	 protein by EGFR TKIs is wellknown another acquired resistance mechanism, which involves mesen-chymal-epithelial transition factor (MET), human epidermal receptor 2(HER2), fibroblast growth factor receptor (FGFR),
2431	 amplification but the difficulty arises due to both MET and
2432	 amplification is alsofound in 2–4% of previously untreated
2433	 TKIwith a
2434	 TKI therapy showed 3
2435	 amplification has been reported in 3 of 26 (12%)
2436	 TKIs, such as afatinib, dacomitinib or neratinib,have a capability of inhibiting both EGFR and
2437	 and 2 had concurrent T790M mutationsbut no concurrent
2438	 mutation and
2439	 mutant patientsreached a
2440	 mutant patients, there was no response at all with a medianPFS and
2441	 TKIs, including a tertiary resistance C797S muta-tion, another tertiary resistance T798I mutation,
2442	 TKIs arenow ongoing, including osimertinib and volitinib (AZD6094,
2443	 for
2444	 for
2445	 mutation-positive patents havingprogressed on first-line EGFR TKI, 3 achieved a
2446	 TKI-naïve EGFR mutant patient achieved a
2447	 mutation, out of 8 patients receivingthe combination 4 reached a
2448	 TKI therapy targeting T79M mutation, adding chemotherapyto EGFR TKI therapy has been thought a practical treatment option, hop-ing that the one might act on resistance cells to EGFR TKIs and continu-ation of EGFR
2449	 amplificationoccurs with or without T790M mutations in
2450	 receptor tyrosine kinase inhibitors through a multistepmechanism involving the
2451	 and
2452	 amplification leads to gefitinib resistance in lung cancer by activating
2453	 loss in resistant
2454	 inhibitors occasionally harbor
2455	 iseffective for the detection of
2456	 amplification and
2457	 amplification: a potential mechanism of acquired resistance to
2458	 amplification in
2459	 in lung cancer patients by deep sequenc-ing of plasma cell-free
2460	 kinase domain mutation results in constitutive phosphorylation and activationof HER2 and
2461	 tyrosine kinase inhibitors in NSCLC cell linesthrough de repression of
2462	/
2463	 expression by blocking nuclear translocation of
2464	 and
2465	  regulates
2466	 and
2467	 mutations,
2468	 and
2469	 (Purple),
2470	 + LADC cells versus p40+ SCC cells,including PD-L1+ in both LADC and SCC cells, while the MIMP panelvisualizes ALK+ versus ROS1+ versus
2471	 and mIHC assays to visualize: 1) theDiagnosis and Immunophenotyping (MIDI) panelto detect TTF1, p40, PD-L1, and 2) Pan-Keratin andmIHC with a Molecular Profiling (MIMP) panel todetect ALK, ROS1, and
2472	 rearrange-menthematoxylin-eosin-safranstaining) with strong cytoplasmic ALK expressionin all tumor cells, and lack of
2473	 rearrange-menthematoxylin-eosin-safranstaining) with strong cytoplasmic and membraneROS1 expression in all tumor cells, and lack of ALKor
2474	 V600Emutation (Left panel, hematoxylin-eosin-safranstaining) with strong cytoplasmic BRAF V600Eexpression in all tumor cells, and lack of
2475	 ex-pression level predicted a poor prognosis of NSCLC and affected cellapoptosis by regulating Bcl-2 [15]; upregulated
2476	 and LSD1 in A549 and PC9 cells was determined by qRT-PCR assays,
2477	 or LSD1 was determined by qRT-PCR assays,
2478	 expression could be repressed by histone methyltransferase
2479	 [32],
2480	 mediated by
2481	 inflammasome activation counteracts the inhibitory effects ofpolydatin on proliferation and migration of NSCLC cellsTo explore the effects of NLRP3 inflammasome in the tumor pro-gression of NSCLC,
2482	 treatment up-regulated the decreased
2483	 inflammasome activation regulated byNF-kappaB and
2484	 or
2485	 facilitates cell growth and metastasis through PI3K/Akt and
2486	 activated PI3K/AKT and
2487	 promotescell growth and metastasis by regulating PI3K/Akt and
2488	 modulates cell cycle and EMT through PI3K/Akt and
2489	 promotes proliferation,migration and invasion, at least in part, through activating PI3K/Aktand
2490	 regulated PI3K/Akt and
2491	 expression reduced the expressionof oncogenic cell cycle regulatorsincluding c-Myc,CDK4,CCND1 and
2492	 expression blocked cell growth by suppressingcell cycle progression and repressing the expression of cell cycle G1/Scheckpoint factors, including CDK4, CCND1,c-Myc and
2493	 signaling pathways reduced
2494	 signaling and
2495	 transcription factors
2496	 ¼ Charlson/Deyo (comorbidity); CI ¼ confidence interval;
2497	 ¼ Charlson/Deyo (comorbidity); CI ¼ confidence interval;
2498
2499	, Ataxia-telangiectasia mutated; ATR, ATM and Rad3-related; BSA, Bovine serum albumin; CHK1, Checkpoint kinase 1; CHK2, Checkpoint kinase2; DAPI, 4′,6-diamidino-2-phenylindole; DCFDA, 2′,7′-dichlorofluorescin diacetate; DDR,
2500	 damage recognition such as
2501	 damage sensor, in-cluding ATM,
2502	 and
2503	 damage-sensors
2504	 and
2505	 damage and
2506	 damage sensors such as
2507	 damage caused byNFD,
2508	 generation, andcaused
2509	 facilitates the removal ofhuman topoisomerase II complexes from genomic
2510	 &
2511	 was expressed predominantly as a membrane protein, andits expression led to diminished phosphorylation of several oncogenic receptor tyrosine kinases, in-cluding the
2512	 as-sociated with the risk of lung cancer [10–13], and the expressionn Corresponding author at: Thoracic Disease Research Unit, Division of Pulmon-ary and Critical Care Medicine, Department of Internal Medicine, Mayo Clinic, Ro-chester,
2513	 dramaticallydepleted the expression of total
2514	 suppressed receptor tyrosine kinases
2515	 ex-pression strongly suppressed several RTKs that are important forlung tumorigenesis, including the
2516	 enhances the pathways that promote resistance to endocrine therapy,including ER, androgen receptor, and
2517	 facilitates ER-derived transcription activity and upregulates androgen receptor(AR) and
2518	 upregulation at the 2SD level were analyzedfor gene set enrichment using the
2519	 affects multiplepathways, the most thoroughly studied molecular basis for theseactivities is BMI1's ability to stimulate the E3 ubiquitin ligase ac-tivity of
2520	 staining was quantified using HScore (see Materials and Methods for details);means ±
2521	 acti-vation in MCF7
2522	 inhibitor U0126 effectivelyinhibited
2523	 kinases are well known for promoting cellproliferation [36], the above observations indicate that
2524	 (2 fold),
2525	 and
2526	-
2527	 induces
2528	 cells were treated with DMSO, TAM (3 mM) pluseither Ctrl or the
2529	 in ER þ BCs expressing
2530	 upregulates
2531	 and
2532	 and
2533	 and
2534	 and
2535	 and
2536	 activation in MCF7
2537	 mutant defective in the ligase activity BMI1DRF wasrecently reported to be effective in the attenuation of
2538
2539	 kinases modulate the activation of
2540	 ¼ cancer-specific survival; NS ¼ not statistically significant; NSCLC ¼ nonesmall-cell lung cancer;
2541	 and
2542	 modifies theexpression of certain molecules involved in the regulation of cell cycleprogression, such as
2543	 and
2544	 promotes progression of non-small cell lung cancer by in-ducing
2545	 and
2546
2547	 and
2548	+   and   422   EGFR
2549
2550	+   and  EGFR
2551	+   metastatic   NSCLC,even   when   adjusted   for   differences   in   survival,   compared   to  EGFR
2552	+  and  EGFR
2553	-TKI  was  differentbetween  EGFR+  (87%)  versus  EGFR
2554	+cohort  compared  to  EGFR
2555
2556	  was  significantly  longer  for
2557
2558
2559	+  and  EGFR
2560	 +ST, EGFR WTNo ST, EGFR +No ST, EGFR
2561	+  and  EGFR
2562	+  patients  were  more  likely  to  have  multiplebrain  metastases  compared  to  EGFR
2563	+and  EGFR
2564	+  metastatic  NSCLC,  even  when  adjusted  for  better  OS,compared  to  patients  with  EGFR
2565	 GAG
2566	 (adjusted
2567	 ¼ hazard ratio;
2568	 ¼ hazard ratio;
2569	 ¼ hazard ratio;
2570	 ¼ hazard ratio;
2571	  and
2572	 mutationin NSCLC, which strongly suggests that EGFR mutagenesis arisesfrom nontobacco carcinogens: in fact, the total number of pack-yearssmoked has been found in multiple studies to inversely correlate withthe rate of EGFR
2573	 in exon 20 orT790M [26], which increases the affinity of the EGFR kinase domainfor
2574	 pathway,
2575	 (indoleamine-pyrrole 2,3-dioxygenase),
2576	 and
2577	 +
2578
2579	 amplification occurs with or withoutT790M mutations in
2580	 Amplification leads togefitinib resistance in lung cancer by activating
2581	 mutations,
2582	 mutations,
2583	 in low-
2584	 of PFS < M and low-level
2585	 of the groupwith high-level
2586	 of thegroup with high-level
2587	 high-level groups, themedian
2588	 as a critical determinant of thetherapeutic response of colorectal cancerKyle Knickelbein, Lin Zhang*University of Pittsburgh Cancer Institute, Departments of Pharmacology & Chemical Biology,University of Pittsburgh School of Medicine, Pittsburgh,
2589	 pro-teins include HRAS, NRAS, and
2590	 to function as the exchange factor for
2591
2592	 and
2593
2594	 upon ligand binding and its subsequentFigure 1auto-phosphorylation create a docking site for the
2595	 as a key downstreameffector of
2596	 and inhibit SOS-mediatednucleotide exchange to prevent the activation of
2597
2598	 KRAS, they can preferentially bindthe G12C mutant, disrupt
2599	 and
2600	Cancer typesColorectalColorectalColorectalLungColorectal, breast,and leukemiaColorectalColorectalLungColorectal, pancreatic,and lungMethods of discoveryReferencesshRNA screenshRNA screenshRNA screenshRNA screenshRNA screenshRNA screenGene expression profilingand knockdownshRNA screenshRNA screen929292939495969798combination of PI3K and MEK inhibitors suppressed murinelung tumors with the G12D mutant
2601	 include thetransforming growth factor beta-activated kinase 1 (TAK1),the Snail2 transcriptional repressor, the serine/threonineprotein kinase STK33, the
2602	 and
2603	 suppression synergizeswith
2604	 inhibition promotestumor regressions in
2605
2606	 acts as a reliable marker for the suppression of
2607	 and
2608	 and
2609	 and ERCC-1 and increased the cleaved
2610	 and increase Cleaved
2611	 and
2612	 and
2613	 and
2614	 and XPA, key
2615	 andXPA are followed by increased cell apoptosis as determined by theincrease in level of cleaved
2616	 and ERCC-1 and increased the Cleaved
2617	 and
2618	 Mutation TestingEGFR mutation testing was performed by the department ofpathology using a human EGFR gene mutation fluorescence PCRdiagnostic kit (Amoy Diagnostics, Xiamen,
2619	 (WJOG6401L)trial, which compared gefitinib to cisplatin/vinorelbine in mutation-positive patients with stage II-IIIB disease,is ongoing in Asiaregarding adjuvant
2620	 TKIs doprovide an
2621	 (Figure 3E), and a similar trend was seen in
2622	 = body mass index, CCI = Charlson comorbidity index, mGPS = modified Glasgow prognostic score,
2623	 mutation analysis was implementedin British Columbia in 2010 and
2624	 and
2625	 repair activities have been foundincreasingly useful to detect and categorize cancer risk and haveentered the clinic for interpretation of unclassified variants ofhigh-penetrance risk genes such as
2626	 dimerizes with xeroderma pigmentosumcomplementation group F (XPF) forming a complex that incisesthe
2627	 and b
2628	 expression level and treatment outcome in NSCLC patientssupporting the hypothesis that ERCC1 expression is associatedwith RR and
2629	 poly (AT) insertion/deletion poly-morphism showed a better response to platinum-based therapyas compared to other polymorphisms of XRCC1,
2630	 protein expression (mRNA and protein) on platinum based 1st line chemotherapy outcomes in NSCLC (as presented in published meta-analyses)MixedStudies are grouped according to the ethnicity of the patients (Asian or Non-Asian); number of cases genotyped per study (non-squamous (NSq) and squamous (Sq) NSCLC);advanced stage NSCLC for all studies (stages III/IV) unless indicated with a superscript $ (stages I–IV); for all studies mRNA levels were studied in the tumor except superscript# (studied on blood samples); for each study, available endpoints are indicated by yes (Y) or no (N); response rate (RR), RECIST criteria for all studies unless indicated with asuperscript W (for WHO classification) or E (for ECOG classification); TTP (time to progression)/PFS (Progression Free Survival);
2631	 C8092A (rs3212986) polymorphism on platinum based 1st line chemotherapy outcomes in NSCLC (as presented in published meta-analyses)Asian1102 (8)NSNNYMixed9615 (39)1252 (11)2097 (17)YYYNNYYNYNSNSNSStudies are grouped according to the ethnicity of the patients (Asian, non-Asian or mixed); number of cases genotyped per study (non-squamous (NSq) and squamous (Sq)NSCLC); advanced stage NSCLC for all studies (stages III/IV) unless indicated with a superscript $ (stages I–IV); for each study, available endpoints are indicated by yes (Y) orno (N); response rate (RR), RECIST criteria for all studies unless indicated with a superscript W (for WHO classification); TTP (Time To Progression)/PFS (Progression FreeSurvival);
2632	 pathway controls
2633	 comple-mentation group (FANC) proteins assist
2634	 base damages and SSBsremaining as DNA replicates need FANC proteins processing toboth prevent DNA replication fork collapse and to potentiallyrestore broken forks by
2635	 represents the backup pathway for various unrepaired
2636	 and
2637	 and p53-binding pro-tein (53BP1) were predictive of better PFS and
2638	 pathway activation,can be monitored by immunofluorescence microscopic analysis ofdiscrete nuclear
2639	 pro-teins
2640	 foci formation in 4 (25%) lines fol-lowing crosslinker(DDP, mitomycin C) or
2641	 dysfunction in these 4 cell lines could be explained eitherby ATM/ATR gene mutations or reduced
2642	 foci formation in 13NSCLC explants ex vivo identified 2 (15%) tumors with an HRdefect, notably without changes in
2643	 analysis via
2644	 mutated NSCLC also showedimproved responsiveness to platinum-based chemotherapy [74],and increased olaparib sensitivity in vitro and in vivo [75] suggest-ing a defect in replication-associated
2645	 mutated lungcancer celllines covering classical diagnostic traits such ascrosslinker-induced G2-M cell cycle arrest and chromosomal radialformation as well as a
2646	 nuclease recruitment, incisionsat ICLs, further downstream
2647	 foci weresuccessfully monitored on 12 epithelial cell cultures from MPE fol-lowing exposure to the
2648	 repair genesbut loss-of-heterozygosity of FANCG, RPA1, and
2649	 expressionin IHC as well as
2650	 in specific subgroups such as com-bined low MSH2/low
2651	 or
2652	 has been studied first con-sidering expression together with
2653	 and
2654	 is a crucial
2655
2656	,
2657	 repair-related biomarkerswere translated in the clinical setting without a validated tech-nique and the long story of
2658	 and
2659	 and XPF
2660	 isoform expression and
2661	 synthesis and repairgenes
2662	 expression byimmunohistochemistry and
2663	 and
2664	 and
2665	 and
2666	 and
2667	 and
2668	 and
2669	 and
2670	 and
2671	 (indoleamine 2 3-dioxygenase 1) and
2672	 and
2673
2674	 mutations and
2675	 3/MHC 2 and
2676	 ¼ anaplastic lymphoma kinase;
2677	+ NSCLCTable 1 Key Patient Eligibility CriteriaInclusion criteriaWritten informed consentAge 20 yearsPathologically documented diagnosis of NSCLCTumor HER2 status IHC 3þ, IHC 2þ and FISH-positive, or insertion mutation inexon 20Stage IIIB/IV not amenable to curative local treatment or postoperative recurrentNSCLCPrevious treatment with 1 regimen of platinum-based chemotherapy forlocally advanced or metastatic/recurrent NSCLC, with documented diseaseprogression based on an investigator assessment (history of resistance tostandard monotherapy also accepted in patients aged 75 years)Patients with known mutation in
2678	 ¼ anaplastic lymphoma kinase; CNS ¼ central nervous system; CTCAE ¼Common Terminology Criteria for Adverse Events; ECOG ¼ Eastern Cooperative OncologyGroup;
2679
2680	 in advanced non-small cell lung cancerMeiLi Ma, ChunLei Shi, JiaLin Qian, JiaJun Teng, Hua Zhong, BaoHui Han ⁎Department of pulmonary, Shanghai Chest Hospital, Shanghai JiaoTong University, Shanghai 200030, Chinaa r t i c l ei n f oa b s t r a c tArticle history:Received 30 January 2016Received in revised form 13 June 2016Accepted 24 June 2016Available online 28 June 2016Keywords:Non-small cell lung cancerARMsEGFR mutationPlasma
2681
2682	 mutations in plasma using
2683	 mutation status tested by
2684	 sources include small biopsiesand cytological samples, providing limited and potentially low-qualitymaterial for
2685	 Gene Mutation Fluorescence Polymerase Chain Re-action (PCR) Diagnostic Kit (Amoy Diagnostics, Xiamen, China), whichwas based on
2686	 mutation detectionin plasma by
2687	 was longer for those with
2688	 was longer for patients with
2689	 for
2690	 mutation detection in plasmaby
2691	 mutation-negative results in plasma should be interpretedwith caution, as 40% of patients with EGFR mutant tumors were not de-tected in plasma ctDNA by
2692	 was longer for those with
2693	 mutation detection in plasma by
2694	 mutations inplasma
2695
2696	 L858R mutation in circulating free
2697	 for the detectionof
2698	 mutations incirculating tumor
2699	 and
2700	 findings of the low-grade andhigh-grade groupsThe spectral parameters including NIC and lHU corre-sponding to different grade groups both in
2701	 parameters and tumourpathological gradesThe Spearman correlation analysis results demonstratedsignificant correlations between the spectral CT parameters(NIC and lHU) and tumour grades in
2702	 and
2703	 and
2704	 and
2705	 and
2706	 and
2707	 and
2708	 and
2709	 and
2710	 gene and 180,017,251, 180,017,252, and 180,017,597 in SCGB3A1gene and INDELs at position 35,871,168 in
2711	 and
2712	 and
2713	 expression could beregarded as an independent predictor for DFS and
2714	 and MVIH indicate a poor prog-nosis and induce metastasis; low expression of lncRNA PANDARpredicts a poor prognosis and affects cell apoptosis by regulating Bcl-2; and lncRNA
2715	 mRNA was quantified on
2716	 or
2717
2718	 expression was relatedwith the prognosis of NSCLC patients, DFS and
2719	 expressionlevel had a shorter DFS and
2720	 ex-pression and TNM stage could be regarded as independent predictorsfor DFS and
2721	 regulates
2722	 could regulate
2723	 mRNA level had a signifi-cant positive correlation with
2724	 knockdown significantly inhibited
2725	 contributes to NSCLC progression through in-hibition of miR-101-3p and activation of Wnt/β-catenin pathway; andSNHG7 promotes the proliferation, migration and invasion, and inhibitsapoptosis of lung cancer cells by enhancing the
2726	 was aberrantly upregulated inNSCLC tissues, and higher expression of SNHG16 was correlated withlarger tumor size, advanced TNM stage, lymph node metastasis, shorterDFS and
2727	 expression by spongingmiR-331-3p in gastric cancer; lncRNA
2728	 regulates
2729	 mRNA and
2730	 and miR-146a expression on
2731	 pathway and in ap-ERK-dependent manner in castration-resistant prostate cancer; inhibitsgastric cancer and bladder cancer metastasis by targeting
2732	 could be reg-ulated by
2733	 promotes non–small cell lung cancer cell proliferation throughepigenetically regulating
2734	 competitivelybinds miR-17-5p to regulate
2735	 extracted from paraffin-embedded, formalin-fixed tumor material using the follow-ing  real-time  polymerase  chain  reaction-based  kits:  Therascreen
2736	 mutation frequency in a cohort of 528 consec-utive Finnish Caucasian NSCLC patients by using real-time polymerase chain reaction performed on
2737	 Extraction and Mutation DetectionDNA from 496 formalin-fixed, paraffin-embedded tumor tissue  specimens  of  NSCLC  patients  was  extracted  using 886Journal of Thoracic Oncology  ®  •  Volume 9, Number 6, June 2014Journal of Thoracic Oncology  ®  •  Volume 9, Number 6, June 2014
2738	 samples of 528 NSCLC patients were tested for
2739	  between
2740	 and
2741	 and
2742	 and
2743	 and
2744	 or
2745	 (florescence in situhybridization [FISH] using the Vysis ALK Break ApartProbe kit [Abbott Molecular, Des Plaines, IL]),
2746	 mutations, 60 (27%) had KRASmutations, 7 (3%) had an
2747	 and
2748	 and
2749	 and
2750	 and
2751	 and
2752	 receptors activatesintracellular transcription factors, such as NF-kB or
2753	 and
2754	 cells stable silenced
2755	 expression was related to a poorer
2756	 represses p57 expression via directly binding with
2757	  could  directly  binds  with  enhancer of zeste homolog 2 (EZH2, the catalytic subunit of the PRC2) in  A549  and  SPC-A-1  cells  (Figure  6b),  while  U1  binding with
2758	 indeed binds with
2759	 repressed p57 expression via interacting with
2760	  directly  binding  with
2761	  simultane-ously recruits
2762	 D HLIN C00511A549U1G AP D HLIN C00511SPC-A-1100908070210876520*A549*IgGSNRNP70*SPC-A-1si-NCsi-LINC00511*A549SPC-A-1cIPRGg I
2763	 represses p57 expression via directly binding with
2764	 RNA levels in immunoprecipitates with
2765	 protein level in immunoprecipitates with
2766	  play  crucial  roles  in
2767
2768	 occupancy H3K27me3 binding in the p57 promoter after knockdown of
2769	 promotes proliferation and stem cell-like property of hepatocellular carcinoma cells by stabilizing
2770	 increases stemness features of hepatocellular carcinoma by derepression of
2771	 represses
2772	 represses KLF2,
2773	 phosphorylation via HDAC3-mediated repression of
2774	 promotes gastric cancer cells proliferation by epigenetically repressing
2775	 (p57) is a direct target of
2776	 TKIshas doubled the response rates, significantly prolonged progression-free survival (PFS), and impressively extended
2777	 gene rearrangementsand
2778	 sequencing in cases ofsmall tumor samples with poor material and in patients requiringrapid therapy based on
2779
2780	 ¼ epidermal growth factor receptor; NA ¼ not applicable;
2781	 mutations ascompared with standard PCR-based methods was evaluated invarious studies with all trials uniformly reporting on excellentspecificity for both predefined EGFR mutations and on fairly goodsensitivity for common EGFR mutations (ie, L858R mutation andClinical Lung Cancer May 2017 - e191IHC for EGFR Mutation Detection in NSCLCFigure 2 PFS (A) and
2782	Mutations in the White PopulationNina Turnsek Hitij et alClinical Lung Cancer May 2017 - e193IHC for EGFR Mutation Detection in NSCLCstudy demonstrated that PFS as well as
2783	 mutationepositive status, such asthe collective of patients with negative
2784	 and
2785	 mutation-specificin pulmonary adenocarcinoma: a comparison with
2786	 and mutationspecific IHC for common activating
2787	 and
2788	 binds to the N-terminus of p53 tumor suppressor and thuscompetes with
2789	 is mutually exclusive to
2790	 renders lung cancer cell line resistance to Nutlin-3a, aneffective
2791	 and
2792	 binds to p53 N-terminus and competes with
2793	 binds to p53 through its N-terminusTAD, the same site
2794	 binds to the N-terminus TAD of p53 and therefore can compete with
2795	 and
2796
2797	 as an alternative approach to promote cancercell survival when
2798	 overexpression renders lung cancer cells resistance to
2799	 competes with
2800	 and
2801	 and
2802	 and
2803	 using Nutlin-3a and
2804	 is located at the N-terminus transactivationdomain, which overlaps with the site for
2805	 competes with
2806	 overexpression is often found in human cancersas an approach to inactivate p53 [13], our data suggest that cancercells may up-regulate
2807	 impaired p53 acti-vation and cell growth inhibition by
2808	 and
2809	 and
2810	 supports bladder urothelial carcinoma cell aggres-siveness by promoting
2811	 grant
2812	88(19)withoutextracranialPD355(77)32450(70)(11)7334(16)(7)Maximum BM number for SRS eligibilityMU
2813	   loss   was   significantly   associated   with   worse
2814	   loss  seen   in  the  overall   population   was   not   observed   in   patients   receiving   perioperative   CT(adjusted
2815	   loss   has   an   unfavourable   prognostic   impact   in  NSCLC   patients   undergoing   curativesurgical   resection,   but   it   may   have   a  favourable   predictive   value   in   the   subgroup   of  patients   receivingperioperative   platinum-based
2816	  damageresponse  who  are  particularly  sensitive  to  CT,  radiotherapy  (RT)or  newer  anticancer  drugs  such  as  the
2817	  is  a  highly  conserved  protein  that  catalyzes
2818	  ubiquitin  ligase  also  plays  animportant  role  in
2819	  defectsexhibit  profound  sensitivity  to  specific  anticancer  agents  includingPARP  inhibitors  and  interstrand
2820	  protein  may   at  leastpartially  overcome  states  of
2821	  may   stimulate
2822	  in  tumor  cell  lines  and  human  malig-nancies  is  usually  associated  with  increased  sensitivity  to
2823	  immunoreactivity  on
2824	  loss  on  PFS  was  onlyseen  in  patients  not  receiving  perioperative
2825	  immunoreactivity  was   significantly  associatedwith  worse
2826	  loss  on  OSwas  only  seen  in  patients  not  receiving  perioperative
2827	  (adjusted
2828	  in  both  ADC  (unadjusted
2829	  damaging
2830	  and
2831	  and
2832	  repair  pathway  gene  expression  score  (RPS)system  to  quantify  the  efficiency  of
2833	  loss  is  a  functional  biomarker  of
2834
2835	  localization  and  activationfollowing
2836	  andXRCC3,  new  human  Rad51-family  members,  promote  chromosome  stabilityand  protect  against
2837	  and
2838	 functions as an oncogene by binding to EZH2and suppressing
2839	 is partially attributable to its repression of
2840	 is partially attributable to its repressionof
2841	 and
2842	 is the first lncRNA with markedly higherexpression in
2843	 resulting in reducing the expression level of
2844	 and
2845
2846	 forward 5′-AGAAGGCTGGGGCTCATTTG-3′ and reverse 5′-AGGGGCCATCCACAGTCTTC-3′;
2847	 contentwas stained with propidium iodide (PI) using the Cycle TEST
2848	 expression was higher in 7NSCLC cell lines than in
2849	 silences
2850	 knock-down affected the expression level of
2851	 protein and mRNA was upregulatedafter
2852	 inhibits
2853
2854	 expression level in 60 NSCLC tissues and corresponding adjacent non-tumor tissues was quantified by Quantitative real-time PCR analysisand normalized to
2855	 overex-pression might decrease
2856	 was overexpressed in gas-tric cancer tissues and that PCAT6 impact
2857	 was re-markably upregulated after
2858	, and EZH2 could directly bind tothe
2859	 exerts its oncogenic func-tion, at least partly, via binding to
2860	 and
2861	 and
2862	 was negatively regulatedby
2863	 expression and
2864	 could recruit
2865	 RNA arepresented as fold enrichment in
2866	 occupancy and H3K27me3 binding in the
2867	 and inhibiting tumor suppressor
2868	 is attributable to its repression ofLATS2 through association with the epigenetic repressor
2869	 up-regulates long non-codingRNA,
2870	 and
2871	 and
2872	 inhibitionsensitizes BRG1 and
2873	 interacts with
2874	 and
2875	 contributes to goodprognosis and can negatively regulate
2876	 and
2877	 and
2878	 and rs10505980 in KRAS, additional quality control of the genotyping was performed using the genotype calls in the  tumor
2879	  rs9582036  and
2880	 clones  of  each  reporter  gene  construct  were  prepared  for 1068Copyright © 2015 by the International Association for the Study of Lung CancerCopyright © 2015 by the International Association for the Study of Lung CancerJournal of Thoracic Oncology  ®  •  Volume 10, Number 7, July 2015
2881	 +
2882	 had a significant and concordant effect (Table 2): the RFS of patients  with  the AC  +
2883	 and
2884	 SNPs (rs7996030 and rs9582036) and one of the
2885	 for cancer-related
2886	 (hazard ratio) or
2887	 status,
2888	 translocation, but not with other featuresincluding age, gender, histology type, smoker status, lymph node me-tastasis status,
2889	-kinase/
2890	 K, p-AKT(Ser473), p-AKT (Ser 308) and
2891	 K, p-AKT (Ser473), p-AKT (Ser308), AKT, members of the PI3-kinase/AKTfamily, and cell cycle-related proteins such as
2892	 K,
2893
2894	 analysis) and racial disparities for
2895	 and
2896
2897	 ¼ adenosine kinase;
2898	 and 10 of 22 Stage IV pts responded (1
2899	 75 mg/m 2 and
2900	-positive non-small-cell lung cancer: results from a global phase 2 studyBenjamin J Solomon, Benjamin Besse, Todd M Bauer, Enriqueta Felip, Ross A Soo, D Ross Camidge, Rita Chiari, Alessandra Bearz, Chia-Chi Lin, Shirish M Gadgeel, Gregory J Riely, Eng Huat Tan, Takashi Seto, Leonard P James, Jill S Clancy, Antonello Abbattista, Jean-François Martini, Joseph Chen, Gerson Peltz, Holger Thurm, Sai-Hong Ignatius Ou, Alice T ShawSummaryBackground Lorlatinib is a potent, brain-penetrant, third-generation inhibitor of ALK and
2901	 and
2902	 positive and treatment naive (EXP1); 59 who were ALK positive and received previous crizotinib without (n=27; EXP2) or with (n=32; EXP3A) previous chemotherapy; 28 who were ALK positive and received one previous non-crizotinib ALK tyrosine kinase inhibitor, with or without chemotherapy (EXP3B); 112 who were ALK positive with two (n=66; EXP4) or three (n=46; EXP5) previous ALK tyrosine kinase inhibitors with or without chemotherapy; and 47 who were
2903	  or
2904	  or
2905	  scans  of  the  chest,  abdomen,  and  pelvis, and brain imaging by
2906	 and
2907	 analysis of
2908	 TKI with or without chemotherapy (EXP3B; n=28)≥2 previous ALK TKIs* with or without chemotherapy (EXP4–5; n=111)Pooled activity group (EXP2–5; n=198)
2909	 was collected, allowing analysis of
2910	 and
2911	 or
2912	 mutations and
2913	 was associated with improved
2914	 on
2915	 in patients with a
2916	 of 30 kg/m2 or higher, who are classified asobese, experience
2917	 in
2918	 for 2585 patients on the basisof their
2919	 in patientswith a
2920	 higher than30 was associated with improved
2921	   TKIs   have   been   proposed,including  protein   expression   of   EGFR   by   immunohistochem-istry,  gene   copy   number   determined   by   fluorescence   in   situhybridization  (FISH),   mutations   of   EGFR   or   KRAS,   andexpression  levels   of   downstream   pathway   markers   such   asphosphorylated
2922	 (tumor suppressor candidate 3), originally named N33, is lo-cated on human chromosome 8p22 [9], and is comprised of 11 exonsspanning 349,435 bp of genomic
2923	 promotescolorectal cancer progression and epithelial-mesenchymal transition (EMT) throughWNT/beta-catenin and
2924	 sequencing ofseveral randomly chosen qPCR products confirmed theidentity of the specific
2925	 and
2926
2927	 TGA TCT
2928	 heterozygous,
2929	 as a novel potential therapeutic target in non-small-celllung cancerMinwei Hea,b, Kangqi Lia,b, Chuanfei Yua,b, Bingfeng Lva,b, Ning Zhaoa,b, Jinhai Denga,b,Lulu Caoa,b, He Huanga,b, Ang Yina,b, Taiping Shia,b, Lu Wanga,b,⁎Ta Center for Human Disease Genomics, Department of Immunology, School of Basic Medical Sciences, Health Science Center, Peking University, Beijing 100191,
2930	 and related signaling molecules were induced activated after
2931	 resulted in decreased
2932	 [6] suggest poor prognosis of patient while an increasedlevel of tumor suppressor genes such as p53 [7] and
2933	 effector, dysregulation of
2934	 promotes cell pro-liferation along with the up-regulation of the phosphorylation of Erk1/2 and
2935	 and
2936	 expression showed a significantly lower
2937	 expression showed a significantly lower
2938	 in squamous cell lung carcinoma does not affect the
2939	 expression activates Erk1/2 and
2940	 were inhibited after
2941	 promotes cell proliferation by upregulating phosphorylation of Erk and
2942	 overexpression on the phosphorylation of Erk1/2,
2943	 overexpression on the phosphorylation of Erk1/2,
2944	 knockdown on the phosphorylation of ERK1/2,
2945	 knockdown on the phosphorylation of ERK1/2,
2946	 and
2947	 and
2948	 also resulted in reduced
2949	 and
2950	 and
2951	 is a
2952	 and
2953	 and
2954	 and
2955	 and
2956	 over-expression caused dramatic activation of Raf/Ras/Erk1/2 and
2957	 promotes cell pro-liferation via activating Raf/Ras/ERK1/2 and
2958	 level isup-regulated under the induction of hypoxia and
2959	 scans were performed (6 weeks and 24 weeks afterthe completion of radiation treatment) and
2960	 and
2961	 and BCL2, but no effect on
2962	 and
2963
2964	 mRNA in five NSCLC cell lines was significantly decreased following transfection with miR-195, which was determined by qRT-PCRusing
2965	 was decreased in five NSCLC cell lines when transfected with miR-195 with
2966	 protein level andsubsequently reduced the expression of
2967	 expression by si-MYB decreased MYB,
2968	 and
2969	 was determined using real-time PCR in 20 paired human NSCLC tissues and normalised against
2970	 via the miR-195/MYB axis, such as
2971
2972	 scanPET-avid tumor having
2973	 ¼ computed tomography; DLCO ¼ diffusing capacity of thelungs for carbon monoxide; ECOG ¼ Eastern Cooperative Oncology Group; FEV1 ¼ forcedexpiratory volume in one second; NSCLC ¼ nonesmall-celllung cancer;
2974	 or
2975	 drugs in themetastatic setting, it has been known for a decade that EGFRmutations, primarily located in the EGFR receptor
2976	 inhibitors with
2977	 and downstream survival and proliferation pathwayssuch as
2978
2979	 repair pathways related to homologousrecombination (eg,
2980
2981
2982	 inhibition and
2983	 inhibitorsto prevent homologous recombination and
2984	 or
2985	 and
2986	 mutations, whichare mutually exclusive with focal
2987	 amplification leadsto gefitinib resistance in lung cancer by activating
2988	 inhibition:
2989	 and
2990	 or
2991	 in theplatinum doublet arms for patients with
2992	 for the wholegroups of patients who had
2993	 for
2994	  60611,  USAi Division  of  Geriatrics,  Department  of  Medicine,  University  of  California  San  Francisco  and  San  Francisco  Veterans  Affairs  Medical  Center,  4150  Clement(181G),   San  Francisco,
2995	 mutation and
2996	 ¼ anaplastic lymphoma kinase; CCI ¼ Charlson comorbidity index; ECOGPS ¼ Eastern Cooperative Oncology Group performance status;
2997	 in the pem-brolizumab group, with
2998	 ¼ anaplastic lymphoma kinase; CCI ¼ Charlson comorbidity index; ECOG PS ¼ Eastern Cooperative Oncology Group performance status;
2999	 ¼ not reached;
3000	Abbreviations: CI ¼ confidence interval; irAE ¼ immune-related adverse event; NR ¼ not reached;
3001	 of
3002	 of the VPIþ NSCLC patientsand the VP
3003	However, in a subgroupanalysis of tumors with VPIþ and VP
3004	In another subgroup analysis of tumor withVPIþ and VP
3005	 for NSCLC patients with T3tumors, and the pooled analysis for T3 NSCLC patientswith VPIþ and VP
3006	 of T1a/VPIþ NSCLC pa-tients and T2a/VP
3007	 of T2a/VPIþ NSCLC pa-tients with T2b/VP
3008	 P-value Multivariate  analysis  for  OS
3009	  tyrosinekinase  inhibitor,  patients  in  whom  TV  decreased  more  than  38%at  8  weeks  had  a  significantly  better
3010	 and 10 of 22 Stage IV pts responded (1
3011	 75 mg/m 2 and
3012	  by  75%  and  also  the  expression  of
3013	  (95%  CI)  for  PFS  between  the
3014	 andrs11662595 mutation
3015
3016	 were markedly increased in A549 cells aftertransfection with both
3017	 in
3018	 protein stability, ligandaffinity and downstream signaling in A549 cellsIn order to explore the biological function of rs11662595 mutationand the underlying molecular mechanism, we first compared the pro-tein stability between the mutated and
3019	 proteinwas similar to that of
3020	 by 4-methylhistamine significantly increased theexpression of E-cadherin, an important epithelial hallmark, and de-creased the mesenchymal marker Vimentin in HRH4
3021	 (H), Snail (I), and Slug (J) mRNA in
3022	 and targets mediators of cell cycle pro-gression, metastasis, and chemoresistance (36); miR-126,which inhibits cell proliferation by targeting
3023	 TCT
3024	 acts as an oncogene in non-small cell lung cancer by epigenetically repressing
3025	 spongesmiR-101-3p to promote proliferation and metastasis of bladder cancer cells throughup-regulating
3026	 expression, patients with a profile of UDGhigh/BRCA1high had the shortest PFS and
3027	 expression in con-junction with other known biomarkers of pemetrexed sensitivity suchas TS and
3028	 (total N = 50)01234Intensity of BRCA1 (total N = 50)0123% TS (total N = 88)01234%
3029	 (89),
3030	 positivity and female gender statuswith better PFS and
3031	 expression with PFS or
3032
3033	 and UDG expression on survival outcomes as peme-trexed-induced genomic instability in tumors with low UDG may lead tomore reliance on other proteins of
3034	 inaddition to other proposed predictive and prognostic biomarkers suchas TS, FPGS, TTF-1, and
3035
3036	 and
3037	 repair suchas
3038	 = epidermal growth factor;
3039	 results in dimeriza-tion of two receptor molecules, and activates receptor autophosphorylation through
3040	Is  bind  to  the  intracellular  TK  domain  of
3041	 (%) PFS (mo)
3042	  status  by  fluorescence  in-situ  hybridization (FISH),  and  immunohistochemistry,  and  for  EGFR mutation  by
3043	 MUTATION exons 18, 19, 20, and 21 of the EGFR gene encoding partial  intracellular
3044	 = epidermal growth factor receptor; EORTC = European Organization for Research and Treatment of Cancer; IFCT-GFPC = Intergroupe Francophone de Cancerologie Thoracique–Groupe Francais de Pneumo-Cancerologie; ILCP = Italian Lung CancerProject;
3045	 mutations  in  tumor  specimens  from  lung  cancer  pa-tients,  including  direct  sequencing,  Scorpion
3046	  in  order  to  detect
3047	-TKI  were  re-ported  in  EGFR  wild  type  NSCLC  patients  whose EGFR mutation status was detected by the direct
3048	 and PNA-LNA PCR clamp techniques, are capable of detecting ≥1% mutant
3049	-TKIs in  NSCLC  patients  with  EGFR  mutation-negative  or unknown  status  might  have  a  detrimental  effect  on PFS and
3050	 and
3051	)Human UGT proteins are clustered into four families includingUGT1, UGT2, UGT3 and
3052	 topoisomerase I inhibitor, by
3053	 and
3054	 and its use in conjunction with
3055	 screening in the high-risk popula-tion has resulted in an increase in detection of early-stage NSCLCand associated improvement in
3056	 AND
3057	 and
3058	 and
3059	 mutation was associated with improved PFS, but
3060	 or
3061	 mutations andreported an objective response rate of 31% and a promising 57% twelvemonth
3062	 and
3063	 directly binds to the 5′-UTR of the drug-resistance genes
3064	 and
3065	 through direct interaction with its 3′-UTR andUBE2C directly binds to the promoter of
3066	/
3067	 and
3068	 and
3069	 or
3070	 and
3071	 and
3072	 and
3073	 and
3074	 and
3075	 and
3076	 and
3077	 and
3078	 and
3079	 and
3080	 and
3081	 directly binds to the promoter of
3082	 only regulates
3083	 and
3084	 and
3085	 may directly tar-get
3086	 andABCG2/
3087	 promoter may acti-vate ERCC1 promoter, mediated by
3088	 directly targetsthe
3089	 upregulates
3090	 and ABCG2were increased in A549 cells overexpressing
3091	 and
3092	 increased
3093	 and
3094	 and
3095
3096	 or
3097	–1 or si
3098	 or
3099	 and
3100	 knockdown combinedwith DDP treatment reduced
3101	 and
3102	 directly binds to the promoter of
3103	 and pGL3–290 (−110~ + 180) for
3104	 binding sites in the 5’UTR sequence of
3105	 or
3106	 using the siRNA decreases but overexpressing UBE2C increases UBE2C levels within the promoter region of
3107	 and
3108	 and
3109	 dose-dependently (i) and time-dependently (j) increased the mRNA and protein levels of
3110	 and
3111	 and
3112
3113	 and
3114	 and
3115	 modulatesDDP resistance via regulation of anti-drug genes
3116	 and
3117	 and
3118	 and
3119	 and
3120	 and
3121	 and
3122	 and
3123	 mediated miR-495 reverses DDP resistance via regulation of
3124	 incisplatin resistance, miR-495 directly bound to the 3′-UTR of UBE2Cand UBE2C directly bound to the 5′-UTR of
3125	 and
3126	 and
3127	 is required for the destruction of mi-totic cyclins, such as cyclin B, to promote cell cycle progression from Mto G1 phase; UBE2C expression was accompanied by that of other bio-markers such as prolactin-inducible protein, AZGP-1, and
3128	 serves as a transcription factor for anti-drug genesABCG2 and
3129	 directly bound to the 5′-UTR of
3130	 by directly target of
3131	 and
3132	 (h),
3133	 and
3134	 iso-form expression and
3135	 TKI trialsDrugTrialTumourRegimeNumber patientstreatedAdverse effectsEKB-569Phase 1Advanced solidtumoursPKI166Phase 1Advanced cancersPart 1: 14 days of a 28 daycyclePart 2: continuous dailyadministration50 
/600 mg/day continuousadministration3032Max tolerateddose75 mg (intermit-tent schedule)220 mgDiarrhoeaRashNausea andvomitingDiarrhoeaFatigue andrashReversible TAelevationsNausea andvomitingCI-1033Pan-erbBinhibitorOSI-774(Tarceva)Phase 1Non-haematologicalmalignanciesEscalating doses68 PatientsPhase 2NSCLC150 mg daily56 PatientsAcneiform rash150 mgDoses between 2and 220 mg/dayDiarrhoeaStomatitis and rashOSI-774(Tarceva)Phase 3(TALENT)NSCLCChemotherapy150 mg orplacebo dailyDiarrhoea6
3136	 TKIs (by blocking the further transfor-mation and proliferation of EGFR positive preneoplas-tic lesions, inhibiting angiogenesis and
3137	 TKIs were found to result in significantlybetter PFS and RR, but not
3138	 for patients with
3139	 were noted onlyin patients with activating
3140	 mutations such as the gatekeeper T790Mpoint mutation, which is the most frequently occurringmechanism of resistance46; (2) activation of downstreamsignaling pathways, likely on account of acquired muta-tions such as mutations in
3141
3142	 inhibitor cabozantinib admin-istered in combination with erlotinib to patients whohad
3143	 kinase causes drug resistance byincreasing the affinity for
3144
3145	 inhibitors occasionallyharbor
3146	 amplifi-cation: a potential mechanism of acquired resistance to
3147	 and
3148	 60637, USAb Department of Radiation and Cellular Oncology, University of Chicago, Chicago, IL, USAc Department of Neurology and Rehabilitation, University of Illinois at Chicago, Chicago, IL, USAd Department of Medicine, Section of Hematology and Oncology, University of Chicago, Chicago, IL, USAa r t i c l ei n f oa b s t r a c tWe present a young woman with
3149
3150	with dif-fusion weighted MRI (DWI) [86], MRI with ferumoxytol contrast agent,or dynamic O-(2-[18F]fluoroethyl)-L-tyrosine
3151	 mutations or
3152	 mutation-positive NSCLC andbrain metastases(including LM) demonstrated encouragingintracranial antitumour activity; among 20 patients with brainmetastases evaluable for RECIST assessment, 3 had confirmedand 3 unconfirmed
3153	 and
3154	 fusion oncogene is detected in 1–2% oflungTable 2Trials evaluating efficacy of
3155	 inhibitor dabrafenibwith the
3156	 mutations,
3157	 and
3158	 and
3159	 or
3160	 sequences of the
3161	 minimalpromoter regionto determine the frequency ofWe screened by direct
3162	 sequence (NM_005056)was searched by the server, which provided an
3163	 in preneoplastic and cancercells may result from
3164	mutation status and treatment for PFS, with a largerimprovement in PFS for patients with EGFR mutations(EGFR positive:
3165	 wildtype:
3166	 (EGFRpositive:
3167	 TKIs for
3168	 TKImaintenance therapy had a significant effect on
3169	 mutation, maintenance EGFR TKI resulted ingreater gains in PFS, but there was no differential ef-fect on
3170	 with few adverse events to support the use ofpemetrexed and
3171	 and
3172	 for the 221 patients with known
3173	 status (wild type)No local intracranialmetastatic treatmentNo TKI treatmentNo chemotherapyTotal pointsAbbreviations: APA ¼ adjusted prognosis analysis; CI ¼ confidence interval; EGFR ¼ epidermalreceptor;
3174	 and
3175	 for
3176	 ¼ epidermal growth factor receptor;
3177
3178
3179	   analysis   in   non-small   cell   lung   cancerTao   Jiang 1,   Shengxiang   Ren 1,   Caicun   Zhou∗Department  of  Medical  Oncology,  Shanghai  Pulmonary  Hospital,  Tongji  University  School  of  Medicine,  Shanghai  200433,
3180	)  activated  mutation  or
3181	  and  alectinib  orceritinib  for
3182
3183	 ARMS ME-PCR digital  PCR ARMS mutant-enriched  sequencing ME-PCR BEAMing Sequenom HRM ARMS AS-APEX AS-APEX inhibiting  PCR-quenching  probe  method ARMS DHPLC MEL  ME-PCR PNAClamp PNA-LNA  PCR  clamp ARMS ARMS ARMS cobas@
3184	  mutations  in  circulating  tumor
3185
3186	  mutated  caucasian  NSCLC:  circulating-freetumor
3187	  T790M  in  plasma  cell-free
3188	  mutations  at  codon  12  in  plasma
3189	  mutated  plasma
3190	 was detected in A549, H1299 and
3191
3192	 functions as a ceRNA to antagonize the effect ofmiR-145a-5p on the down-regulation of
3193	 pro-motes non-small cell lung cancer progression by up-regulating
3194	 and
3195	 and
3196	, AXL Receptor Tyrosine Kinase; ZEB1, zinc finger E-box-binding homeobox 1; EMT, epithelial-mesenchymal transition; CK1α,casein kinase 1 alpha; GEO, Gene Expression Omnibus; DMSO, dimethyl sulfoxide; RMA, robust multiarray analysis; FC, fold change; GO, Gene Ontology; BP, biological process; CC,cellular component; MF, molecular function; KEGG, Encyclopedia of Genes and Genomes; DAVID, Database for Annotation, Visualization, and Integrated Discovery; CMAP, ConnectivityMap; ORA, over-representation analysis; YPEL1, Yippee Like 1; YPEL2, Yippee Like 2; YPEL5, Yippee Like 5; CREBRF,
3197	 (up-regulated), CREBRF (up-regulated), and
3198	 (up-regulated),ITGA2 (down-regulated), and
3199	 plays pro-apoptotic role and is also in-volved in
3200	 and
3201	 and
3202	 signaling in cancer cells through interaction with the tumorsuppressor
3203	 regulates cofilin activity and colon cancercell migration by targeting
3204
3205	 and
3206	 Z circulating tumor cell; NSCLC Z non-small cell lung cancer;
3207	 imaging); LR and
3208	 Z computed tomography;
3209	 assays may also usefully complement
3210	 (SUVmax) of the primary tumor andregional lymph nodes on
3211	 adducts can block
3212	 with
3213	  [42],
3214	  protein  (P53˛),  the  TP53  genealso  produces  TP53ˇ  through
3215	  isoforms  have  distinct  preferences  in  binding  todifferent  target  promoters  [52]:  TP53˛  preferentially  binds  prefer-ably  to  the
3216	  binding  domain  but  stillcontains  the  domain  that  interacts  with
3217	  [70],  and  isthus  up-regulated  in  most  cancers  and  acts  as  an  oncogene  toaffect  hundreds  of  cancer-associated
3218	  affects  cancer  progression  throughcontrolling  many  cancer-associated
3219	  directlyreduces
3220	  and
3221	  antagonizes
3222	  regulates
3223	  family  have  been  shown  to  phosphory-late  SR  proteins  at  sites  distinct  from
3224	),  among  which  CLK1,  CLK2and  CLK4  are  expressed  ubiquitously,  whereas
3225	  has  also  been  found  tofunction  as  a  key  regulator  of  thousands  of  periodical
3226	  binds  to  a  vari-ety  of  newly  transcribed  pre-mRNAs  and  is  mainly  accumulatedin  the  nuclear  speckles  where  the  splicing  occurs;
3227	  domainphosphorylation  in  an  SR  protein  through  the
3228
3229	 [18],
3230	 and
3231
3232	 expression and increased expression of p53 and thephosphorylated form of
3233	 negatively regulates
3234	 is a directtarget of miR-30e-5p and that miR-30e-5p inhibitsUSP22-mediatedregulation of Sirt1, p53, and
3235	 and
3236	 and
3237	 overexpression significantly increased
3238	 and increased p53 and p
3239	 signaling by deubiquitinating
3240	 negatively regulates the
3241	 triggers au-tophagy via stabilizing Sirt1 and attenuates the chemosensitivity of
3242	 gene mutations and
3243	 gene mutations and
3244	 samples werescreened for somatic mutations in
3245	-positive cases, it was not possible to draw any conclu-sions with regard to the relationship between the ALK status and TAMinfiltration; however, wild-type
3246	 ¼ chemotherapy; DMs ¼ distant metastases;
3247	 ¼ chemotherapy; DMs ¼ distant metastases;
3248	 ¼ hazard ratio; met ¼ metastasis;
3249	 ¼ hazard ratio; met ¼ metastasis;
3250	 and
3251	 mutationsand
3252	 and
3253	 and
3254	 concentrations of
3255	 TKIs allowed mostly for increase in peak
3256	 TKI for theprimary treatment of EGFR-mutated patients with brain metastases atbaseline remains unknown, as the
3257	-mutated NSCLC patients with brain metastases initially treatedwith an EGFR TKI (almost exclusively – erlotinib), SRS or WBRTshowed apparently better
3258	 TKI offered the longest
3259	 damagerepair and direct stem cell killing by
3260	 and
3261	 estimates of 33%, 59%, 76% and 100%,providing additional rational to apply the updated Lung-molGPA in-corporating
3262	 and systemic plasma samples analysis for alectinib,one of the second generation
3263	 concentration was 63–94% of that measured in theplasma, possibly because this agent, unlike crizotinib and another nextgeneration
3264	 in 29%,
3265	 or
3266	 and
3267	 or
3268	 positiveHMLN and with patients with
3269	 = computed tomography;
3270	 might be related to thefact that it inhibits
3271	  is  supported  by  the
3272	   bythe  interaction  between  berberine  and
3273	 werethe upstream molecules of
3274	 formation,
3275	 deficient breast can-cer cells to
3276	 and Akt-dependent down-regulation of
3277	 levels and enhanced protein expression of bcl-2, HIF-1α, VEGF, and IL-8, which was re-versed by co-incubation with MK2206 (an
3278	 and
3279	  methyltransferase  inhibitor  [43]  and  deter-mined  that  treatment  with
3280	 replicated the association in an independent sampletheSMYD2,cohort,two positionsoverlapping withFive variants out of 28 analyzed were associated with a
3281	 and TTP was lower in the
3282
3283	 is overexpressed inmultiple cancer cells [10], and in addition to histones, methylates otherprotein substrates, including
3284	 is linked to cancer chemotherapyimprovement, through the reduction of
3285
3286
3287	 is a transcription factor involvedin stress and
3288	 and
3289	 methylation by
3290	 methylates
3291	 and NPA, but
3292	 was reversed after pretreatment withNAC (5 mM, 1 h),
3293	 contributed to the OSI-induced cell viability decrease and apopto-sis in NSCLC cellsThe effects (pro-survival or pro-death) of the
3294	 and c-caspase 3, whichare protein biomarkers of apoptosis (Cohen, 1997), were decreasedunder pretreatment with NAC (5 mM, 1 h),
3295	 is
3296	 in NSCLC cells, and the gener-ation of
3297	 is an advisory board member for Roche; JN hasreceived honoraria from Astra Zeneca and Roche and a travel grantfrom Roche; JL has no conflicts to declare; DT has received fees forconsultancy/honoraria from Pierre Fabre, Eli Lilly, Pfizer, Novartis,Astra Zeneca, Celgene, Boehringer Ingelheim, BMS, Roche and con-tributions to cost of events from Novartis, MSD, Ipsen, Eli Lilly, Roche,BMS;
3298	 and
3299	  mutation-positive  patients are  a  specific  subgroup  of  patients  with  NSCLC,  in whom
3300	  and
3301	  or
3302	  and
3303	 chest with contrast, CT abdomen and pelvis withcontrast, bone scan,
3304	D T Cell Infiltration in the Cancer Nest; D, CD4D T Cell Infiltration in the Stroma; E,
3305	 ¼ Cluster of differentiation 4; CD8 ¼ cluster of differentiation 8;
3306	 ¼ cluster of differentiation 4; CD8 ¼ cluster of differentiation 8;
3307	 ¼ cluster of differentiation 4; CD8 ¼ cluster of differentiation 8; DFS ¼ disease-free survival;
3308	 ¼ cluster of differentiation 4; CD8 ¼ cluster of differentiation 8; DFS ¼disease-free survival;
3309
3310	 tyrosine kinaseinhibitor gefitinib ("Iressa") and the
3311	 in non-small cell lung cancerXiaobing Chen a,b,⇑,1, Guoyong Chen b,1, Xinguang Cao a, Yudong Zhou b, Tiejun Yang a, Sidong Wei ba Department of Oncology, Henan Cancer Hospital, The Affiliated Cancer Hospital of Zhengzhou University, Zhengzhou, Henan Province 450008,
3312
3313	 associates with and inhibitsthe transcription factor
3314	 andATG7, the most important components for the formation of auto-phagosome, were decreased when
3315	 and
3316	 inhibits the increase ofATG5 and
3317	 and
3318	-specific primers, we found that BTG3 mRNA is ex-pressed as two variants: full-length and an alternatively splicedversion lacking 144 bps, which was confirmed by
3319	 hypermethylationand
3320	 gene expression in the p53-dependent and -independent cellular response to
3321	 sequencing ofLM in
3322	 mutation in 29% of patients, the
3323	 andPIK3CA mutations in 2%, each,
3324	 TKI therapy after diag-nosis of LM remains an independent predictive factor of extendedsurvival (median
3325
3326	 TKI, with modest benefitin outcome with a median
3327	 TKI pre-treated EGFR-mutant NSCLCpatients with LM (confirmed by
3328	 and
3329	 penetrance of
3330	 inhibitor has demonstratedactivity in crizotinib-resistant patients with brain metastasis in aphase I/II trial [90] and in a recent phase III study, alectinib signif-icantly improved progression-free survival over crizotinib as first-line treatment in ALK-positive Japanese NSCLC patients, and evenin patients with brain metastasis (n = 43,
3331	 and
3332	 and
3333	 kinase [104] anddabrafenib, another BRAF kinase inhibitor, in combination withtrametinib, a
3334	 and
3335	  deacetylates  varioustranscription  factors  involved  in  stress  response,  cell  cycle,  and  apo-ptosis,  such  as  p53,  Ku70,  nuclear  factor-kB,  FOXO,  and
3336	  expression  in  NSCLC  correlates  with  reduced  overall  survivalUnivariate  and  multivariate  analyses  for
3337	  was   sig-nificantly  correlated  with  higher  T  stage,  larger  tumor  size,  andshorter
3338	  has  beenexplained  by  deacetylation  of  tumor  suppressor  gene  products,such  as  p53,  Ku70,  NF-kB,  FOXO,  and
3339	T group, 13 patients hadTable 3 Treatment EfficacyTotal(n [ 74)RT(n [ 56)CRT(n [ 18)Response, n (%)CRPRSD
3340	 ¼ hazard ratio;
3341	 mutationwith
3342	 exon19deletion, EGFR L858R, or
3343	, while cohort 2contained 12% of patients with tumors harboring mutant EGFR or
3344	 forward: 5′-TCGGTAACTGACTTGAATGTCCA-3′ and reverse: 5′-TCGCTTCCCTGTTTTAGCTGC-3′;
3345	 forward: 5′-GGCACTGCTTTCTACTCATCGA-3′and reverse: 5′-AGTTGGTGATTTTTATGTACGGAACA-3′;
3346	 status and
3347	 and
3348	 extraction from FFPE tissueusing QIAamp DNA Micro kit (Qiagen, Hilden, Germany), theTherascreen
3349	 gene and patients with
3350	 and
3351	 and
3352	 could enhance cisplatin-induced apoptosis in NSCLC,although it is unable to disrupt the interaction between
3353	   generation   in   H1650   and   H1975   gefitinib-resistant   NSCLCcells   leads   to  impairment   of   growth   and   induction   of  apoptosis,   whereas   modulation   of
3354	  and  triggers  specific
3355	  and
3356	  and
3357	  degradation  andsuppresses  the  EGFR  signalling  pathway  in  H1975  cellsInhibiting
3358	  is  essential  for  Shikonin-induced  apoptosis  in  H1975cells  and  that  the  apoptotic  effect  is  dependent  on  the
3359	  mutation  by  activation  of  NOX3,  resulting  in  exces-sive  increases  in
3360	  and  Bcl-2  family  mem-ber  degradation,  which  are  initiators  or  executors  of  apoptotic  celldeath  that  lead  to  caspase-3  activation  and  subsequent  cleavageof
3361	  overproduction  also  triggers
3362	  overproduction  induces
3363
3364	 or TT genotype exhibited a significantly better
3365	 or TT genotyperevealed a significantly better
3366	 was significantly associatedwith
3367	 and
3368	 and
3369	 - computed tomography CTCAE - common terminology criteria for adverse events   DSB - double-strand breaks  Fpc - foci per cell G - grade of adverse effects as per Radiation Therapy Oncology Group GalliPET - clinical trial investigating Gallium-68 ventilation/perfusion PET/CT  γ-H2AX - phosphorylated histone H2AX Lung V20 - the volume of lung receiving at least 20Gy of irradiation  MLD - mean lung dose  N
3370	 repair and increased clinical
3371	 and NOR, were previously exposed to RT before assessing their
3372	  (Promega,  Madison,  WI,   USA),  the
3373	  copy  number  displayeddecreased
3374	  was   normalized␤-actin
3375	  expression,  wedetected  the  relative  DENND2D
3376	  copy  number  and  mRNA  expression  werenormal,  H2170,  the  amount  of
3377	  blocked  the  death  domain  of  tumor  necrosis  factor  receptor1  (
3378	   and
3379	 TKI(gefitinib), improved PFS, ORR, and
3380	 benefit with afatinib com-pared with chemotherapy in patients with advanced lung adenocarci-noma and del19
3381	 benefit specifically among patients with del19-positiveNSCLC, overall analysis of the LUX-Lung 3, LUX-Lung 6, and LUX-Lung7 data highlight the consistent OS benefits observed with first-lineafatinib, independent of
3382
3383	 when compared with gefitinib as first-linetherapy in lung adenocarcinoma and a PFS and
3384	 and
3385	 fusion and
3386	 and
3387
3388	 mutation and
3389	 proto-oncogene (MET), BRAF, and
3390	 mutations and sensi-tivity to gefitinib and erlotinib in lung adenocarcinoma, typically in patients with modest tobacco exposure EGFR
3391	 and
3392	 binding protein (CREBBp), E1A binding pro-tein p300 (Ep300), and LFF as well as pTEN mutations,
3393	  has  been  shown to preferentially eliminate clonogenic survivors to
3394	 wild-type patients showed that front-line EGFR TKI was a harmful strategy for them with
3395	 mutants  suggested  that  erlotinib  provided  a  DFS  advantage with
3396	 mutants and powered to exam-ine
3397	 and HER3 in NSCLCHER2 and HER3 (also known as
3398	 has no known high-affinity ligand and therefore uses homo- or heterodimerization for activation, and HER3 has no
3399	 and
3400	  mutations  are  relatively  rare  in  lung cancer, the rate of detection can be enriched by testing never-smoker patients with adenocarcinoma or adenosquamous his-tology without an
3401	 mutations are mutually exclu-sive with point mutations in EGFR, K
3402	 and
3403	 insertion mutation in the
3404	-positive tumors  to  small  molecule ALK
3405
3406	 in multiple randomized phase III studies of
3407	 Inhibitors: Alectinib and CeritinibAlectinib (RO5424802) is a highly potent and selective TKI targeting ALK, but not
3408	 and
3409	 facilitateshepatocellular carcinoma invasion and metastasis via activating
3410	 influencesmurine intestinal homeostasis and cancer, targeting Notch, Jun, and
3411	 and
3412	 and
3413	 (26%) and
3414	 and
3415	 mutations, 1 PIK3CA, STK11,
3416	 positive tumors withco-mutations and 71% of
3417	 difference was seen in either
3418	 and
3419	 mutations were not sig-nificantly associated with
3420	 mutations (either alone orwith a co-mutation) had significantly worse
3421	 or
3422	 or DFS, between patients with and without
3423	 and
3424	 was not significantly different be-tween the groups, which potentially may be explained by the sub-sequent use of targeted
3425	 muta-tions were associated with worse DFS but not
3426	 mutant vs EGFRwildtype (E, G),
3427	 mutation waspredictive for worse
3428	 mutations alone showed no
3429	 than
3430	 and
3431	 mutation was associated withworse DFS and worse
3432	 and
3433	 and
3434	 wereseen as early event clonal mutations, whereas
3435	 comutation status combined with
3436	 and
3437	 [25] and
3438	 andp38 itself and can be triggered by endogenous
3439	 for
3440	 (with
3441	 (with
3442	 and
3443	 in non-small cell lung cancerDi Chen a,1, Weijie Guo a,b,1, Zhaoping Qiu a, Qifeng Wang b, Yan Li b, Linhui Liang b, Li Liu b,Shenglin Huang b, Yingjun Zhao b,*, Xianghuo He a,b,*a State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Renji Hospital, Shanghai Jiao Tong University School of Medicine,Shanghai 200032, Chinab Fudan University Shanghai Cancer Center and Institutes of Biomedical Sciences, Shanghai Medical College, Fudan University, Shanghai 200032, ChinaA R T I C L
3444	 response elements are present in the promotersof metastatic genes, such as MMP9, MMP14, and
3445	 and
3446	 and
3447	 (CellSignaling, USA), Caspase-8 (Cell Signaling, USA), Bcl-2 (Cell Signaling,USA), Mcl-1 (Cell Signaling, USA), Bax (Cell Signaling, USA),
3448	 and
3449	 promotes tumorcell proliferation through
3450	 family in several non-small cell lung cancer (NSCLC) cell lines, we foundthat compared with that in human bronchial epithelial (HBE) cells, the mRNA expression levels of fiveCOMMD genes including COMMD3, COMMD4, COMMD5,
3451	 interacted with the
3452
3453	 and
3454	 by itselfhas very little transcriptional activity; it cooperates with the
3455
3456
3457	 Vii
3458	 weregenerated by PCR amplification from c
3459
3460	 genes includingCOMMD3, COMMD4, COMMD5,
3461	 mRNA expression level was analyzed by Q-PCR in four NSCLC celllines and
3462	 was detected by western blot in four NSCLC cell lines and
3463	 had no obviouseffect on the cell cycle of
3464	 may be an interacting pro-tein in tandem affinity purification screens using
3465	 bound with
3466	 and
3467	 couldalso interact with
3468	, we determined the critical region in TFDP1 required for interac-tion with
3469	 and
3470	 interacts with
3471	 and
3472	 and either HA-tagged wild type (WT) or deletion mutants of
3473	 and either V5-tagged wild type (WT) or deletionmutants of
3474	 and
3475	 and
3476	 had less effect on cellgrowth and did not affect cell cycle in
3477	 might be the interacting pro-tein of
3478	 was necessary and sufficient for
3479	 protein such as
3480	 family members could also bind with TFDP1and play function similar or opposite to
3481	 transcriptional activity is regulated by interac-tion with p53,
3482	 to
3483	 could facilitate the dissocia-tion of these repressor proteins from
3484	 facilitates
3485	 ligases by preventing
3486	 expression in SPC-A1 and NCL-H1299 cells after transfection with DANCR orshDANCR, normalized to
3487	 and
3488	 fusions, acti-vating
3489	 GTPase is nottherapeutically druggable at present, there are precision therapies ap-proved for the clinical treatment of NSCLC tumors bearing activatingreceptor tyrosine kinase mutations, including EGFR, ALK, ROS1, HER2,and
3490	 and
3491	 amplification isprevalent in both squamous and non-squamous NSCLC, and
3492	, canin turn counteract EMT and metastasis through direct binding and re-pression of ZEB1 and
3493	 inhibitor gefitinib, a phenotype correlated withmiR-200-mediated reduction of
3494	 and
3495	 kinase, whichsubsequently phosphorylates and activates
3496	 kinase re-duced
3497	 as an alter-native mechanism of
3498	 supports the possi-bility of conserved mechanisms of TGFβ-mediated resistance in METexon 14 deleted NSCLC treated with crizotinib and in
3499	 signaling causes resistance to
3500	 and
3501	 kinase domain mediate
3502	 and
3503	 and
3504	 mutations or
3505	 þ ðSi;j
3506	 in twoBRCA1 and
3507	 rearrangementsare either inversions or translocations of the ALK-tyrosine kinase(-
3508	 and
3509
3510	 and
3511
3512	 rearrangement with expression of
3513	 and
3514	   followed   by   amplifica-tions  of   exon   18—21   of
3515	   is   acti-vated,  the
3516	   binds
3517	  mutationspredict  response  to
3518	 transcript in each sample was standardized with the geometric mean of PBGD, hMRPL19 and
3519	 transcript in each sample was standardized with the geometric mean of PBGD, hMRPL19 and
3520	 transcript in each sample was standardized with the geometric mean of PBGD, hMRPL19 and
3521	 transcript in each sample was standardized with the geometric mean of PBGD, hMRPL19 and
3522	 in PC-9 cells, which wasfurther accelerated by suppression of
3523	 accelerated the activa-tion of
3524	 with gefitinib accelerated the activation of
3525	 inhibitors occasionally harbor
3526	 ¼ hazard ratio; I ¼ IALT; IALT ¼ InternationalAdjuvant Lung Cancer Trial; J ¼ JBR10;
3527	 comutation status combined with
3528	 mutation on survival in patients with
3529	 repair by
3530	 ¼ hazard ratio; I ¼ IALT; IALT ¼ InternationalAdjuvant Lung Cancer Trial; J ¼ JBR10; N ¼ number of patients used in the multivariable statistical analysis;
3531	 benefit was found for sequential chemotherapy with an increased
3532	  8 weekswith sequential chemotherapy was associated with better
3533	 ligand
3534	 and
3535	 by its ligand
3536	 (sc-82428),
3537	 in lung cancer cells, we stimulated A549 and PC9cells with different concentrations of
3538	 binding to
3539	 siRNA and siRNA control and then stimulated with 20 nmol/L
3540	 expression using XCR1 siRNA inA549 and PC9 cells blocked XCR1 and abolished the role of
3541	 couldpromote lung cancer cell migration by activating
3542	 mRNA level wasslightly evaluated after
3543	 was reported to increase theexpression of matrix metalloproteinase 2 (MMP2) and
3544
3545	 by siRNA obviously abolished theeffect of
3546	 and p-STAT3 in both A549 and PC9cells after
3547	 and
3548	 significantly promoted thephosphorylation of
3549	 for 48 h, or knocked down of
3550	 in bone tissueactivating
3551	 could up-regulate PIM1, JunB and TTPwhile knockdown of
3552	 and
3553	 and
3554	 could possibleactivate JAK2/STAT3 pathway, which might explain the regulationrole of XCR1 in
3555	 and
3556	 and
3557	 and
3558	 and
3559	 or
3560
3561	 signalling, such as
3562	  testing  because  in  both  cases  the specimens tested were resected tumours and one patient was  reported  to  have  a
3563	 and
3564	 mutations  and
3565	  mutations  and
3566	 signalling, such as
3567	 L858R  mutation  under  the  control  of  the
3568	 and loss of
3569	 knockout mice have low expression of
3570	 inactivation occur, these same alveolar type II cells might subsequently transform to SCLC and become independent of
3571	 kinase causes drug resistance by increasing the affi  nity for
3572	 amplifi cation leads to gefi tinib resistance in lung cancer by activating
3573	 loss in resistant
3574	-based gross tumor volume (CT-GTV) wascontoured on the CT component of the
3575	 and
3576	-adapted 3DCRT,none of PET parameters, including all of the volumetric factors,were significantly associated with
3577	 and
3578	 reduced more than gross tumor volume on
3579	 fusion,
3580	 mutationsor
3581	 amplificationand
3582	 exon 14 mutation was sig-nificantly higher than in patients harboring
3583	 on overall survival of
3584	 and
3585	 exon 14 wild type andKRAS mutation but more than patients with
3586	 rearrangement and
3587	 exon 14 mutation in stage IV NSCLC patients,particularly among those who have already tested negative for othergenetic driver mutations such as EGFR, KRAS, ALK, and
3588	 exon 14 in comparisonwith MET-wild-type and other genomic biomarkers such as EGFR,KRAS, or
3589	 and
3590	  inhibitors  and  immu-notherapy  or  alternatively  improve  a  multilevel  mitogen-activated protein kinase (MAPK) pathway blockade by combining with
3591	  and
3592
3593	  and
3594	 V600E mutation results in constitutive acti-vation of its serine/threonine kinase, with a high dependency on downstream
3595	 mutants versus
3596	 was found with advanced IIIB to IV stage
3597	 inhibitor trametinib has also been approved (in 2013) as monotherapy for patients with advanced melanoma with either a
3598	 Mutations in Lung CancerBRAF  mutations  are  detected  in  approximately  2%  to 4% of lung cancer, hence occurring at a lower frequency than
3599	 V600E mutation had shorter disease-free survival (DFS) and
3600
3601	 between
3602	  inhibitors  (PD0325901  and  CI-1040)  have also shown activity in in vitro and in vivo preclinical models of NSCLC with
3603	 inhibitors (86%) were used after at least one line of chemotherapy, five patients received BRAF inhibitors as first line, among who three achieved a
3604	 using a
3605	 inhibitors and had a significantly poorer  outcome,  although
3606	 inhibitor selumetinib is  also  being  assessed  in  a  phase  II  study  in  nonmelanoma tumors with
3607	  inhibitor  therapy  demonstrates activity in NSCLC; however, this activity is inferior to previ-ous observations using
3608	  inhibitors  are  being  thoroughly  characterized in melanoma and consist of elevated expression of the kinases CRAF, COT or mutant BRAF, activating mutations in neuroblas-toma
3609	 V600E-mutated NSCLC  treated  with  dabrafenib,  molecular  profiling  revealed three new acquired mutations in KRAS, TP53, and
3610	 and
3611	 alterations, BRAF amplifications,
3612	 inhibitors but are pos-sibly  sensitive  to
3613	 with
3614	 and/or
3615	 mutation predicts sen-sitivity to
3616	  and
3617	 and
3618	 and
3619	 inhibitor (BRAFi) dabrafenib (D) in combination with the
3620	  and
3621	 inhibitor with activity in models of acquired resistance to
3622	 76% 24%
3623	 and
3624	 when
3625	  inhibitor  to  be approved  by  the  US  Food  and  Drug  Administration; however, it has a very low
3626
3627	  is  a  reliable  method  to determine  the  genetic  characteristics  of  leptomeningeal metastasis  because  circulating  tumour
3628	  liquid  biopsies (collected after
3629	  when  patients  developed leptomeningeal  metastasis  and  were  resistant  to
3630	 Thr790Met mutations and a higher frequency of
3631	 copy number gain and
3632	  amplification  is  confirmed, studies will be needed to identify the MET inhibitor with the best ability to penetrate the
3633	 alone, 22% by
3634	 circulating tumour
3635	 cytology and EGFR-mutated
3636
3637	 clearance and six patients had a substantial decrease in their EGFR-mutated
3638	  mutations  that  were  resistant  to gefitinib,
3639	  cytology (in  all  cancers)  or  flow  cytometry  in  haematological cancers;  and  radiographic  assessment  with  complete contrast-enhanced  neuro-axis
3640	 mutations or
3641	 fusions  and
3642	  cytology,  of  which  17  had
3643	 samples were available for
3644	 cytologic negative conversion in 10 of 25 patients; erlotinib had a better cytologic conversion rate than gefitinib: 64·3% vs 9·1%; p=0·012Complete response in 1 patient, partial response in 2 patients, stable disease in 2 patients; median survival time after combined treatment: 9 monthsAfter high-dose treatment: radiological improvement in 3 of 10 evaluable patients; improved neurological function in 6 of 12 patients; in both groups: median overall survival: high-dose group 6·2 months vs standard dose 5·9 months (p=0·94)One case of dose-limiting toxicity at 1000 mg; median overall survival: 3·5 months; neurological progression-free survival: 2·3 months; CSF cytology clearance in 1 patient; improved neurological function in 4 patientsBoth univariate and multivariate analysis showed that
3645	 samples available, the mean reduction in  the  number  of  EGFR-mutant
3646	 TKIs and
3647	 cytology clearance and radiographically)Radiological and neurological improvement for at least 3·5 months to 6 monthsPulse-dose crizotinib (500 mg daily) followed by ceritinibPulse crizotinib for 11 months resulted in control of BM; brain
3648	V600-positive NSCLC  is  unknown  and  the  effects  of  BRAF  tyrosine kinase  inhibitors  alone  or  in  combination  with  BRAF and
3649	 mutantNo prior EGFR TKI• Erlotinib, afatinib, osimertinib (preferred)Prior EGFR TKI• If Thr790Met-positive: osimertinib• If
3650	 treatment also induced caspase-dependent cell apoptosis, as evidenced by increase in Annexin Vpositive cells and the cleavage of
3651	) wild-typeA549 and EGFR T790M mutant NCI-H1975 cells were selected to in-vestigate the anti-cancer effect of
3652	 in A549 and NCI-H1975 cells were decreased after 24 h treatment of NLE, while theexpression levels of Cyclin D1 and
3653	 wild-type A549 and EGFR T790M mutant NCI-H1975 cells were selected forinvestigation, and our results showed that
3654	 did not activate
3655	 as an effective therapeutic target in non–small celllung cancer resistant to
3656	 amplification occurs with or without T790Mmutations in
3657	 promotes progression of non-smallcell lung cancer by inducing
3658	 pathway consists of the extracellular regulatedkinase (ERK) and its upstream amplifying kinases MEK, RAF, RAS,
3659	 pathway consists of the extracellularregulated kinase (ERK) and its upstream amplifying kinases MEK, BRAF, K-RAS,
3660	 lead topersistent activation of the
3661	 and
3662	 and
3663	 and
3664	 and
3665	 rear-rangement possess many of the features seen in
3666	 or EGFRpositive patients than do patients with
3667	 and
3668	 and
3669	 binding cassette transporters (ABC), resistanceto
3670	 and
3671
3672	 and
3673	 and
3674	 and
3675	 and
3676	 and
3677	 statuswas positive in 524 (13%) patients;
3678	 mutation positive and
3679	 TKIs in this real-world study were likelynot given to patients on the basis of mutational status, and in thesepatients the
3680	 muta-tions and
3681	 enhancesangiogenesis in non-small cell lung cancerYue Wang a, Dongmei Han b, Liming Pan c, Jing Sun d, *a Department of Thoracic Surgery, China-Japan Union Hospital of Jilin University, Changchun, Jilin Province, 130033, Chinab Department of Vascular Surgery, China-Japan Union Hospital of Jilin University, Changchun, Jilin Province, 130033,
3682	 and TNK2-AS1therefore augmented STAT3 signaling by elevating
3683	 can promote lungadenocarcinoma development by binding
3684	 inhibitor treatmentstrongly abolished enhanced
3685	and enhance its stability by reducing proteasome-mediated ubiq-uitination of STAT3 thereby enhancing
3686	 over-expression increased the secretion of osteopontin (
3687	 can competes for miR-124binding to upregulate
3688	 and decreased
3689	 and
3690	 over timeseems to be explained partially by increased application of
3691	 andimprovements in one-year
3692	 for specific stages could be explained by alterations in stagingprocedures and guidelines for treatment over time, significant improve-ments in both RS and
3693	 and DFS (OS:
3694
3695	  phosphorylation  via  Rho  GTPase  activa-tion  and  actin  cytoskeleton  rearrangement  independent  of  MSTand
3696	  and
3697	  receptors,
3698	  and
3699	 of the chest or abdomen; sufficient organfunction; histological tissue available by rebiopsy after progressionfrom prior
3700	 was defined asa ≥30% decrease in the sum of the longest target lesion diameter,taking as reference the longest baseline diameter and/or the persistenceof one or more non-target lesions;
3701	 or
3702	 and NC lungtissues using UHR-FT
3703	  tyrosine  kinase inhibitors  (TKIs),  such  as  gefitinib, erlotinib,  and  afatinib, increase aldehyde  dehydrogenase  stem-like cells  driven  by
3704	 mutation or
3705	 in
3706	 mutationsand
3707
3708	 (Cat: 60004-1-lg diluted to 1:5000 from Proteintech)or
3709	 assay was performed to analyze the binding between
3710	 expression levelsand patient survivalTo investigate the prognostic value of OLFM4 expressionfor NSCLC, we assessed the association between OLFM4expression levels and patient survival using Kaplan-Meier736Table 3DSSSummary of univariate log-rank analyses of
3711	 proteinexpression were not significantly correlated with the
3712	 proteinexpression among the smokers predicted a significantlyshorter
3713	 TaqMan
3714
3715	 in tumor endothelial cells of
3716	 kinase induces microRNAbiogenesis in the
3717	 over-expression is more prevalent in high-grade,
3718	 coamplification and
3719	  and
3720	 were associated with a significantly shorterDFS and
3721	 ¼ hazard ratio; Ly ¼ lymphatic invasion;
3722	 ¼ hazard ratio; Ly ¼ lymphatic invasion;
3723	  siRNA  and  cell  transfectionThe  miR-137  mimics  (5(cid:3)-UUA  UUG  CUU  AAG  AAU  ACG  CGUAG-3(cid:3),  5(cid:3)-ACG  CGU  AUU  CUU  AAG  CAA  UAA  UU-3(cid:3))  and  nega-tive  control  miRNA  mimics  (NC,  5(cid:3)-UUC  UCC
3724	   ATA  CGCGTA  G-3(cid:3) and  reverse  5(cid:3)-AAC  TCC  AGC  AGG  ACC
3725	  TTT  G-3(cid:3);
3726	 (completeresponse),
3727	 and
3728	 wasobserved; 5 confirmed PR, 19 SD, and 12
3729	 mu-tations, 2 PR, 5 SD, and 1
3730	 mutations, 1 PR, 1 SD, and 1
3731	 rearrangements, 3 hadSD and 2 had
3732
3733	 and
3734
3735	Abbreviations: DCR ¼ disease control rate; NE ¼ not estimable; NR ¼ not reported; NSCLC ¼ nonesmall-cell lung cancer; ORR ¼ overall response rate;
3736	 mutations (del19 and L858R) are known todecrease the affinity of the kinase for
3737	 site ofboth EGFR,
3738	 mutationsTesting for EGFR mutations is
3739	 mutations in circulating tumor (ct)
3740	 mutation combinations of G719X,S768I, L861Q and L858R the ORR was 67%, median PFS was 9 monthsand median
3741	 Modeling of
3742	 and
3743	 (metastasis associated lung ade-nocarcinoma transcript 1),
3744	 is a newly identified lncRNA, locatedat the antisense
3745	 family,
3746	 and 10 mL of TaqManGenotyping Master Mix, a 1-mL TaqMan Copy NumberAssay, which included forward primer, reverse primer,and
3747	 copy number analysis of PD-L1 (C) and
3748	 protein expression levels inHCC4006, 11-18, PC-9, and HCC827 cells (lung adeno-carcinoma cell lines with
3749	 and PD-L1 expression in non–small cell lung cancer cell lines harboring
3750	 signaling contributes to the enhancedexpression of PD-L1 in lung cancer cell lines and thata downstream
3751	 activation may be involvedin controlling total expression of PD-L1 as a downstreameffector of
3752	 (metproto-oncogene) amplification or activation of
3753	 and Downstream Signaling CascadesUpon binding to its ligands, EGFR forms homo- orheterodimers with other
3754	 dimerizes with other members of the
3755	 to the
3756	 mutations were found to favor the shorterallele of polymorphic
3757	 to
3758	 gene arereported in acquired resistance to imatinib in chronic myeloidleukemia30; however, the
3759	 amplification activates the PI3K/Akt pathwaythrough
3760	 amplificationleads to gefitinib resistance in lung cancer by activating
3761	 amplification occurs with orwithout T790M mutations in
3762	 CAE
3763	 CAE
3764	 CAE
3765	 with standard doses ofchemotherapy; toxicities included fatigue,hypertension, diarrhea, and headacheoverall1 confirmed
3766	 tyrosine kinase activity, effi-ciently blocks oncogenic
3767	 GAT GTT CTTGG AGG ACC
3768	 and RAR-β genes as prognostic markers innon-small cell lung cancer (NSCLC)Hongxiang Feng a,1, Zhenrong Zhang a,1, Xin Qing b, Xiaowei Wang a, Chaoyang Liang a, Deruo Liu a,⁎a Department of Thoracic Surgery, China–Japan Friendship Hospital, Beijing 100029, Chinab Department of Pathology, Harbor-UCLA Medical Center, 1000 West Carson Street, Torrance,
3769	 and RAR-β methylation using methylation-specificPCR (MSP)500 ng of
3770	 methylation profile of
3771	 methylation profile of
3772	 methylation and prognosis in NSCLCsWe next estimated the association between overall survival ratesamong 41 NSCLC patients and DNA methylation status of
3773	 mutation and
3774	 and
3775	 and
3776	 mu-tations or
3777	 mutation status, and
3778	 mutation and
3779	 mutation and
3780	 was the most frequent (8%)followed by PAGE3 (4%), MAGEB4 (3%) and
3781	 mutations,
3782	 (cfDNA) Can Be Used for Molecular Testing of Molecular Mechanisms of Resistance to TargetedTherapyAbbreviations:
3783	 sequencing is the mostestablished and widely used
3784	 mutations can be detected inlung tumor samples with 10% mutant
3785	 mutationsofmethods are typically less expensive than sequencing and can beused effectively in biopsy samples with low tumor content, becauseless tumor
3786	 Mutation Test, v2 (Roche Molecular Systems,Inc), is an RT-PCR assay for use with
3787	 mutations in exons 18to 21 and
3788	 and KRAS, and translocations, such asthose seen in
3789	 and
3790	 and
3791	 in diagnosis andmonitoring
3792	 and
3793	 mutations inplasma
3794	 and
3795	 and TP53genes in human lung cancer tumors detected by Ion Torrent
3796	 for thedetection of
3797	 mu-tations from circulating tumor
3798	 mutatedCaucasian NSCLC: circulating-free tumor
3799	 mu-tations in circulating tumor
3800	 T790M mutation inurinary circulating tumor
3801	 mutation analysisCell-free
3802
3803	 mutationpatients defined by ddPCR was shorter than that defined by
3804	 from direct sequencing or
3805	 = partial response; SD = stable disease;
3806	 mutations that had been defined by direct sequencing (A) and re-defined by ddPCR (B), as well as those that had beendefined by
3807	 and
3808	 and direct sequencingfor
3809	 repair mutations and
3810	 or
3811	 fusion with low TMB score, 3patients had
3812	 RepairFigure 2 Survival Curves Including PFS and
3813	 and
3814	 and
3815	 ¼ hazard ratio;
3816
3817
3818	  =  hazard  ratio,  PFS  =  progression-free  survival,
3819	  may   causeresistance  to
3820	  and
3821	  amplification  leads  togefitinib  resistance  in  lung  cancer  by  activating
3822	 and
3823	 forgender may be somewhat confounded as fixed dose
3824	  in  the  process  ofdecreased
3825	  might  induce
3826	  inactivation  via
3827	, SK1 and p38
3828	 binding siteof p38
3829	 and p38
3830	 amplificationleads to gefitinib resistance in lung cancer by activating
3831	 and
3832	 and initiation ofrepair by
3833	 loading at sites of
3834	 genes and radioresistance has long been es-tablished, nevertheless, little is known about the miRNA-mediatedregulation of
3835	 and
3836	 (RAD51, BRCA2) and
3837	 pathway and
3838	 and
3839	 or
3840	 (KU80),
3841	 andATM, according to their central role in this pathway, DDB2, GADD45A,and
3842	 and
3843	 and
3844	 of
3845	 and hsa-miR-218-5p that is a potential biomarker for lung adenocarcinoma [44] andthe interaction between
3846	 3′UTR, and also the
3847	 and
3848	 (DNA-PKcs),
3849	 gene, andhsa-miR-874-3p targets 3′-UTR of
3850	 and
3851	 and
3852	 and
3853	 and
3854	 (RAD51, BRCA2)and
3855	 and
3856	 is atarget of hsa-miR-96-5p,
3857	 and
3858	 and
3859	 transcript was markedly re-duced in cells over-expressing hsa-miR-96-5p, as well as that of PRKDCand
3860	 and
3861	 and
3862	 genes and IR iseffective to enhance cytotoxic effect of therapeutic doses of γ-radiationin NSCLC A549 cells, similarly to specific chemical inhibitors of
3863	 repair mechanisms and a maximal use of
3864	 mutantfrequency, but not the expression of
3865	 and
3866	 was highly corre-lated with that of its binding partner
3867	 was also highly correlatedwith
3868	 mRNA expression levelspositively correlated with
3869	 is connected to laminins (LAMA1,LAMB1, LAMC1, LAMA2, etc), genes in the
3870	 mutation, thedifference in
3871	 mutation, we also compared
3872	 was similar to that in all patients, whichsuggests that the better OS in the APR group is likely not due to thepresence of
3873	  and
3874	 in early screening, andobscured the selection approach to identify important featuresfrom other categories for
3875	 of
3876	 neighborhoods of
3877	 of
3878	 neighborhoods within two layers of
3879	 (layers#1 and #2), subsequently some predictorsfrom layer#1 of
3880	 neighborhoods of
3881	 Prism7300 sequence detection system (Applied Biosystems, Foster City,Figure 1
3882	 Prism 7300
3883	 (GTX112846, GeneTex, Irvine, CA), p-CREB (Ser133, 06-515, Millipore, Cleveland, OH),
3884	 levels in both total and nuclearcompartments of radioresistant NSCLC cells compared with parentalcells, while increased
3885	 is a direct target of
3886	 mutations butmore effective in patients with
3887	TGTGT-30,  and reverse,  50-ATCTTCCAT-CATCTGAGGGC-30;  and b-actin,  50-TCA  TGA  AGT  GTG  ACG  TTGACA  TCC  GT-30,  50-CCT
3888	 ¼ anaplastic lymphoma kinase gene; ECOG PS ¼ Eastern Cooperative Oncology Group performance status;
3889	 ¼ anaplastic lymphoma kinase gene; CI ¼ confidence interval; ECOG PS ¼ Eastern Cooperative Oncology Group performance status;
3890	  and
3891	 status and baseline patient and tumor characteristics, treatments and outcomes (relapse-free sur-vival [RFS] after surgical resection, overall survival [OS], overall response rate [ORR] and progression-freesurvival [PFS] on
3892	 MUT; 36 TP53 WT) received first-generation
3893	 54%,
3894	 TKIs with
3895	 3/3 [100%],
3896	 alterations may be associated with resistance to EGFRinhibitors and chemotherapy, shorter PFS and reduced
3897	 status was corre-lated with baseline characteristics (age, sex, ethnicity, smoking history,stage at diagnosis, histology, type of
3898	 status on RFS and
3899	 missense muta-tions (n = 32) to TP53 wildtype (n = 62),
3900	 for the sub-group of patients who presented with unresectable stage III or IVdisease (n = 29) was not influenced by
3901	 mutated patientswho were on
3902	 wildtype,
3903	 is commonly co-mutated with
3904	 mutation had no influence on RFS or
3905	 TKIs for treatment ofrecurrent or advanced disease, we saw no significant difference in ORRbased on
3906	 statuson PFS while on
3907	 missense mutations (n = 17) to TP53wildtype (n = 36) in our study, PFS while on first-line
3908	 between the two groups; SD and
3909	 and RFS after surgery, a small impact of
3910	 mutated lung cancer, and larger da-tasets will be required to clarify the influence of
3911	 missense mutations suggests that these mutations potentiallymay have a greater predictive impact on response to
3912	 disruptive mutation is a negative predictivefactor in
3913	 co-mutation status combined with
3914	 TKIs aresuperior to chemotherapy as first-line treatment in EGFR mutatedNSCLC, showing improved responses and prolonged progression-freesurvival (PFS), whereas
3915
3916	 excessive levelOnartuzumabFiclatuzumabPhase III (stopped)Phase II–Controversial results
3917	 similar to what it is seen in
3918
3919	 appeared to favour Osimertinib with a
3920	Abnormal activation of MET is the second more frequent me-chanism of
3921	 is atyrosine kinase receptor activated by the hepatocyte growth factor(HGF), which acts through pathways related to PI3K-AKT, RAS-MAPkinase,
3922	 can also formheterodimers and cross-activate other growth receptors,includingEGFR and ERBB3, and has cross-talk with HER2,
3923	-
3924	 is associated with resistance to targeted therapies, suchas primary and acquired resistance to
3925	 amplificationin
3926
3927	 and intrinsic or acquired resistance toEGFR TKIs may also depend on excessive level of
3928	 or
3929	 andcompetes with
3930
3931	 amplification represents another mechanism of acquired re-sistance to
3932	 in mediating sensitivity and resistanceto
3933	 as a possible target in
3934	 decreased after treatment with Afatinib, a se-lective and potent irreversible
3935	 amplification as a new mechanism of acquired resistanceto
3936	 and
3937	 mutantlung adenocarcinoma specimens that underwent transformation intoSCLC, demonstrating a loss of
3938	 inactivation,in SCLCin addition to
3939	 and
3940	 and
3941	 TKI treatment and genetic and epigenetic al-terations, such as
3942	 amplificationhas been described as a mechanism of acquired resistance to
3943	, the downstreaming signaling pathways whichcan be activated as a EGFR TKI resistance mechanism involve keymediators, such as RAS, BRAF, ERK1/2, PTEN,
3944	 and
3945	 mutations constitutively activate
3946	 mutations as apossible mechanism of acquired resistance to
3947	 exon19 deletion and EGFRT790M and
3948	 mutation areextremely sensitive to selective BRAF and
3949	 and
3950	 in-hibitor, and WZ4002, a
3951	 mutations leading to
3952	 andAXL may be altered, but also that SFK may be independent of
3953	, SFKs and FAK may be an interestingprospective and clinical trials are warranted to explore the combinationof EGFR TKI and
3954	 family kinases and focal adhesion kinase with the loss of the am-plified, mutated
3955	 and
3956	 exon 19 deletion and amplifica-tion of
3957	 as well as
3958	 4/6 in resistant cells, which was ex-amined via phosphorylation of
3959
3960	 and is readily counteracted viacombination of afatinib with a
3961	 mutations anddeveloped resistance preserved phosphorylation of
3962	 with the help of
3963	 in serum influence outcome to che-motherapy versus
3964	 double-positivity showed significantly lower DFSand
3965	 and DFS were analyzed according to theexpression of PD-L1 and
3966	 in tumor tissues were the mainindependent factors affecting both DFS and
3967	 regulates the antitumor immune re-sponse through
3968	 impact on
3969	 in-hibition:
3970	  as  well  as
3971	  and
3972
3973
3974	 ¼ anaplastic lymphoma kinase; DNLR ¼ delta neutrophil-to-lymphocyte ratio; ECOG ¼ Eastern Cooperative Oncology Group;
3975	 ¼ not reached;
3976	 ¼ anaplastic lymphoma kinase; DNLR ¼ delta neutrophil-to-lymphocyte ratio; ECOG ¼ Eastern Cooperative Oncology Group;
3977	  and
3978	  activity,  especially  CYP3A4  and
3979	  and
3980	 ¼ anaplastic lymphoma kinase;
3981	 TKI as well asradiotherapy, with a median
3982	 after BM diagnosis in the
3983	 mutation group, thepatients with isolated BM showed significantly longer
3984	 was apparently different between the
3985	 seemed to be shorter inNSCLC patients with cranial relapse than in those only withextracranial relapse, regardless of
3986	 was apparentlydifferent according to
3987	 in chemotherapy-naive NSCLCpatients with
3988	 of 64 and 52 months,respectively, in
3989	 of our patients seems poor,although
3990	 scanning, which is standardly recommended for usein combination with
3991	  =  partial  response,  SD  =  stable  disease,
3992	 for positive PD-L1 expression significantlyincreased, while the OR for mutant
3993	 ¼ twice a day; CMR ¼ complete metabolic response; DM ¼ distant metastases; ECP ¼ extracerebral progression; fx ¼ fractions; 5-FU ¼ fluorouracil; LRF ¼ locoregional failure; max ¼ maximum;
3994	 ¼ twice a day; fx ¼ fraction; LRFS ¼ local relapse-free survival; MTV ¼ metabolic tumor volume;
3995
3996	 levels, and upregulation of LATS2via the long non-coding RNA
3997	 andcannot produce sufficient
3998	 overexpression enhanced mitochondrial
3999
4000	 production was measured, and the resultsindicated that
4001	 productionwas significantly elevated by
4002	 overloading and repressed cyt-c liberationdespite
4003	 and
4004
4005
4006
4007
4008
4009
4010
4011
4012
4013
4014
4015
4016
4017
4018
4019
4020
4021
4022
4023
4024
4025
4026	 increased in gastric carcinoma,along with higher MET mRNA level and increased
4027	 in lung tumor tissues and higherlevel of serum MET
4028
4029
4030
4031
4032
4033
4034
4035	 and
4036	 R,
4037	 gene copy numberin lung cancer using
4038	  and  Pokemon  in  NSCLC  cell  linesTo  determine  whether  CCAT2  and  Pokemon  were  expressed  inNSCLC,  NSCLC  cell  lines  of  Pc-9,  H358,  H1975  and  normal  bronchialepithelial  cell  line
4039	  represented  as  anew  marker  that  is  upregulated  in  NSCLC,  which  regulates  cellinvasion  and  metastasis  via  the  down-regulation  of
4040	  knockdownsignificantly  decreased  the  expression  of  Pokemon,  but  increasedthe  expression  of  p21;  up-regulation  of
4041	  on  the  expression  of  Pokemon  and
4042	  down-regulation  significantly  decreased  expression  of  Pokemon,  but  increased  expression  of
4043	  scans,  or  brain
4044	 and  the  cyclic  nucleotide  phosphodiesterase  PDE10A; deficient
4045	  demethylating  agents  and  other
4046
4047	 pathwayfollowed by induction of the
4048	 and
4049	 genes,and components of the
4050	 genes and furtherupstream events such as activation of p38
4051	 family gene induc-tion as well as p38
4052	 family ofgenes by means of p38
4053	 dependenceof
4054	 mutational analysisWe isolated tumour
4055	 amplification leads togefitinib resistance in lung cancer by activating
4056	 mutations and
4057
4058
4059	 GA was significantly associatedwith
4060	 truncation and HER2 increased
4061	HODSCohortThis study was conducted in a cohort of 447 NSCLCpatients previously analyzed for MET (mesenchymal-epithe-lial transition factor)
4062	 FISH positive and 48 patientswere considered as
4063	 FISHUnstained 4-␮m sections from each of the three TMAwere submitted to dual-target, dual-color FISH assays usingthe PathVysion
4064	 Mutation AnalysisGenomic
4065
4066	 amplification isfrequently associated with
4067	 andEGFR
4068
4069
4070	 and
4071	 FISH posi-tive and
4072	 FISH positive and
4073
4074	 geneamplification or in the context of increased
4075
4076	 and
4077	 has the ability to act as ascaffolding protein to link
4078	 pathway as a strategy to circumvent resis-tance to anti-EGFR or
4079	 truncation and increased
4080	 and
4081	 kinase domainmutation results in constitutive phosphorylation and activation of HER2and
4082	 activationmutations or
4083	 significantlyattenuated homologous
4084	 69G>A and 4150G>T single nucleotide poly-morphisms that were reproducibly associated with lower FEN1expression, increased
4085	 has recently beenreviewed as one of the deregulated
4086	 inA549 (E) and H460 (F) cells transfected withcontrol or
4087	 in
4088	 in NoneSmall-Cell Lung CancerFigure 5Effect of knockdown of FEN1 on
4089	 reporter assay (A), and A549-EJ5GFP/H460-EJ5GFP cells for
4090	 reporter (C)and
4091	 inducedhigher levels of cleaved caspase-3 and
4092	 Knockdown on
4093	 or
4094	 eliminates heterologous se-quences at
4095	 depletionon both
4096	 and
4097	 in DSB
4098	 as an essential componentof
4099	 was highly expressed by cycling cellsand that it colocalizes with
4100	 plays a critical role in
4101	 eliminatesheterologous sequences at
4102	 and
4103	 might have animpact on a broad range of
4104	 poly-morphisms are associated with
4105	 suppresses
4106	 ¼ not otherwise specified; NSCLC, nonesmall-cell lung cancer; nSES ¼ neighborhood socioeconomic status;
4107	 ¼ hazard ratio; NCI ¼ National Cancer Institute;
4108	 ¼ epidermal growth factor receptor;
4109	Abbreviations: ECOG ¼ Eastern Cooperative Oncology Group; NR ¼ not reached; ORR ¼ overall response rate;
4110	 doubled amongpatients with
4111	 Extraction and Mutation Analysis of
4112	 extraction and mutation analysis of EGFRand
4113	 fusion protein in the cytoplasm (Figure 3)in line with the absence of any nuclear localization signal inthe
4114	 or
4115	is evolutionarily conserved, and CCDC8 mutation leads tothe development of 3M syndrome in humans, a primordialgrowth disorder, by interacting with
4116	 protein andmRNA levels in NSCLC cell lines were significantly lower comparedwith those in
4117	 mRNA andprotein levels in NSCLC cell lines were significantly lowercompared with values obtained using
4118	 mutations in 3-M syndrome, suggesting that CCDC8 contrib-utes in a pathway with
4119	 and
4120	 method after normalization to the
4121	 receptor tyrosine kinase gene (ALK) and ROS1rearrangements,
4122	 BY-NC-ND licenseundertheKeywords: KIF5B-
4123	 receptor tyrosinekinase gene (ALK)-rearranged2,3 and
4124	 gene was identified through the transfectionof NIH3T3 cells with human lymphoma
4125	 wild type (WT)portion of
4126	 andALK
4127	 fusion proteins isanalogous to the oncogenic activation of rearranged
4128	)-
4129	 IHC staining patterns among RET-positiveand RET-negative specimens previously identified byRT-PCR, and the
4130	 rearrangement, with 33% to 43%
4131	 variantsby cross-checking of
4132	 rearrangements inblood samples, and KIF5B-RET fusion gene was suc-cessfully identified in cell-free
4133	 rearrangement and
4134
4135	,
4136	 receptor tyrosine kinase,
4137	 inhibitor (vandetanib, cabozantinib, len-vatinib, sunitinib, sorafenib, alectinib, ponatinib, orregorafenib) and their ORR and median PFS and
4138	 proto-oncogene, non-receptor tyrosine kinase (SRC), VEGFR,PDGFR,
4139	 (ORR 60%–95% and median PFS 8–11months),93 and
4140
4141	, MET proto-oncogene, receptor tyrosine kinase; PI3K,phosphoinositide 3-kinase; AKT2, AKT/serine threonine kinase 2; MAPK, mitogen-activated protein kinase; TKI, tyrosine ki-nase inhibitor; mTOR, mechanistic target of rapamycin;
4142	 G12V were highly resistant to AD80, confirm-ing the paramount role of concomitant mutations oractivated signaling pathwaysin driving
4143	 and
4144	 and
4145	 and
4146	 and
4147	 rearrangement co-existing with activated
4148	 expression was associated with
4149	 mutations[4e6] and Alk-translocations [7] are available and newtargets such as
4150	 exon19 and 21mutations were found in
4151	 mutations were associated with a trend to-wards decreased odds for ‘high’
4152	 acti-vation and suppression of
4153	 expression are shown for adenocarcinoma (A) andtaxane sensitivity in patients with activating
4154	 are available inTCGA, a correlation between reduced CHFR proteinexpression and
4155	 (exon19/21) mutations in AC and with malegender in SCC further suggest that
4156	 expression with
4157	 (exon19/2) mutationsreduced
4158	 group had
4159	 were longer in those that received
4160
4161	 + NSCLC patients progressing on crizotinibwere treated with
4162	 and
4163	 forthe PET/CT-detected OPD subgroup that received
4164
4165	 within 6 weeksafter having eCNS progression noted on index CT demonstrated further
4166	 vs CT on clinical outcomes when a
4167	 cytology were clinically diagnosed with LMC based on both definite
4168	  and  18  additional  patients (17%)  who  showed
4169	 group remains unknown in this  study,  but  we  suspect  this  transient  negative  conversion could not represent a clearing up of cancer cells from the
4170	 of the more strict definition of
4171	  after  intraventricular  administration  largely  depends  on the normal
4172
4173	 and
4174	 input was 150 to 300 ng, as measuredby the TruSeq FFPE
4175
4176	 expression where pyrazole significantly down-regulated the gene expression of CDK-2 in a time dependent manner,which might be one of the molecular mechanisms of pyrazole in in-hibiting the growth of A549 cells by disrupting
4177	 represses oncogenic
4178	Abnormalities in TP53 function through deletion or mutation of  the  gene  or  overexpression  of
4179	 regulates
4180	Normally,  CDKN2A  (previously  designated  p16)  regulates transcription  through  phosphorylation  of  the
4181	  and
4182	  and
4183	 mutations in circulating tumor cells or
4184	 or
4185	 or
4186	 and
4187	  has  been  advocated  as  a  cost-effective  replacement  for
4188	 and
4189	 alone  or  CT  plus  RT  showed  no  PFS  or
4190	 or crizotinib followed by  definitive  chemoradiation  in  patients  with  documented
4191
4192
4193	/
4194
4195	  and
4196	 antigen on Tcells and the B7 ligands (ie,
4197	 ¼ overall survival; Pacl ¼ paclitaxel; PD-L1 ¼ programmed cell death-1 ligand; PFS ¼ progression-free survival;
4198	 ¼ overall survival; PD-1 ¼ programmed cell death-1;Clinical Lung CancerJanuary 2017 - 1516-ClinicalLungCancerJanuary2017Table 3 Reported Treatment-Related Adverse Events of PD-1 and PD-L1 BlockadePembrolizumab69 (%)Nivolumab57,58 (%)2 mg/kg (KEYNOTE-010)Grade ‡3All Grades10 mg/kg (KEYNOTE-010)Grade ‡3All Grades3 mg/kg (Checkmate 057)Grade ‡3All Grades3 mg/kg (Checkmate 017)Grade ‡3All GradesirAEFatigueDecreased appetiteSkin rashDiarrheaNauseaAstheniaStomatitis/mucosal inflammationArthralgiaHypothyroidismHyperthyroidismPneumonitisColitisAdrenal insufficiencyThyroiditisTransaminase increase/hepatitisNeuropathy or encephalitisAbbreviations: irAE ¼ immune-related adverse event;
4199	 (ataxia telangiectasia mutated)-checkpoint kinase 2 (Chk2) pathway, which can arrest the cell cycle, allowing
4200	 and
4201	 inhibitors showedantiproliferative/proapoptotic effects, and EMT reduction in LKB1 wild-type human NSCLC cell lines, independently from the
4202	 [6,7],
4203	 and
4204	) and isocitrate dehydro-genase 2 (
4205	 thatresult in this phenomenon occur at the amino acid position ar-ginine 132 and its homolog arginine 172 of
4206	 mu-tations at the amino acid position arginine 140 have beenreported less frequently in solid tumors but occur at a similarfrequency to that of
4207	 and
4208	 or
4209	 mutation but did have a coexisting
4210	 or
4211	 and/or
4212	 and
4213	 and
4214	 and
4215	 and
4216	 and
4217	 and
4218	 ¼ partial response;SD ¼ stable disease;
4219	 had significantly lower median
4220	 mutations, ALK, ROS, and RETfusions, and
4221	 and PFS betweenpatients with wild-type and mutant
4222	 remained in the final model and was amongthe most statistically significant genes in predicting both
4223	 Mutation Status With Survival inNSCLCThe median
4224	 hadsignificantly lower median
4225	 mutation status remained predictiveof both
4226	 alterations (1KMT2D mutation), 4 patients with
4227	 ¼ hazard ratio;
4228	 mutations in our cohort was greater inwomen, similar to the female bias observed for
4229	 mutations was greater in women,similar to the female bias observed for
4230	-mutated NSCLC is sensitive to EGFR TKIs and anincreased dose increases
4231	  to
4232	   methodology  inselecting  patients  for  PCI  in  whom  no  evidence  of  brain  metastasescan  be  found  may   be  revealed  in  pending  investigations  such  as
4233	 gene may be implicated in the mechanism of primary resistance to
4234	 tyrosine kinasedomain, amplification of the ALK fusion gene and the activation ofalternative signaling pathways, such as EGFR,
4235	 gene andthen studied it in vitro as potential new mechanism of primaryresistance to
4236	 and FISH for
4237
4238	 overexpression as a potential mechanismassociated with resistance to specific
4239
4240	 rearrangement together with
4241	 rearranged lung cancer celllines, indicating
4242
4243	 regulates the antitumor immuneresponse through
4244	 mutations and
4245	 imaging in all patientsand with
4246	 size greaterthan 1 cm in the largest axis or
4247	 and
4248	 or
4249	 and
4250	 and
4251	 and
4252	 and
4253	 and
4254	 and
4255	 and in 122 of 1,278(10%) by
4256	 and
4257	 and in 4 (11%) by
4258	 and
4259	 and
4260	 and
4261	 and
4262	 mutation), 2 patients had 2concomitant mutations (EGFR and
4263	 or
4264	 mutations from circulating tumor
4265	 as far as
4266	   and
4267	 = CR +
4268	 as a promising therapeutic target because crizotinib,a multi-targeted drug against ROS1, ALK, and the
4269	oncogene dependence of HCC78 cells by upregulating the expression of the ROS1 fusion gene andreducing the activity of the
4270	 (40%e50%),
4271	 are ongoing, including lorlatinib, cabozantinib,entrectinib, brigatinib, ceritinib, DS-6051b, and TPX-0005, some ofwhich also inhibit
4272	 based medium containing gellan gum,restored the
4273	 but also other
4274	 phosphorylation was observed in HCC78 cells in aprevious study, addition of the MET inhibitor PHA-665752 did notreduce the IC50 of HCC78 to
4275	 familykinases including EGFR, but not c-MET, contribute to the resistanceof HCC78 cells to
4276	 and ERK1/2was reactivated after 48 h of crizotinib treatment even thoughphosphorylation of
4277	 and itsdownstream modulators,
4278	-
4279	 family pathwaypartially contributes to the resistance of HCC78 cells to
4280
4281
4282	 positivepatients is expected to be similar to that for
4283	 and
4284	 or
4285	  is  generally  overexpressed  inmesenchymal  tissue  and  the  nervous  system,  but
4286	 promotes proliferation in non-small cell lungcancerQi Sun a, 1, Run Shi b, 1, Xin Wang b, Demin Li a, *, Haiwei Wu c, **, Binhui Ren b, **a Department of Cardiothoracic Surgery, Jinling Hospital, Southern Medical University, East Zhongshan Road 305, Xuanwu District, Nanjing, Jiangsu 210002,
4287	 expression was closely associated with
4288	 is highly upregulated in NSCLC tumor tissues and suggestthat ZIC5 may act as an oncogene by influencing
4289
4290	 expression was highly correlated with genes enriched in the cell cycle, mismatch repair and
4291	 and Cdc25C were dramatically decreased, while the expression levels of p21, p27, CCNA1,
4292	 and Cdc25C expression weresubstantially decreased, while the expression levels of p21, p27,CCNA1, and
4293	 proteins have similarspecific
4294	 was significantly longer in low
4295	 in both low and high
4296	 expression isfound to associated with shorter
4297	 depicting relationship between
4298	 data, meta-analyses werecarried out with Stata software (version 12; Stata Corporation, USA) bypooling the HR data reported in individual studies and to generate in-verse variance weighted overall effect size and group effect sizes (group1: studies which used low
4299	 = 1 and group 2:studies which used high
4300	 values from stu-dies which used low
4301	 values fromstudies which used high
4302	 or PFS in theunified analysis as well as with low
4303	 and PFS in the unified analysis as well as with in subgroupanalyses with low
4304	 in overall as well as low andhigh
4305	 has been found to be significantly longer in low
4306	 is crucial for the nucleotide excision repair system of
4307	 between low
4308	 and PFS and positively associated with
4309	 and PFS and inversely as-sociated with
4310	 expression as reference (
4311	 is standardized outcomemeasure which eliminates the variabilities in individual study cut-offsused for
4312	 ex-pression of
4313	 data revealed no meaningful association betweenthe expression of
4314	 in NSCLC as
4315	 and in-versely associated with
4316	 and
4317	 and
4318	 and
4319	 and
4320	 and
4321	 and
4322	 and
4323	(ERK1/2; Thr202/Tyr204), p44/42 MAPK (ERK1/2), p-MEK1/2(Ser217/221), Na and K-ATPase antibodies (Cell Signaling Tech-nology, Danvers, MA, USA), and monoclonal antibodies anti-E-cadherin, N-cadherin, Vimentin, Twist1, Snail1, b-actin, K-Ras, H-Ras, and
4324	 and
4325	 humanIGF-I single plex;
4326	 exon 19 muta-tion and 1 case of
4327	 ¼ bone morphogenetic protein;CEA ¼ carcinoembryonic antigen; CI ¼ confidence interval;FGF ¼ fibroblast growth factor; G-CSF ¼ granulocytecolony-stimulating factor; HB-EGF ¼ heparin-binding endothelialgrowth factorlike growth factor;
4328	 and
4329
4330	 ¼ hazard ratio; IRAE ¼ immune-related adverse event;
4331	 ¼ hazard ratio; IRAE ¼ immune-related adverse event;
4332
4333	 gene mutations or
4334	 gene mutations,
4335	 and
4336	 and PD-L1 expression in
4337	 mutations, extreme
4338	  and
4339	 expression by TDP43 controls the migrationand invasion of non-small cell lung cancer cells in vitroFengjie Guo a, Feng Jiao a, Zuoqing Song b, Shujun Li c, Bin Liu a, Hongwei Yang d,Qinghua Zhou a, b, *, Zhigang Li a, b, **a Tianjin Key Laboratory of Lung Cancer Metastasis and Tumor Microenvironment, Tianjin Lung Cancer Institute, Tianjin Medical University GeneralHospital, 154 Anshan Rd, Tianjin 300052,
4340	 and LPHN2 both decreasedafter knockdown of
4341	 and
4342	 phase or deformation of the CTV contour from onebreathing phase to the others) [26], or by contouring the CTV ona
4343
4344	 and 61% for
4345	 and 51% for
4346
4347
4348
4349
4350	 was not significantly different between
4351	 samples isolated using theQIAamp Circulating Nucleic Acid Kit (Qiagen, Hilden, Ger-many) were tested for the
4352	strand) and trans (on different DNA strands) allelic re-lationships of the
4353	 mutations were incis (on the same
4354	 dimerization, and EAI045, anallosteric inhibitor that synergizes with cetuximab andovercomes the enhanced
4355	 mutations and T790M levels intumour and plasma
4356
4357	 oncogene, or translocation of the
4358	 Chinac Department of Biostatistics and Bioinformatics, Emory University Rollins School of Public Health, Atlanta, GA, 30322, USAd Department of Medical Oncology, Tianjin Medical University General Hospital, Tianjin, PR Chinae Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, GA, 30322, USAA R T I C L E I N F OA B S T R A C TKeywords:Cancer therapyEnergy metabolismInsulin-Like growth factor receptor 1 (
4359	 signaling was assessed by the phosphorylation of IGF1R and itsdownstream target
4360	 phosphorylationWe previously demonstrated that 2-DG treatment activates the pro-survival
4361	 phosphorylation at these sites,however, was observed by Estan et al in leukemia cell lines, who alsoobserved a serum-dependent 2-DG induction of
4362
4363	 phosphorylation was not observed at 15 min; con-sistent with our hypothesis that 2-DG‒induced
4364	 phosphorylationand
4365	 inhibitor,completely inhibited 2-DG‒induced IGF1R and
4366	 signaling through
4367	 isogeniccells, re-establishment of LKB1/AMPK signaling was also capable ofsuppressing caspase-3 and
4368	 somatic mutation ratealone in invasive breast carcinoma is ∼36%, and the rate of
4369	 activity, and it is unclear whether 2-DG-in-duced
4370	 image obtained for the
4371	 aptamer was covalently bound onto theconducting polymer (pTTBA layer) and coated onto the AuNP-de-posited
4372	 Chinab Department of Oncology, The First Hospital of Jiaxing (The First Affiliated Hospital of Jiaxing University), Jiaxing, Zhejiang 314000, PR Chinac Department of Oncology, Zhejiang Hospital, Hangzhou, Zhejiang 310013, PR ChinaA R T I C L E I N F OA B S T R A C TKeywords:PolyphyllinMALAT1STAT3Gefitinib-resistanceNSCLCNon-small cell lung cancer (NSCLC) patients harboring
4373	 and inactivating
4374	 and
4375	 and suppressing
4376	 and inhibiting phosphorylation of
4377	 and phosphorylation of
4378	 and phos-phorylated
4379	 decreased, while cleaved
4380	 and
4381	 and
4382	 and in-hibiting phosphorylation of
4383	 increased, cleaved
4384	 mutationson response to
4385	 and RNA were quantified by theQubit DNA
4386
4387
4388	 mutation, androgen receptor amplification, and nuclearreceptor binding
4389	1 (amplification)NilIHCP53 Rb ASCL1+ ––+ – +–––– +–+ ––+ – +––––– +Abbreviations: AKT1, AKT serine/threonine kinase 1; AR, androgen receptor; ASCL1, achaete-scute homolog 1; CNV, copy number variation; del, deletion; EGFR,epidermal growth factor receptor; FGFR1, fibroblast growth factor receptor 1; fs, frameshift; IHC, immunohistochemistry; NBN, nibrin; NSD3, nuclear receptorbinding
4390	 driver mutations, identical
4391	 and
4392	 overexpression,other genetic changes including
4393	 mutation (patient 1),PIK3CA amplification (patient 2),
4394	 loss in resistant
4395	 and
4396	 β-actin  tdeaertnu CN p5-291-Rmi 512-Rmi tobl nretseWXIAP 3’-UTR Mutant XIAP 3’-UTR XIAP pro-casp3 cleaved casp3
4397	 and an increase in caspase-3activation and
4398	 PRISM 7900HT byusing inventoried TaqMan assays for
4399	 methylation is prognostic forlung cancer survival and increases sensitivity to topoisomerase-I inhibitors via in-duction of
4400
4401	 induced the mitochondrialtranslocation of
4402	 revealed coiled-coil-helix-coiled-coil-helix domain-containing 2 (CHCHD2) protein, whichwas coamplified with
4403	 and
4404	 is coamplified with
4405	 and
4406	 (Abcam, ab4812, a cross-reactive antibody to USP22-C185A) 1:500, far upstream element-binding protein 1 (FBP1,Abcam) 1:500, COX-1 (Abcam) 1:500,
4407	 silencing down-regulated COX-2 and
4408	 (A and D), COX-2 and
4409	 for the deubi-quitination of COX-2,the effect of another deubiquitinatingenzyme,
4410	 or
4411	 and
4412	 was identified as a sub-strate of
4413	 in treatment-naïve advanced non-squamous non-small cell lung cancer patientsFangfang Xiea,b, Yujun Zhanga,b, Xiaowei Maoa,b, Xiaoxuan Zhenga, Han Han-Zhangc, Junyi Yec,Ruiying Zhaod, Xueyan Zhangb, Jiayuan Suna,b,⁎Ta Department of Endoscopy, Shanghai Chest Hospital, Shanghai Jiao Tong University, 241 West Huaihai Road, Shanghai 200030,
4414	 (L858R, exon19del,exon20ins, S768I, G719X, amplification),
4415	 and
4416	 amplification, KRASamplification,
4417	 in-hibitors and 2 were treated with
4418	 am-plification and
4419	 mutation, an ALKor
4420	 and
4421	 profiling reveals heterogeneity of
4422	 = CR +
4423	 Protein Overexpresssion in CL1-0 CellsACTN4 gene overexpression in CL1-0 cells was achieved through transfection with human ACTN4
4424
4425
4426
4427
4428	   from   a  liver   metastasisbiopsy   sample   and   circulating   tumor   DNA   both   found   the   same   I1171N
4429	  scan  at  the  time  of  transbronchial  re-biopsy  (A)  and  subsequent  NGS  analysis  of
4430	  or
4431	  kinase  acti-vating  mutation  (I1171N),  known  to  confer  resistance  to  crizotiniband  alectinib  [7],  in  a  liver  tumor’s
4432	  of  heterogeneous  mutant
4433	 were added to the cell suspension underdark condition for 15 min, and stained cells were detected by flowcytometry (FCM) using Accuri
4434	 compared with control or low levelof
4435	 could increase
4436	 signaling controls expression of pro-apoptoticBOK and
4437	 CUTTITA (15} +++ ++ ND + 538
4438	 (Hs00988717_m1),
4439	 (203196_at),
4440	 was cho-sen to replace
4441	 had a 7% (19/271) ofloss of
4442	 protein inNSCLC tumors is concordant with an observed 4% (11/271) of gain oramplification of
4443	 is part of
4444	 is regulated by multiple NF-κB and
4445	 from the current study and
4446	 copy numberand gene expression regulatory network analysis of NSCLC metastasis,CCL19 is a driver gene and
4447	 and
4448	 and
4449	 is an amplified oncogene bridging the
4450	 signaling: in-volvement of
4451	 regulatory factor family transcriptionfactors regulate
4452	 scans, ultrasonography of abdominal and cervical/supraclavicular regions, and brain
4453
4454	 and four for
4455	 and
4456	type, first author, publication year, number of participants, sex pro-portion, country or region of the cohort, cut-off point of ESR statusin PCR analysis, histological type, stage, and
4457	 was taken as theeffect size to reflect the association between ESR1/ESR2 mRNAexpression levels and patients’
4458	1; 4 studies for ESR2) for this meta-analysis73 records were removed aŌer duplicaƟon check102 records of animal and cell study were removed312 records of other diseases were removed94 records of case report were removed38 records of review were removed12 Records employing non-mRNA evaluaƟon of ESR were removed4 records not about survival were removed3 records unable to obtain
4459	 mRNA expression in survivalThe pooled unadjusted
4460	 and
4461	 expression from random-effect model byunivariate analysis; (B) ESR1 expression from fixed-effect model by multivariate analysis; (C)
4462	 mRNA expression (514 participants) and fourstudies on
4463	s from univariate analysis revealed no statis-tically significance, the pooled adjusted HR suggested a significantsurvival benefit among patients with
4464	 and
4465	 in lung cancer survival and these studies were cat-egorized by location of expression (nuclear or cytoplasm); however,according to a recent qualitative systematic review on the IHCmethod, contradictive results obtained from insufficient numberof studies made it hard to evaluate the virtual prognostic roles ofeither
4466	 mutation status, such as circulatingcell-free
4467	 mutations after three cycles of combinedEGFR TKI treatment and chemotherapy (the FAST-ACT2study) was found to be an independent predictor ofshorter PFS and
4468	 Mutation-Positive NSCLC951this underscoresNevertheless,the importance ofensuring early access to an EGFR TKI during the diseasecourse and highlights the limitation of adopting
4469	 when comparing anupfront TKI versus chemotherapy,
4470	 activating mutations;however, a clinically relevant
4471	 as an increase in the sum of di-ameters of target lesions by 20% usually on
4472	 receptor tyrosine kinase gene(AXL) overexpression,88 and
4473	, MET proto-oncogene, receptor tyrosine kinasegene; FISH, fluorescence in situ hybridization; HER2, erb-b2 receptor tyrosine kinase 2 gene;
4474	 sensitizing mutations were foundto drop with tumor response, with the emergence ofT790M mutations occurring in plasma up to 4 monthsbefore
4475	 in lung cancer patientsby deep sequencing of plasma cell-free
4476	 iseffective for the detection of
4477	 kinase causes drug resistance byincreasing the affinity for
4478	 inhibitors occasionallyharbor
4479	 ampli-fication: a potential mechanism of acquired resistanceto
4480
4481	 and
4482	 gene, whileMYCLo-2 represses
4483	 has received honoraria and consultancy fees from Eli Lilly, AstraZeneca, Roche, Merck
4484	 mutation and presence of
4485	 and
4486	 repair by
4487	 synthesis and repair genes
4488	 scan,
4489	/
4490	 and
4491	 and
4492
4493	 activating mutations (w15% of NSCLC), ALKrearrangements (w5% of NSCLC), and
4494	 and
4495	 or
4496	 and
4497	 and
4498
4499	þþ
4500	 and
4501	 and
4502	 or
4503	 and
4504	 or
4505	 IH
4506	ccording to the initialFISH (Abbott Molecular probes) and IHC results, 13 samples wer
4507	 status (ie, > 6 ROS1 copies per tumor nuclei), and4 samples had other known oncogenic molecular alterations (2 withEGFR L858R and 2 with
4508	 IHCFISHFISH
4509	 and
4510	 and
4511	 FISH and
4512	 and
4513	 IHCwho could also be treatedFIS
4514	FISHþ; 95%þ; 40%þ; 41%þ; 84%þ; 40%þ; 64%þ; 80
4515	 amplifications (not tested in our study) could also bepredictive markers of response to crizotinib therapy (and couldperhaps explain the response to crizotinib of some cases withdiscrepant
4516	 and
4517	 part ofthe dual
4518	 and
4519	 and
4520	 and
4521	 and
4522	 and
4523	 and
4524	 and
4525	 and
4526
4527
4528	 could bind to the promoter region of
4529	 could partially abolished the action of
4530
4531
4532	 can influence cellapoptosis, flow cytometry assay with Annexin V-FITC and
4533
4534
4535
4536	 atleast partly abolished
4537	 could bind withthe
4538	 in NSCLC cellswith or without
4539	 binds with the
4540	 protein in A549 cell with orwithout
4541
4542
4543
4544	 binds tothe promoter region of
4545	 overexpression resulted inhigher
4546	 turns out to increase
4547	   overexpression   increased   the
4548
4549	  by  the  X-treme  GENECells  were  transfected  with  3
4550	  7900HT  sequencedetection  system,  and
4551	  and
4552	  plasmid  transfection,  increased
4553	  relativeto
4554	  levels  or  its  activity  and  less  is  known  about
4555	  and
4556	  and
4557	  overexpression  cells  and  control  cells  were  stained  with
4558	  can  increase
4559	  in  NSCLCcell  lines  led  to  an  increase  in  the  intracellular
4560	  and
4561	  and
4562	  expression  correlated  to  both
4563	  subunit  has  ahigher  affinity  for  pyruvate,  preferentially  converting  pyruvate  tolactate,  however
4564	  and
4565	 mutationEGFR increased copy numberMET amplificationMET mutationEML4-
4566	 mutations are predic-tive of a high RR and prolonged PFS in patients treated withEGFR TKIs, which does not, however, translate into a sig-nificant benefit in
4567	 and
4568	 copy number on FISH and a GTPase KRAS(KRAS) mutation showed no significant predictive value forany of the agents assessed, although the
4569	 expression, EGFR copy number,EGFR mutations, and
4570	 amplification has been reported in 17% of treat-ment-naive patients with NSCLC and was associated with adismal prognosis and resistance to
4571	 inhibitorswith
4572	 T790Mresistance mutation (7/9 patients demonstrated SD) and inpatients with
4573
4574	 mutations are usually mutually ex-clusive to
4575
4576	 mutation did not seem to have animpact on survival of patients treated with
4577	 oncogene, a member of the
4578	 receptor does not have a knownligand and is putatively activated by homodimerization withother HER2 receptors or by heterodimerization, preferentiallywith either
4579	 kinase, leading to phosphorylation ofdownstream effectors such as
4580	 and
4581	 mutations are resistant to
4582	 amplification has beenreported in approximately 12 to 17% of patients with NSCLCand can have a role in
4583	 and
4584	 mutation owing toalterations at other levels of the PI3K/AKT/mTOR pathway,such as
4585	 and
4586	 mutations and secondary re-sistance to EGFR TKIs may lose the mutation underlyingacquired T790M resistance or
4587	 amplification occurs with orwithout T790M mutations in
4588	 and
4589	 kinase domainmutation results in constitutive phosphorylation and activation ofHER2 and
4590	 [30,31] and
4591	 was
4592	 translocation,
4593	 translocations are less frequent (2–4% of NSCLC) than
4594	 translocated NSCLC tend to be youn-ger than patients with
4595	 translocations,
4596	 or
4597	miceBMPR1AK19-C2mE miceSMAD1/5Muc5acPGE2invasive ductal carcinoma(IDC) patients–breast tissue samples
4598	 Components in Various CancersComponents Involved Cancer Cell/ModelRelated Targets/PathwaysRolesReferencesAntagonistsNogginK14-Noggin miceWnt, Shhpromotes skin tumorigenesistumor cellsblood vesselstumor cellstumor cells–
4599	 receptor type IA(
4600	 protein is expressed at higher levels in
4601
4602	 and
4603	)mice MBtissue MBprimary tumorsBMPs and TheirInvolvementBMP2BMP4
4604	a-118b/tumor
4605	 in boneacts as a potential inhibitor of PC bone metastasis in vivoBMP7 induces reversible senescence in PC8211912012112212312412512612712812913036131132epithelial tumor cellsSMAD–Pancreatic cancerPANC-1 cells/ xenografttumor modelBMP2Spp24related to stromal features and shorter postsurgical overall survival in pancreatic ductaladenocarcinomasBMP2 dramatically promotes tumor growthsecreted phosphoprotein (Spp)24 abolishes the effect of BMP-2 and induces tumorshrinkage when used aloneID-1,
4606	 signaling may also be inactivated by a germlinemutation of
4607	 in breast cancer cells increased chemoresistance todoxorubicin by upregulating multiple drug resistance (MDR)-1/P-glycoprotein expression and activating the
4608	,
4609	 enhances cell proliferation and chemoresistance via acti-vation of the
4610	 and
4611	 pathway regulate
4612	 and
4613
4614	  expression  in  additional  cell  types,  including monocytes,  neutrophils,  and
4615	 expression is restricted to low levels  in  nuclei  of  normal
4616	  induce
4617	 peptide vaccinations induce
4618	 YCLE=DROP RLTDAY=DROP TAFD=DROP             ADTAFDM=DROP RATE WGTTD=DROP EVID MDV BECOGN SEX RACE AGE             SCRTD=DROP CRCLTD=DROP ALPTD=DROP ASTTD=DROP ALTTD=DROP
4619	 TIME BOR CL Q V1 V2 TVEXCLQ TVEXV1V2 TVCL FCL TSE
4620	 AGE AST
4621	 were used as internal controls fordetecting miRNA-4465 and
4622
4623	 treatment for Chinesepatients with
4624	 compared with
4625	 = Cisplatin;
4626	 = Growth factor receptor; NSCLC = Non-small cell lung cancer; QA
4627	 = Overall survival; PFS = Progression freesurvival;
4628	 of PFS and
4629	 of afatinib against gefitinib, erlotinib and
4630	,
4631	 and
4632	 (catechol-O-methyltransferase),
4633	 rs4680 andA/A homozygous genotype in
4634	 and
4635	 and
4636	 was more frequentin human NSCLC tissues and that NSCLC patients with high levels ofSPIN1 presented with worse
4637	 is morefrequent in human NSCLC tissues and that NSCLC patients with highlevels of SPIN1 presented with worse
4638	 and
4639	 and
4640	 and
4641	 and
4642	 and
4643	 and
4644	 and
4645	 and
4646
4647	 ¼ other cause-specific death;
4648	 signaling molecules, while
4649	-b interacts with thetype I IFN receptor complex composed of the
4650	 family of transcription factors,
4651	 in LL/2 cells, which wasblocked by an addition of CYT387, a JAK1/JAK2 inhibitor, orAZD1480 that inhibits JAK2, Tyk2,
4652	 is one of the key transcription factors that locate down-stream of the type I
4653	 mutationsvary in their responses to drugs targeting such downstream mole-cules, which include inhibitors of MEK, PI3K, RAF, ERK, and
4654	 and
4655	 inhibitors; however, whereas inhibitors ofEGFR and
4656	 mutations, including targeting RAS effectors, such as
4657	 and
4658	 inhibitor trametinib in combinationwith the
4659	 and
4660	 signaling pathway is frequently activated in lungcancer through mutations of several genes, including activatedgene mutations in several growth factor receptors (see morebelow),
4661	 and
4662	 and three drugsfor
4663	 inhibitors are also active in suppressing
4664	 and
4665	 mutations whereas other patients havemutations in additional genes like
4666	 inhibitorsAs critical
4667	 and
4668	 mutations and
4669	 mutations and
4670	 inhibitors) are not effective in pa-tients with
4671	  5847,  Stanford,
4672	   5847,Stanford,
4673	  =  hazard  ratio;  3D-CRT  =  3-dimensional  conformal  radiation  therapy;  IMRT  =  intensity-modulated  radiation  therapy;
4674
4675	   or
4676	  and
4677	  (29%),  17  EGFR(17%),  two
4678	  (6%)  andfour  non-canonical  mutations  in
4679	  mutation  nor
4680	  mutation  (no  vs  yes)
4681	  was   the  mostfrequently  involved  gene  (56%),  followed  by
4682	   Kinase  pathway,  withKRAS  as  the  most  frequently  mutated  gene,  followed  by
4683	   and
4684	 and
4685	 (C > T; rs1143634), IL1B (C > T; rs12621220), IL1B (C > G; rs1143623), IL1B (A > G;rs16944), IL1B (C > T; rs1143627),
4686	 rs7170924-GG and
4687	 rs12621220,IL1B rs1143623, IL1B rs16944, IL1B rs1143627,
4688	 (C > T; rs1143634), IL1B (C > T; rs12621220), IL1B (C > G;rs1143623), IL1B (A > G; rs16944), IL1B (C > T; rs1143627), IL6(C > G; rs1800795),
4689	 to beassociated to
4690	 accordingto all genotypes and T-allele of
4691	 rs7170924 gene polymorphism was the only in-dependent factor associated to
4692	 and
4693	 or
4694	 (rs4778889, rs11556218, rs1131445)and
4695	 and IL12 mayregulate cytochrome P450 enzyme expression via microRNA andsubsequently promote pro-carcinogen activation and
4696	 and
4697
4698	 rs1800795 was not associated either with survival inour patients, despite a previous study with 434 Caucasian stage I-IVpatients reported that the IL6 rs1800795 G-allele was associatedwith poor
4699	 rs7170924-GG and
4700	 rs12621220,IL1B rs1143623, IL1B rs16944, IL1B rs1143627,
4701	 and CYP2E1in colorectal cancer involves
4702	 as well as
4703	 and
4704	 was 35months; median
4705	 or
4706	 and
4707	 withbrain metastasesAdvanced solid tumorG/GEJ adenocarcinoma,NSCLC, UC, biliary tractcancerAtezolizumabPembrolizumabAtezolizumabNivolumabSBRTSBRTHIGRTRadiosurgeryAtezolizumabPembrolizumabBevacizumabRamucirumabStage IIIB/IV NSCLCNivolumabBevacizumabStage IV nonsquamousAtezolizumabBevacizumabNSCLCAdvanced NSCLCAdvanced or metastatic solidtumorsPembrolizumabAtezolizumabAdvanced solid tumorsPembrolizumabAdvanced NSCLCNSCLCSHR-1210PembrolizumabStage III/IV NSCLCNivolumabBevacizumabBevacizumabNintedanibApatinibErlotinib/gefitinibBevacizumabErlotinibþNSCLC (EGFR)Bevacizumab (maintenance)DurvalumabGefitinibPhaseIIIIIIIIIII/IIPilotIIIbIIIIII/IIIbIbIII/IIIIAtezolizumabRociletinib (CO-1686)Ib/2DurvalumabOsimertinibAdvanced/metastaticþ)NSCLC (EGFRþAdvanced NSCLC (EGFR)þStage III/IV NSCLC (EGFRþStage IV NSCLC (EGFRþ)or
4708	 exerts an inhibitoryfunction in T-cell activation not only by competitively binding toCD155, but also by directly binding to
4709	 antibody was approved for SCCpatients combined with chemotherapy in first-line treatment on thebasis of the longer
4710	 inhibition promotes PD-L1expression that is reversible by
4711
4712	 and
4713
4714
4715	 overexpression show nosignificant changes in
4716	 in tumor tissue and adjacent tissue from NSCLC patients weremeasured via qRT-PCR (A); protein expression of PEBP4 in NSCLC tumor tissue and adjacent tissue was measured using Western blot analysis and quantified (B); themRNA level of
4717	 or si-SCUBE2 orcorresponding controls, the protein expression of SCUBE2 was assessed by western blot analysis and quantized (A); the proliferation of
4718	 interferes with the
4719	 and
4720	 protein is a G-protein coupled receptor that acts as thereceptor for
4721	 (C) and
4722	 or
4723	 and
4724	 and CCL22, as
4725	 levels are regulated with
4726	 harbors one miR-187-3p cognate sitespmiR-RB-REPORT
4727	 in glaucoma [25], and miR-187-3p could modulate human prostate cancer progression byrepressing androgen-regulated gene
4728	 for
4729	 and
4730	 ¼ computed tomography;
4731	 imaging has theoretical benefits over CT scan-ning for surveillance that might be expected to enhance survival,although a previous study compared PET/CT versus CT forsurveillance in stage III NSCLC patients after (chemo)radiationtreatment with regard to several outcomes, including
4732	 ¼ computed tomography;
4733	 ¼ computed tomography;
4734	 ¼ computed tomography;
4735	 and withincreased
4736	 of21 months reported in patients treated with
4737	  and  whole-brain  CT  or
4738	 and
4739	 and
4740	 and
4741	 (24%) and
4742	 and
4743	 mutations and
4744	activating mutations (Cobas EGFR Mutation Test v2 CE-IVD;Roche Molecular Diagnostics),
4745	 fromprevious or concurrent
4746	 analysis using an Ion
4747	 NGS: 1 With an
4748	 or
4749	 and
4750	 and ROS1IHC as well as NGS (excluding redundant
4751	 and
4752	 mutation in a patient with EGFR-mutantNSCLC and 1
4753	 qPCR,
4754	 IHC and FISH Analysis,
4755	 and
4756	 fromstandard
4757	 and
4758	 and
4759	 and
4760	 and
4761	 and
4762	 from previous orconcurrent
4763	 was more marked:
4764	  and
4765	 (# 45-0049-41) and
4766	 and
4767	 induced autophagy in non-small cell lung cancer cells was through AKT/mTORC1 and
4768	 reduced both the mitochondria membrane potential and
4769
4770	 in
4771	 participated in
4772	 inducedaccumulation of LC3-IIin
4773	 may alsoparticipate in the regulation of
4774	 reduced the mitochondriamembrane potential and
4775	 protected HUVECs deprived ofserum and
4776	 was early reported to influence theintracellular Ca2+ level and activating the
4777	 for 6 h, Western blot showed changes ofphosphorylated
4778	 for the indicated times, Western blot showed changes ofphosphorylated
4779	 in
4780	 wide type non-small cell lung cancer (NSCLC) cell line A549 cells and P53 deficient cell line H1299 werechallenged with 10 lM
4781	 is expected to be more sensitive than
4782	 and not
4783	   fusion   proteins   that   areactivated   by   the   dimerization   induced   by   their   amino-terminal   portions,   the   amino-terminal   domains   ofseveral  of  its  fusion   proteins   including
4784	  or  C-spine,  catalytic  spine;  CL,  catalytic  loop;  EGFR,  epidermal  growth  factor  receptor;  GK,  gatekeeper;  GRL,  Gly-rich  loop;InsR,   insulin  receptor;  I
4785	  (Fused  in  Glioblastoma)  was  fused  to  the  car-boxyterminal  protein-tyrosine  kinase  domain  of
4786	  fusion  partnersthat  have  been  reported  in  NSCLC  include  CD74,  SDC4,  SLC34A2,␣-helicalCCDC6,  TMP3,  LRIG3,  and
4787	  and
4788	  protein  kinase  reaction  is  given  by  thefollowing  chemical  equation:Mg
4789
4790	  sequence  occurs  in  many  recep-tor  protein-tyrosine  kinases  such  as  EGFR,  platelet-derived  growthfactor  receptor,  and
4791	   DFG,  Second  D  of  K/E/D/D AS  AS   tyrosines End   of  ASC-terminal  tail C-terminal  tail  tyrosinephosphorylation  sitesN2084 D2102 D2102–E2131 2110,  2114,  2115 2129APE2131 2223–2347 2274,  2334 N1254 D1270 D1270–E1299 1278,1282,1283 1297PPE12991393–1620 1507,  1604 N1164 D1177 D1177–E1206 1185,  1189,  1190 1204APE12061299–1382 1355,  1361 ␤-phosphate ␣-␤-phosphatesLinks  extracellular  andintracellular  domains  andmediates  dimer  formationPotential  regulatory  roleCatalyzestransphosphorylationAnchors
4792	  corresponds  to  its  interactions  with
4793	  closely  resembles  that  with
4794	   receptor  protein-tyrosine  kinase  inhibitor  [61];  MET   is  part  of  the  insulin  receptorfamily  and  is  related  to
4795	  to  the  receptor  tyrosine  kinase
4796	  by  a  phosphorylation  mechanism  initiated  by
4797	) are oncogenic driversin non–small cell lung cancer (NSCLC), but it has remained unknown whether ligand-independent EGFR sig-naling conferred by EGFR mutation triggers
4798	 signaling due to EGFR mutation increased
4799	 levels in
4800	 production has been found tobe induced by expression of oncogenes such as those for RAS, BCR-ABL,and
4801	R) isfrequently overexpressed in various tumor types [8,9], and activation ofthis receptor by its ligand EGF elicits an increase in
4802	 signaling by such mutationstriggers
4803	(pBabe-19del) or wild-type human EGFR (pBabe-EGFR-WT) were ob-tained from Addgene and subjected to amplification by the polymerasechain reaction with PrimeSTAR GXL
4804	 signaling induced by activating receptor mutation in-creases intracellular
4805	 Prism 3130
4806	 signaling due to an activating EGFR mutation induces
4807	 as measured with theROS-sensitive probe H2DCFDA, and this effect was greatly attenuatedby the
4808	 signaling conferred by activating receptormutation promotes
4809	 levels among
4810	 levels in
4811	 levels in NSCLC cell lines including four linespositive for activating
4812	 concentration in
4813	 levels in CD44vhigh
4814	 or control siRNAs and then assayed for surface CD44v expression by flow cytometry (A, D, and G), intracellular GSH content (B, E, and H), and intracellular
4815	 levels in NSCLC cells that harbor
4816	 defense throughup-regulation of GSH synthesis in CD44vhigh
4817	 proteins increases
4818
4819	 that was sensitive to inhibition bythe
4820	 signaling conferredby an activating EGFR mutation was associated with
4821
4822	 mutation–positiveNSCLC cell lines that manifested the lowest basal
4823	 accumulation due to oncogenic
4824	 signaling conferred by ac-tivating EGFR mutation promotes
4825	 and c-Myc potentiate apoptosis through inhibitionof NF-kappaB activity that facilitates MnSOD-mediated
4826	 mRNA by
4827	  del19 initially  randomized  to  chemotherapy  had  ashorter
4828	-TKIsMechanism  of  Resistance  (Tertiary  EGFR  Mutation) Third-Generation  EGFR-TKI C797S L789I T790M  loss
4829	  overexpression  activates  the  PI3K/AKT  pathway,  rendering  cells  less  dependent  solely  onmutant
4830	  inhibitor  cabozantinib  administered  in  combination  with  erlotinibto  patients  with
4831	  inhibitor  in  combinationwith  gefitinib  is  a  promising  strategy  for  patients  with
4832	  and  tumor  tissues);  DHPLC,  denaturing  high-performance  liquid  chromatography;  DxS  kits,  DxS
4833	  of  patients  with  advanced  NSCLC  harboring  anactivating
4834	  mutatedCaucasian  NSCLC:  circulating-free  tumor
4835	  signaling  pathwaysomatic
4836	  mutations  in  circulatingfree
4837	  muta-tions  in  circulating  tumor
4838	 or
4839	 fusions than for
4840	 mutation or
4841	 mutation-positive cases, 24% of the participating physicians were initially unsure of what targeted therapy to choose, and 16% were unsure about the use of chemotherapy in the setting of
4842	 and
4843	 mutation and
4844	 mutations and
4845	 and
4846	 rs3092989G > A, NELFErs440454C > T, PPP2R4 rs2541164G > A, and
4847	 rs2298881C > A,
4848	 rs3786527G > A was significantly as-sociated with better
4849	 rs440454C > Texhibited better
4850	 rs3786527G > A was significantly asso-ciated with better
4851	 rs2298881 (A),
4852	 ex-pression is affected by
4853	 and
4854	 and
4855	 factor
4856	 transcription factors
4857	 paralogs: roles in
4858	 parameters, MTV and TLG,differed according to the histologic subtype, and high glucosetransporter 1 expression was associated with the poorer
4859	 parameters and
4860	   demethylation   of
4861	  to
4862	  methylation  status  of  the
4863	  proteins  detected  byWestern  blotting  was  presented  as  HSD17B1  to
4864	  methyltransferases  inhibitor,  we   demonstratedthat  the  expression  of
4865	  methyltrans-ferases  inhibitor,  on
4866	  in  LCtissues  from  male  patients  may   be  associated  with
4867	 was reported to have asynthetic lethal interaction with
4868	 and
4869	 inhibitor selumetinib and the CDK4/6 inhibitor palbociclibin RAS-driven NSCLC and observed that this combination resultedin enhanced antitumor activity in cases with
4870	 was markedly inhibited by selumeti-nib while neither the phosphorylation of
4871	 and
4872	 inhibitorselumetinib and the CDK4/6 inhibitor palbociclib in RAS-drivenNSCLC with
4873
4874	 mutations and wild type
4875	 and its close homolog
4876	 mutations lead to hyperactive
4877	 loss is rare and p16 is inactivated in 30e40% of cases,which suggests that
4878	 inhibition promotestumor regressions in
4879	 mutant non-small-cell lung carcinoma with nanoparticle-mediated
4880	 ones (in contrastto that reported in Ad-NSCLC) and include
4881	 signaling and functionsUpon ligand–receptor binding, FGFR dimerizes and, in turn, itphosphorylates FRS2a,leading to
4882	 and
4883
4884	 gene amplificationsThe amplification of
4885	 amplification rate of 19%, signif-icantly correlated with smoking status and lymph nodemetastasis, not able to influence
4886	 gene mutationsSomatic FGFR mutations in lung tumors occur at the same posi-tions to germline
4887	 and
4888	 (6 cases)and
4889	 (W290C andS320C) and
4890	/FGFR biomarkers include overexpression of FGF family members,
4891
4892	 and
4893	 and
4894
4895
4896
4897
4898	1amplification and recurrent/unresectable MPM[NCT01868022]Non-selective FGFR inhibitorsDovitinib/TKI258VEGFR1–3,FGFR1/3, FLT3,KIT, RET,PDGFRBAdvanced NSCLC or colorectal cancer (CRC)previously treated with anti-VEGF therapy[NCT01676714]Nintedanib/BIBF1120VEGFR1–3PDGFRa-bFGFR1–3Previously treated FGFR1-amplified Sq-NSCLCpatients [NCT01861197]Phase I dose escalation trial in elderly patientswith stage IV NSCLC [NCT01684111]Phase I safety run-in trial in Japanese patientswith advanced/metastatic Ad-NSCLC[NCT02300298]First-line treatment in Sq-NSCLC[NCT01346540]Sq-NSCLC FGFR1-ampl 1st line (Arm A) 2nd line (Arm B)
4899	 q28Ponatinib 45 mg orally once ortwice daily q28Ponatinib 45 mg orally once aday q28ORR; DCR, PFS, 1-year
4900
4901	Ongoing,notrecruitingAntitumor activity; ORR, safety,DCR, PFSCurrentlyrecruitingPFS; OS, ORR, toxicitiesCurrentlyrecruitingPFS (Ph II), OS (Ph III); ORR,toxicitiesCurrentlyrecruitingInduction platinum-basedchemotherapy for 4 cycles withSD or
4902	 alteration inAsian patients [NCT01697605]Advanced solid tumors (ASTs) expressingPIK3CA mutations with or without FGFRalterations [NCT01928459]BAY1163877Pan-FGFRAdvanced solid tumors, including NSCLC, andhaematological malignancies with FGFR geneticalterations [NCT02160041]Advanced solid tumors (dose escalation),including Ad-NSCLC and Sq-NSCLC according toFGFR profile [NCT01976741]JNJ-42756493Pan-FGFRAdvanced solid tumors, including NSCLC, orlymphoma [NCT01703481]GSK3052230FGFR1Advanced solid tumors and deregulated FGFpathway signaling [NCT01868022]cancer) FGFR gene alteration Asian ethnicity ECOG PS 6 2 PIK3CAmutationsescalation + expansion)(doseIb FGFR gene alteration (expansioncohort) No CRC (expansion cohort) ECOG PS 6 2 FGFR gene alteration ECOG PS 6 1 Ad-NSCLC Sq-NSCLC High FGFR expression FGFR mutation Pre- and post-treatment biopsies Sq-NSCLC ECOG PS 6 1Sq-NSCLC FGFR1-ampl 1st line (Arm A) 2nd line (Arm B)MPM
4903	 and 35 SD andmedian PFS and
4904	 and
4905	 or
4906	 ampli-fication together with amplification of 11q13 (containingFGF3/4/19 genes) and
4907	 was observed in a patient with high
4908	 and
4909	 tyrosine kinase inhibitors in NSCLC cell linesthrough de-repression of
4910	 and
4911	 was positively associated with increasing PD-L1 expression (TC1/2/3 orIC1/2/3,
4912	 mutations, whereas PD-L1 positivity has been associated with
4913	 (eg, KEYNOTE-021), EML4-ALK(eg, NCT02013219),
4914	 damaging effects of DNA repair inhibitors, such asPARP and
4915	 methyltransferase)secrete gp96-Ig) þ multiple treatment regimens, including nivolumabAvelumab in combination with other immunotherapiesAvelumab þ PF05082566 (4-1BB agonist, CD137, and TNFRSF9)Pembrolizumab þ PLX3397 (oral inhibitor of
4916	 funding to the NIHR Biomedical Research Centre at The RoyalMarsden and the
4917	  may   be  a  useful  potentialtool  for  the  gene  therapy  of  human  NSCLC,  and  even  other  cancersat  high  level  of
4918
4919
4920	 inhibitors are no longer recommendedin patients who lack EGFR driver mutations, our analysis conductedfrom 2006 to 2011 demonstrates activity of an EGFR inhibitor whencombined with antiestrogen therapy among EGFR
4921
4922	 were greatly superior in
4923	 status couldbe assessed, 17 patients had mutations and 51 were EGFR
4924	for all patients, C,D) PFS and OS for
4925
4926	 with erlotinib plus fulvestrant among all pa-tients, in subgroup analysis among
4927
4928
4929	 and PFS for patients with an
4930
4931	 with the combination therapy among
4932	 TKIs in terms of PFS and
4933
4934	 occur in patients with
4935
4936
4937
4938
4939	 and
4940	 to perform direct sequencing of
4941	 and
4942
4943	 mutations confer a special sensi-tivity to the tyrosine kinase inhibitors gefitinib and erlo-tinib,2 but patients with
4944	 (exons18, 19, 20, and 21) and
4945	 mutations inpatients without
4946	 and
4947	 MutationsVariableAge (yr)ⱕ60 (%)⬎60 (%)GenderFemale (%)Male (%)HistologyAdenocarcinoma (%)LCC (%)NOS/nondifferentiated (%)SCC (%)Smoking statusSmoker (%)Never-smoker (%)EthnicityCaucasian (%)Mestizo/indigenous (%)KRASPositive (%)Negative (%)ArgentinaColombiaMexicoPeruTotalMutantpMutantp MutantpMutantpMutant p (UA)p (MA),
4948	 mutations in lung cancer: an oncogenic driver that contrastswith
4949	 and
4950
4951	 functions as an oncogene in NSCLC, acting mechanisti-cally by upregulating
4952	 functioned as competitive endogenous RNAs (ceRNAs) andpromoted the cell proliferation and colony formation, leading toupregulation of the
4953	 encoding
4954	 expression in NSCLC tissuesis significantly associated with worse
4955	 expression wasan independent prognostic indicator for
4956	 promotes the proliferation of NSCLC cells in NSCLC cell linesTo investigate whether UCA1 has a role in the pathogenesisof NSCLC, A549 and H1299 cells were selected as researchTable 2Univariate and multivariate analyses of different prognostic factors for
4957	 modulated expression of endogenous miR-193a-3p targets
4958	 regulates NSCLC progression by affectingmiR-193a-3p targets, we evaluated the effect of UCA1 on
4959	 eliminates the repression on
4960	 modulated expression of endogenous miR-193a-3p targets
4961	 kinase and
4962	1, HOXD3, HOXD4, and HOXD8-13) constitutethe HOXD cluster and are positioned sequentially from 3′ to 5′, withHOXD1 at the 3′ end and
4963	 cluster,induction of HOXD8, HOXD9,
4964	 genes like HOXD1, HOXD3, HOXD4,HOXD11 and
4965	 and
4966	 downregulated the expression of
4967	 and
4968	 (cDNA) for the human gene;
4969	 expression in HCT116, DLD-1 and HT29 cellssignificantly increased the percentage of in situ apoptotic
4970	 is inversely correlated with
4971	 (Zinc Finger Protein 618), FOXD4 (Forkhead Box D4),ETV5 (ETS Variant 5),
4972	 (Serine/Threonine Kinase 38) and the well-knownoncoprotein
4973	 and,
4974	 was inversely correlated with
4975	 and
4976	 inHCT116, DLD-1 and HT29 cells downregulated
4977	-addicted tumors by decreasing MYC levelsand increasing apoptosis, thus we checked the expression of apoptoticmarkers in
4978	 and
4979	 is negatively associated with
4980	 and
4981	 and
4982	 and
4983	 mRNA expression level in HCT116, DLD-1 and HT29 cells either expressingGFP or GFP
4984	 mRNA level as normalized to
4985	 and
4986	 genes to be negatively associatedwith
4987	 activity reduces
4988	 and
4989	 and
4990	  and
4991	  or
4992	  and
4993	  (SD  +
4994	 and
4995
4996	 protein frequently occurred in thelung cancer tissues of mutant EGFR-transgenic mice and also associated with
4997	 EGFR, and 11 with mutantEGFRs) also identified significantly stronger down-regulation of
4998	 down-regulation could be a critical step involved in the
4999	s, which include casitas B-lineage lym-phoma (c-Cbl, the EGFR ubiquitin ligase) [13], cyclin G-associated ki-nase (GAK, an endocytosis regulator) [14], and
5000	 interacts with
5001	 enhances EGF-induced
5002	 reduces the level of ubiquitylation of
5003	 over-expression was associatedwith a marked reduction of
5004	 could be a mechanism involved in themutant
5005	 gene in the Tgmouse tail
5006	 and
5007	 expressionin H1299 cellsPreviously we have established NSCLC H1299 cell lines permanentlyexpressing
5008	 kinase inhibitor, didnot reverse the
5009	 expression is subjected to epigenetic regulationsin myeloma cell lines [34], we have treated NSCLC cells with 5-aza-deoxy-cytidine (5-aza-dC), a
5010	 promotes
5011	 knockdownincreased the expression of
5012	 knockdownin H1299-
5013	 was functional in down-regulation of
5014	 reduces mutant
5015	 greatly decreased the expression of mutant EGFRs, but thesuppressive effect was less evident on the
5016	 and
5017	 (pEGFR), EGFR and
5018	 and
5019	 and
5020	 increases
5021	 show increased
5022	 exportation in NSCLC cell lines with endog-enous
5023	 over-expression associated with
5024	 over-expression, associated with the loss of EGFR negativeregulators such as
5025	 over-expression associates with
5026
5027	 and
5028	 and mutated
5029	 and
5030
5031	 are molecules involved in
5032	 (Arf-GAP, Rho-GAP, ankyrin repeat,and pleckstrin homology domain-containing protein), a molecule thatprevents
5033	 and caveolin expression among NSCLCcell lines with or without
5034
5035
5036
5037	 protein is a common mechanism incells with mutated
5038	 is associated with down-regulation of
5039	 showed bet-ter suppressive effects on mutant
5040	 mutation also demonstrated astronger down-regulation of
5041	 down-regulationis involved in the drug resistance to
5042	 over-expression associates with
5043
5044	 or
5045
5046	 and
5047	 and
5048
5049	 inhibits down-regulation of
5050	 methylation of the
5051	 methylation of APC,
5052	 was checked for both
5053	 and RASSF1A promoter in cell-free circulating
5054	 mutations,
5055	 trans-locations appear to be mutually exclusive with
5056	 is
5057	-rearranged NSCLCCrizotinib in previously treated ALK-rearranged NSCLC in east Asian patientsCrizotinib in ALK rearranged tumors except NSCLCCrizotinib in patients with advanced tumors except NSCLC with proven specific ALKand/or
5058	-rearranged NSCLC in east Asian patientsORRORRORRORRPFSPFSPFSAbbreviations: AE ¼ adverse event; ALK ¼ anaplastic lymphoma kinase; c-
5059	 Positive Non Squamous Cancer Of The Lung; NCT ¼ National Clinical Trial;
5060	 and
5061	 and
5062	 ¼ hazard ratio; NA ¼ not applicable;
5063	 5847  875 Blake Wilbur Drive Stanford,
5064	 metrics in NSCLC  Conflicts of Interest: BWL, MFG, MD, and
5065	 platform and after 2012 a Siemens Somatom Definition
5066	 loss) and A549 (EGFR wild type and
5067	 are by far less sensitive toEGFR-TKIs, particularly in those with concurrent
5068	 amplification [12],
5069	 mutation-positive NSCLCcells with
5070	-TKI-resistant NSCLC cells as well as further investigate the me-chanism of reversal of EGFR-TKI resistance in the cells with EGFR wildtype and
5071	 mutation), and H1650 (EGFR exon 19deletion and
5072	, EGFR and
5073	 mu-tation displayed more sensitivity to erlotinib compared to A549 cellswith EGFR wild-type and
5074	 damage such as DNA double-strandbreaks (DSBs),
5075	 amplification leads togefitinib resistance in lung cancer by activating
5076	 amplification: apotential mechanism of acquired resistance to
5077	 35 F2enables YM155-mediated
5078	 in response to
5079	 by
5080	 19-9, CA 72-4, and
5081	 sequencing was performed using the
5082	 +
5083	 +
5084	 was frequently downregulated throughpromoter hypermethylation in
5085	 by a constitutive or inducible approach couldsuppress cell proliferation, colony formation, and invasion abilityin
5086	 could also inter-fere with Wnt/b-catenin signaling in the development of
5087	 methylation analysis of
5088	 and
5089	 inhibits the increase of
5090	 hypermethylationand
5091	 and DLAe induced
5092	 and
5093	 and 18F-FDG
5094	 and
5095	 staging at diagnosis reported amedian PFS and
5096	 ¼ complete response; NA ¼ not applicable;
5097	  in  clusters  1,  2,  and  3  with
5098	  PS  pStage Differentiation Surgical  procedureAnemia Sarcopenia 70 Male/Female Ever/Never <22/≥22 0/1 IA/IB G1  +  2/G3 Wedge  +  segmentectomy/LobectomyPresent/Absent Present/Absent 50/40 52/38 56/34 33/57 54/36 56/34 71/12 23/67 36/54 38/52
5099	  PS  pStage Differentiation Surgical  procedure Anemia Sarcopenia 70 Ever/Never <22/≥220/1 IA/IB G1  +  2/G3 Wedge  +  segmentectomy/Lobectomy Present/Absent Present/Absent 21/31 47/5 19/33 26/26 30/22 37/9 15/37 19/33 16/36
5100	   and
5101	   domain   of   the
5102	   have   been   described   in   NSCLC   patients:TGF,
5103	   FISH   is   considered   positive   ifa  split   by   more   than   2   signal   diameters   is   detected   betweenthe  red   and   green   signals   labeling   the   3end   of   the   ALK   geneand  the   5end   of
5104	   and
5105	   affinity   forthe
5106	   kinase,   while   L1152R   reduces   crizotinib-mediatedinhibition   of   downstream
5107	  in  4  out  of  4
5108	   or   the   mutant   L1196MALK,  as   well   as   the   mutated
5109	   downstream   pathway   by   block-ing
5110	  and
5111	  secondary  mutationand
5112
5113	/
5114	 and FDG uptake on
5115	 criteriaare met, use of a more sensitive procedure such as
5116
5117	 mutation, orALK or
5118	 or
5119	 molecular testing was recommended as partof larger testing panels performed either initially or when routineEGFR, ALK, and
5120	 amplificationClinical Lung Cancer Month 2018 - 7MET Exon 14 Skipping in Lung CancerFigure 3 Kaplan-Meier Curves of
5121	 of
5122	-amplified Group Shows Poorer DFS than the non-amplified Group (E and F)Abbreviations: DFS ¼ Disease-free Survival; METex14 ¼ MET Exon 14 Skipping;
5123	 and
5124	 and
5125	 amplification leads togefitinib resistance in lung cancer by activating
5126	 ¼ body mass index; NSCLC ¼ non–small cell lung cancer;
5127	 and
5128	 expression were correlated with a shorter median
5129	 levels in adherent and tumorspheres ofSPC-A1 and NCI-H1650 cells after 3 days culture in stem cell medium containing
5130	 and MDR1 (G, H) and hsa-miR-124a (I) levels in adherent and tumorspheres of SPC-A1and NCI-H1650 cells after 3 days culture in stem cell medium containing
5131	 and
5132	 levels in adherent and tumorspheres of SPC-A1 and NCI-H1650 cells after 3days of culture in stem cell medium containing
5133	 expression wasnegatively correlated with hsa-miR-124a expression and thatUSP14 was a direct target of hsa-miR-124a, we further examinedthe prognostic value of USP14 expression together with hsa-miR-124a expression by KaplaneMeier analysis of
5134	 expression for
5135	 was highly expressed in NSCLCtissues compared with normal lung tissues and high levels of USP14in tumor tissues had poor prognostic values for
5136	 and
5137	 or
5138	 mutation statusfailed to be an independent prognostic factor for
5139	 mutationon
5140	 mutation had no prog-nostic value for
5141
5142	 mutation-positive NSCLC patients managed inreal world clinical practice had long
5143	 in NSCLCA is an inversion within chromo-some 2 that creates a fusion of ALK with
5144	 isCD74, although multiple fusion partners have been identifiedincluding EZR, SLC34A2, and
5145	 ): BRAF en-codes a serine/threonine kinase that lies downstream of
5146	 is KIF5B,although multiple fusion partners have been identified, includingthose most commonly associated with PTCA e
5147	) e fetal adenocarcinoma: CTNNB1 en-codes a transcriptional activator in the
5148	 and
5149	 and
5150	 fusionpartner is not requiredNo recommendationNo recommendationYounger patients, never-smokers, solid tumourswith mucin (“signet ring” morphology)Resistance to crizotinibResistance to crizotinib, ceritinib, alectinibRequired, but determination of
5151	 mutation is often identified, it is unlikely thatactivating
5152	 fusion as an alternative toFISH and screening for
5153	 and miRNA expression to
5154	 mutationsand
5155	 and
5156	 and
5157
5158	 mutations and
5159	 DSB repairpathways,
5160	 repair enzyme O6-alkyl-guanine-DNA-alkyltransferase (AGT), and the effect was not modifiedby
5161
5162	 (XPD) and
5163	 (485 C>A) found that compared the
5164	 double-strand breakrepair gene
5165
5166	 (rs11616)
5167	 (XPF) and
5168	 repair capacity on lung cancer riskused Host-Cell Reactivation
5169	 repair genes,APE1 Asp148Glu and
5170	 base-excision repair genes (APE1,
5171	 repair gene
5172	 repair gene
5173	 repairgenes XRCC1, APEX1,
5174	 repair genes
5175	 repair gene
5176
5177	 base excision repair genes ADPRT and
5178	 repair genes XPD and
5179	 repair genes and
5180	 Repair by
5181	 repairpathways [33], while damage by gemcitabine, etoposide, and camp-tothecin is repaired by HRR and
5182	 or HER-1and
5183	 and
5184	 mutant variants? L1152R? C1156Y? V1180L? L1196M? G1202R? R1275Q(B)
5185	 and
5186	 kinaseand showed preclinical activity against several
5187	 binding site of
5188	 and
5189	 with a T790M resistance mutation (L858R/T790M), native EGFR,IGF-R1, and
5190	 sequence of
5191	 se-quence of
5192	 gene encodes a
5193	 and
5194	 = Epidermal Growth Factor Receptor; IMRT = Intensity Modulated Radiation Therapy; IGRT = Image-guided Radiation Therapy;
5195	 scans during treatment to show that pro-nounced tumour regression was associated with worse loco-regionalcontrol and
5196	  scan  and  biopsy  or  increasedSUV  value  on
5197
5198	  and  DW
5199	  and  DW
5200	  and
5201	  todiagnose  cancer  in  LNADC  inferior  to
5202	 of
5203	 and increased esophageal fludeoxyglucose avidityon
5204	 (epidermal growth factor receptor) and
5205	 (epidermal growth factorreceptor) or rearrangements of the
5206	 or
5207	 gene amplification and exon 14 skip-ping,
5208	 and
5209	 and ALK, but also BRAF,
5210	 and
5211	 and
5212	 ¼ anaplastic lymphoma kinase;
5213	 and
5214
5215	 mutations,
5216	 and
5217	 and
5218	 and
5219	 ¼ anaplastic lymphoma kinase;
5220	 ¼ anaplastic lymphoma kinase;
5221	 and
5222	 or
5223	 and
5224	 and
5225	 and
5226	 and
5227	 and
5228
5229	 and
5230	 and
5231	 and
5232
5233	 muta-tions from circulating tumor
5234	  +
5235	 in  A  and  6  as 36%  and  3% in  29% and  7 arrhythmia age IIIB  39%, 38%, for  objective HD-EPI  +
5236
5237	 grade  3  and  4  toxicities included  nausea/vomiting (9%)  and  grade  3  alopecia  with
5238	  (17%)  and  9
5239
5240	 domain of
5241	 domain of
5242	 pathway can be an effective strategy to enhance thesensitivity against
5243	 to block
5244
5245	 pathway,
5246	 and
5247	 at 3 years was 90% for T1 tumors and 74%65LC = localcontrol;survival;Abbreviations:CSS = cause-specificsurvival; UVA = univariate analysis;MVA = multivariate analysis;
5248	   T790M   mutation   in   approximately   50%   ofcases,   and
5249	  T790M  mutation  (49%),
5250	  T790M  mutation  confers  resis-tance  to  gefitinb  or  erlotinib  therapy  by  increasing  the  affinity  ofthe  mutant  EGFR  for  its  substrate,
5251	  family  blockerscould  be  potentially  effective  in  inhibiting
5252	  fam-ily  receptor  tyrosine  kinases  derived  from  the  anilino-quinazolinechemical  series  that  was   designed  to  covalently  bind  to  Cys  773  ofEGFR,  Cys  805  of
5253	  L858R  andto  lapatinib  for  inhibiting
5254	-TKIs,  including  tumors  harboringthe  EGFR  L858R/T790M  double  mutant,  and  in  models  dependenton
5255
5256	 ORR PFS Part  I:  safetyPart  2:  ORRNot  required
5257	  mutations(Del19/L858R),  median  PFS  of  patients  treated  with  afatinib  wasprolonged  as  compared  to
5258	  of  patients  with  uncommon
5259	  amplification  [40,41],insulin-like  growth  factor  receptor  I  [42],
5260	  were  observed  in  8/22(36%)evaluable  patients,  including  4/13  (29%)  confirmed  PRs  in  patientswith
5261	  kinase  causes  drug  resistance  by  increasing  the  affin-ity   for
5262	  and
5263	  and
5264	   amplifica-tion  occurs  with  or  without  T790M  mutations  in
5265	  expressed
5266	  con-centrations  were  shown  to  exceed  the  half-maximal  inhibitoryconcentration  for
5267
5268	 T790M mutation or
5269	 procedural details that may influence diagnosticyields and complication rates were not evaluated; theseinclude tumor depth, emphysema status,
5270	 amplification leads to gefitinib resistance in lungcancer by activating
5271	 and
5272	 mutation (32%, 13/41),
5273	 mutation, EGFR mutant tumors seemed to engraftat a lower rate when compared to EGFR
5274
5275
5276
5277	 tumors based on germline mutationsWe performed targeted deep sequencing to detect single-nucleotidevariants and small insertions/deletions in 10 original tumor (F0) andPDX
5278	 E542 K (YHIM-1009),
5279	 (YHIM-1018),
5280	 mutations (P151S, H179R, Y220C, S241 F, R248 P,P278S), while 3 (10%) had
5281	 fusion and mutation wereidentified in YHIM-1005, and
5282	 genotype validationTo validate the genotypes of PDX models with driver genetic al-terations, we used additional classical genotyping methods, includingRT-PCR to identify
5283	 sequencing identified
5284	 harboring an
5285	 mutation (32%),ALK rearrangement (10%), and
5286
5287
5288	 mutation affected the engraftrate of
5289	 mutantshow lower rate compared to EGFR
5290	 mutation, EGFR-mutant
5291	 mutation-positive
5292	 wildtype,
5293	 muta-tion or
5294	inally,the following nine features were selected into the radiomicssignature, and a radiomics signature score for each patient wascalculated using the following formula:Radiomics Score
5295	 that couldpredict the
5296	 in producing
5297	 canstimulate proliferation, especially due to the oxidative inactivation ofprotein phosphatases, such as
5298	 activity is also suppressed in human breastcancers, due to the loss of its regulator
5299
5300	 to
5301	 Foundation Trust, Manchester, UKg Lowe Center for Thoracic Oncology and the Belfer Center for Applied Cancer Science, Dana Farber Cancer Institute, Boston, MA, USAMARKA R T I C L E I N F OA B S T R A C TKeywords:
5302
5303
5304	 mutations when using
5305	 extraction using the cobas® DNA Sample Preparation Kitaccording to the manufacturer’s protocol with the following modifica-tion: to maximize the likelihood of obtaining sufficient DNA to performthe cobas®
5306	 extraction, the cobas®
5307	  and
5308	 difference was observed  between  patients  with  high  and  intermediate-level
5309	  amplification achieved a
5310	 amplification in
5311	 amplification occurs with or without T790M mutations in
5312	  amplification  leads  to  gefitinib resistance in lung cancer by activating
5313	 Gene  Amplification  and  Overexpression  in Chinese  Non-Small-Cell  Lung  Cancer  Patients  Without
5314	 UK Imaging Centre, Institute of Cancer Research and Royal Marsden
5315	 and
5316	 and 18FDG
5317	 and 18FDG
5318	 and 18FDG
5319	 and 18FDG
5320	 change on 18FLT-PET
5321	 and RMH in associationwith
5322	 and dynamic contrast-enhanced
5323	 and
5324	 recognizes50 flap structures and is involved in
5325	 hypermethylationand
5326
5327	 asopposed to
5328	 scan or increased FDG uptake in mediastinallymph nodes which are not enlarged on
5329	 and
5330
5331	 and
5332	 mutant adenocarcinomaReceived consolidative SBRT to solitary LUL lung lesion and thereafter restarted gefitinibReceived SBRT to oligoprogressive RLL lung lesionReceived adjuvant carboplatin and etoposide chemotherapyReceived maintenance gefitinibReceived rechallenge carboplatin-etoposide chemotherapy due to liver progression: progression as best overall responseReceived
5333	 mutations and
5334	  55905,  United  Statese Division  of  Hematology,  Oncology,  Blood  &  Marrow  Transplantation,  Department  of  Internal  Medicine,  Carver  College  of  Medicine,  University  of  Iowa,  200Hawkins  Drive,  C32  GH,  Iowa  City,  IA  52242,  United  Statesf Department  of  Health  Services  Policy  and  Management,  Arnold  School  of  Public  Health,  University  of  South  Carolina,  915  Greene  Street,  Suite  303D,Columbia,
5335	 tissues and cell lines and overexpressionof miR-542-3p inhibited cell migration, invasion and EMT progress viatargeting
5336	 (Abbott Laboratories, Abbott Park, IL);cobas 4800
5337	 LDT,
5338	 therascreen or
5339	 and/or
5340	 or
5341	 therascreen and
5342	 or
5343	  transcription  factors  isassociated  with
5344	 ¼ event-free survival;
5345	 ¼ complete response; N ¼ node;
5346	 ¼ hazard ratio; Lyc ¼ lysine;
5347	 repair machinery thatincludes other crucial genes, such as
5348	 and
5349	 mutations and
5350	, mos(95% CI)Median survival,mos (95% CI)Abbreviations: CI ¼ confidence interval; EFS ¼ event-free survival;
5351	, mos(95% CI)Median survival,mos (95% CI)Abbreviations: CI ¼ confidence interval; EFS ¼ event-free survival;
5352	 ¼ event-free survival;
5353	 mightpromote normal cytokinesis, or how its cytokinesis function might beregulated in response to
5354	 replication was examined in these cells, itwas found that chromosomes exhibiting
5355	 Z cell-cycle progression; CI Z confidence interval;
5356	 of the GLCM on
5357	 or
5358	 CGUT T-3′; miR-214 mimics, 5′-ACAG CAGG CACA GACA GGCA GU-3′; in-hibitor control, 5′-CAGU ACUU UUGU GUAG
5359	 CAGA GAAG ATT-3′, R 5′-AGGA ACGC TTCA CGAA TTTG-3′; GAPDH, F 5′-TGAA GGTC GGAG TCAA CGGA TTTG GT-3′, R 5′-CATG TGGG
5360	 (Cell Signaling Technology, Danvers,MA, USA), PKM2 (Cell Signaling Technology),
5361	 proto-oncogene 1, receptor tyrosine kinase(ROS), and
5362	 isassociated with an individual
5363	 proto-oncogeneGTPase (KRAS),
5364	 and
5365	 V600E,
5366	 and
5367
5368
5369	 (26%) was the most commonly mutated gene inNSCLC patients, followed by
5370	 and
5371	 and
5372	 proto-oncogene(MET) for gene amplification, ALK,
5373	 mutations from circulatingtumor
5374	 mutation was found in 20 patients (20%), 5 patients (5%)had an EML4-ALK fusion, and 17 patients (17%) were identified to havea
5375	 inthe high PEC cluster group (range: 100–63,935 PEC Clusters/mL) vs thelow PEC cluster group (range: 0–71 PEC clusters/mL) (Cox
5376	 (Cox adjusted
5377	 (Cox adjusted
5378	 and
5379	 Ia and REG Ib
5380	 IX and GLUT I and the cytokines VEGF and
5381
5382	 and
5383	 vs Pembro + ImmunotherapyPlatinum + Alimta ± pembroPlatinum doublets vs Platinum doublets + Nivo vs Nivo ± Ipi1st1st1st1st1stJuly 2015PFS and
5384	 TKI-inhibitor or
5385	  also  approved  pembrolzi-umab  as  monotherapy  in  the  first-line  setting  of  metastatic  NSCLCin  adults  whose  tumors  express  PDL1  in  a  tumor  proportion  score≥(TPS)   50%  with  no  EGFR-  or
5386	 NR
5387	  mutation  and
5388	  SNPs  in  NSCLCcases  and  healthy  controlsWe  genotyped four  TNKS2  SNPs (rs1538833,  rs1770474,rs1340420,  and  rs2066275)  in  whole  blood  genomic
5389	  and
5390	   in  58  patients,  brain
5391
5392	 expression but not amplification could be an independent poorprognostic factor for overall survival among those
5393	 amplification and overexpression status in relation to survivalMethods: MET amplification was detected by fluorescence in-situ hybridization in 791 patients with
5394	 wild type patients were identified as harboring
5395	 expression was an independent prognostic factor for poor
5396	 amplification had weak relevance for
5397	 among these
5398	 gene amplification has been described asone of the reasons responsible for acquired
5399	 inhibitor therapyharbored
5400	 amplificationmay be enriched in
5401	 gene amplification andoverexpression in
5402	 mutations, and 791 had sufficientmaterial for
5403	 mutation,
5404	 amplification in
5405	amplification, the clinical pathologic characteristics of this subtypeTable 2 Clinical Characteristics of MET AmplificationePositive NSCLC PatientsStageSmokingHistologyMET/CEN7 Ratio MET Expression216 -Clinical Lung Cancer March 2017Sex/Age (Years)Case ID97191266417485535603681Abbreviations: Ad ¼ adenocarcinoma; NA ¼ not applicable;
5406	 amplifica-tionepositive patients had worse
5407	 expression had a worseprognostic implication in NSCLC patients with wild-type
5408	 prevalence of
5409	 expression but notamplification is an independent poor prognostic factor in patientsnegative for
5410	 expression but not amplification could be an independentpoor prognostic factor for
5411	 gene amplification or
5412	 expression plays differing rolesin nonesmall-cell lung cancer patients with or without
5413	 was lowerwith
5414	 encodes the receptor tyrosine kinase c-MET, and the binding of its ligand (hepatocyte growth factor,HGF) results in tyrosine phosphorylation of the receptor and acti-vation of downstream signaling pathways including phosphoinosi-tide 3-kinase (PI3K) and AKT, signal transducer and activator oftranscription 3 (STAT3), or
5415	 activationAXL is a receptor tyrosine kinase, and upregulation of AXL hasbeen reported in acquired resistance to
5416	 restored sensitivity to
5417	 activation as a result of
5418	 was amplified in 3 of 26 (12%) of
5419	 pathwayThe PIK3CA pathway via
5420	) sparingwith a very low inhibitory effect on WT
5421	 TKI that forms an irreversible covalent bond with EGFRT790M or EGFR mutation via the cysteine-797 residue and is selec-tive for EGFR sensitizing mutations and T790M resistance muta-tion over
5422	 phosphorylation in mutant and
5423	 cell lines as compared with theearly-generation
5424	 C797G mutationin cis together with
5425	 amplifica-tion (n = 29; 48%);
5426	 [84–86],
5427	 and
5428	 C797S as well as other rare tertiary EGFR mutations, amplification in MET, HER-2, Fibroblast growthfactor receptor (FGFR), and Kirsten rat sarcoma viral oncogene (KRAS),
5429	 amplificationwas observed with
5430	 muta-tion, KRAS amplification, BRAF,
5431	 inhibitor, selumetinib and
5432	 and
5433	 amplificationoccurs with or without T790M mutations in
5434	 losscontributes to erlotinib resistance in
5435	 loss in resistant
5436	 inhibitor AZD9291 isassociated with increased dependence on
5437	 count (n = 43/89) experienced worse outcomescompared to those with a low CTC load (PFS:
5438	 (2B) depending on the pre-treatment
5439	 are 50-TGCACCACCAACTGCTTAGC-30 (forward)and 50-GG
5440	 component via se-lective down-regulations of MMP-2 and/or MMP-9 through theregulation of
5441	 and
5442	 and
5443	 is a potent autophagy inducer by targeting multipleplayers in the
5444	  TKI  therapy  after  LC  diagnosis  had longer
5445	 is the preferred choice of neuroimaging study to diagnose LC, and contrast-enhanced
5446	 study or with a time-consuming
5447	  study  or
5448	 TKI therapy developed, acquired EGFR T790M resistance mutation was detected in only 1 out of 20
5449	 Y-box-binding protein 1 (YB-1), leading toup-regulation of
5450	 [88], XIST, and
5451	 contributed to cisplatinresistance of NSCLC cells by downregulating p21WAF1/CIP1expression [99] and that
5452	 methyltransferase 1; EZH2, enhancer of Zeste homolog 2; GAS5, growth arrest-specific transcript5; GAS6-AS1, growth arrest-specific transcript 6 antisense RNA 1; GHSROS, growth hormone secretagogue receptor opposite strand; HNF1A-AS1, HNF1 homeobox A antisense RNA 1; hnRNP C, heterogeneous nuclear ribonucleoprotein C; HOTAIR: Hox antisense intergenic RNA;lncRNA, long non-coding RNA; LSD1, lysine-specific demethylase 1; LUADT1, lung adenocarcinoma associated transcript 1; MALAT1,metastasis associated lung adenocarcinoma transcript 1; MEG3, maternally expressed gene 3; MVIH, microvascular invasion in HCC; NF-YA, Asubunit of nuclear factor-Y; NKX2-AS1, NK2 homeobox-1 antisense RNA 1; NPM1, nucleophosmin 1; Nrf-2, NF-E2-related factor 2; NRG1,nickel-related gene 1; NSCLC, non-small-cell lung cancer; PANDAR, promoter of
5453	 enhanced thesensitivity of cells expressing wild-type
5454	 affects cell prolifer-ation in human non-small celllung cancer, partly throughepigenetically regulating
5455	 and
5456	 repair by
5457	 (cyclin D1), which belongs to the highly conserved cyclin family, is a key regulatory protein and functions as one  of  the  regulators  of
5458	 gene may regulate the degradation of
5459	 overexpression with
5460	  and
5461	  and
5462	   receptor  expression  but  notgene  amplification  in
5463	   FISH-positive  status  predicts  shortprogression-free  survival  and  overall  survival  after  gefitinibtreatment  in  lungadenocarcinoma  with
5464	sPlatelet-derived growth factor (PDGF) is a potent SMC mitogenthat may contribute to smooth muscle hyperplasia during thedevelopment of chronic
5465	 and cancerpathology both signal through the
5466	 kinases are activated inpulmonary artery fibroblasts following acute hypoxia, and suchfibroblasts show sustained enhanced proliferative capacities [33,34],such as the
5467	 are resistant to apoptosis as induced by bonemorphogenetic protein (BMP) 2 or
5468	 scan with [18F] fluoro-deoxy-D-glucose performed onidiopathic
5469	 (growth factor) ↗V
5470	 regulates
5471	 play a key role inhypoxia-induced
5472	 samples from these11 patients with LM were examined, eight patients were found to carrythe
5473	 of LM patients harboringL858R after effective
5474	 mutations or rearrangements of
5475	 should be considered forpatients harboring primary sensitive
5476	 levels can activate PI3K/Akt signaling mainly through inhibition of phosphatases such as PTENor direct activation of oncogenes including
5477	 generation are imaged by an Arrayscan
5478
5479	  Foundation  Trust,  London,  and  Surrey,  UKb National  Heart  and  Lung  Institute,  Imperial  College  London,  UKc Royal  Brompton  and  Harefield  Hospitals  NHS  Foundation  Trust,  UKa r t i c l e i n f oa b s t r a c tSeveral   different   acquired   resistance   mechanisms   of
5480	  exon  20  duplications,
5481	 RECISTresponse, but not
5482	 (BMI b 25 and BMI ≥ 25 kg/m2) and moderate- andvigorous-intensity physical activity (
5483	 h/week
5484	 (95% CI)Multivariate adjusted HR⁎ (95% CI)Ovarian cancer deathsAge-adjusted HR (95% CI)Multivariate adjusted HR⁎ (95% CI)Pre-diagnosis physical activity± at enrollment,
5485	 = 0Vigorous PA N 0(N = 439)(N = 161)Total deathsAge-adjusted
5486	 or
5487	 (hyal-uronic acid receptor), CD90 (thy-1), TWIST, SNAIL, SLUG,EPCAM, E-CADHERIN were designed using the Primer-Quest Tool (Integrated
5488	 ¼ cycle threshold; ECAD ¼ e-cadherin; EMT ¼ epithelial-mesenchymal transition;EpCAM ¼ epithelial cell adhesion molecule;
5489	 model proved suit-able to predict the effect for high-dose ablative radiotherapy, thepresented
5490	   mutation   than   in   those   with   EGFR
5491	  and
5492	,  CR  +
5493
5494	  mutationWild-type Mutation Exon  19  deletion Exon  21  L858R Unknown
5495
5496	  mutation  thanin  those  with  EGFR
5497
5498	  for
5499
5500	mutation  status  and  only  15  (32%)  patients  had  EGFR
5501
5502	  mutations  or
5503	 for
5504	 and
5505	 inhibitor inaddition to radiation therapy had a higher median serumlevel of
5506	 levels wererecently proposed to be of importance in observed out-of-field
5507	 and
5508	 and
5509	 and/or
5510	 and
5511	 or
5512	  partners  such  as
5513	 amplification  presented  also  an
5514	 amplification in
5515	  LCC
5516	, squamous cell carcinoma; LCC, large cell carcinoma;
5517	 and
5518	 were normalized to
5519	 ex-pression was associated with reduced
5520	 expression wasassociated with reduced
5521	 and
5522	 could upregulate the expression of
5523	 was proven to mediate theinduction of
5524	  tumor  suppressors,  MstII  and  LATS1/2, can  suppress  tumor  cell  growth  by  phosphorylating  and inhibiting
5525	 of
5526	  expression  by  transforming  all other confounding variables (including age, gender, smoking history, histology, p-TNM stage, and adjuvant chemotherapy) into a single estimator and revealed that after the adjustment, the
5527	  was  relatively  low  in  all normal (
5528	 staining in NSCLC is similar to that of
5529	 and
5530	 microarray analysis identified the onco-genes Cyr61 and
5531	 with the
5532	 and its downstream transcriptional targets Cyr61 and
5533	 or
5534	 or
5535	 or
5536	 and
5537	 amplification [8] and inactivation of tumorsuppressor genes (eg,
5538	 and
5539	 and
5540	 or
5541	 mutations in the tumor as well as the absence of ALKand
5542	 mutations and the ab-sence of
5543	 mutations in lung cancer: an oncogenic driver that contrastswith
5544	 and
5545	 nor
5546	 and
5547	 and
5548	 or
5549	 or
5550	 and
5551	 mutational status was not associatedwith a statistically significant
5552	 mutation individually was associatedClinical Lung CancerSeptember 2013584 -Table 2 Associations Between Patient Characteristics and EGFR and
5553	 mutation was not associated with survival(median
5554	 ¼ hazard ratio; ND ¼ not defined;
5555
5556	 mutationalthe University ofPennsylvania, neither EGFR nor
5557	 nor
5558	 and
5559	 and
5560	 overexpression markedly increased
5561	 knockdown inhibited
5562	 upregulation is associated with unfavorable
5563	 expression and
5564	 expression independently predicts poor
5565	 expression were associated with unfavorable
5566	 was observed in LUSC pa-tients in terms of
5567	 expression and
5568	 expressionhad no influence on
5569	 and
5570	 enhances epithelial-mesenchymal transition (EMT)through suppressing E-cadherin and regulating
5571	 could epigeneticallyrepress the expression of E-cadherin via binding with LSD1 and
5572	 represses KLF2,
5573	 or
5574	 could bindto
5575	 reduced this bindingcapability of
5576	 inhibits E-cadherin expression by interacting with
5577	 bound to
5578	 reduced thisbinding capability of
5579	 also significantly in-creased Axin1, but decreased β-catenin and
5580	 expression suppresses
5581	 acts as an oncogene in non-small cell lung cancer byepigenetically repressing
5582	 could bind to
5583	 upregulated Axin1, but down-regulated
5584	 represses KLF2,
5585	 represses
5586	 ¼ hazard ratio;NR ¼ not reported; NSCLC ¼ nonesmall-cell lung cancer; pac ¼ paclitaxel; pem ¼ pemetrexed; PFS ¼ progression-free survival;
5587
5588	 is another
5589	 co-mu-tations (KL subgroup),
5590	 subgroup, hypoxia induciblefactor-1 alpha (HIF1α)-mediated metabolic reprogramming and adap-tation to oxidative and endoplasmic reticulum stress was the hallmarkof tumours with
5591	 or
5592	 codon subtypes showed that mutantKRAS-G12C or KRAS-G12 V cell lines had decreased levels of phos-phorylated
5593
5594	 or KEAP1), which may at least partially contribute to this me-tabolic diversity [39], the mutant
5595	 was specifically due to a poorprognostic effect of
5596	 wild-type NSCLCs,
5597	 and
5598	 inhibitors according tothe presence of
5599	 mutations and in those with KRAS and
5600	 signalling through PI3K-mTOR and
5601	 and
5602	 signallingPreclinical evidence supports that
5603
5604	 TKIs) or monoclonal antibodies blockingother receptor tyrosine kinases [98,99], indicating that combinationsmight be needed to fully block
5605	 signalling pathways, including the AKT-mTOR pathway[116] or
5606	 and
5607	 loss incites
5608	 mutations have been shown to be amajor determinant of primary resistance to PD-1 blockade in PD-L1positive NSCLC, regardless of
5609	-mutant melanomacell lines have demonstrated that treatment with RAF or
5610	 and
5611	 inhibitors totreat mutant Kras G12D and
5612	 mutatedpremalignant human bronchial epithelial cells is enhanced by LKB1 loss andmediated by
5613	 and
5614	 (dabrafenib) and/or
5615	 TKI)Afatinib (SOC EGFR TKI)Average cost of SOC EGFR TKICisplatin + PemetrexedDocetaxelNivolumabChemotherapy administrationManagement cost on TKI therapyManagement cost on chemotherapy/IOManagement of febrile neutropenia (Grade ≥3, above 10%)Management of anemia (Grade ≥3, above 10%)Terminal careEGFR mutation testT790M mutation tissue testUtilitiesIn
5616	  family  in  lung  cancer  tissues  by  immunohistochem-istry  and  reported  high
5617	  protein  levels  were  measured  and  normalizedto
5618	  knockdown  (CLDN1  siRNA  #1,  #2)  or  negative  control  (control±
5619	   remarkably   induced   cell   apoptosisby   arresting   the   cell   cycle   in   the   G0/G1   phase   while   simultaneously   activating   various   pro-apoptotic   sig-nals,  including   TRAIL-R2   (DR5),   Bax,   caspase   3,   cleaved   caspase   3,   and  cleaved
5620	  7500  system isolated  using  TRIzol  after  mag-nolol  and
5621	  and
5622	  treatment  resulted  in  a  moresignificant  decrease  in  the  protein  expression  levels  of
5623	  treatment  at  16 ±icantly  suppressed  the  protein  levels  of
5624	  treatments,  we   found  that  magnolol  eliciteda  more  significant  reduction  in  the
5625	  mutation,  and
5626	  significantlyincreased  the  cleaved  caspase  3  and
5627	  via  increasing  the  levels  of  Bax,  caspase  3,cleaved  caspase  3,  and  cleaved
5628	 mutations or
5629	 or
5630	 muta-tions [42,43] or
5631	 and
5632	 interacts with
5633	 exerted ceRNA function in NSCLC by regulating miR-448 and
5634	 upregulates
5635	 forward, 5′-CCAGATTCCAAGGGCTGATA-3′,and reverse, 5′- GATGTTTGGAGGCATCTGGT-3′;
5636	 positively regulates
5637	 as well as between
5638	 on the expression of
5639	 and
5640	 and
5641	 positively regulates
5642	 as well as the positive expressioncorrelation between
5643	 positively regulated
5644	-miR-448-
5645	 or
5646	 and
5647	 was negatively regulated by miR-448, while was positively regulated by
5648	 can act as a ceRNA inNSCLC by competing with miR-448 to share
5649	 contributes to tumorigenesis of human os-teosarcoma by sponging miR-9-5p and regulating
5650
5651
5652
5653
5654	 arm, representing an
5655	 in the
5656
5657
5658
5659
5660
5661	 and
5662	 mutation (BRAF V600E, n-9; BRAF non-V600E, n-9), 20 tumorswith ERBB2/3 aberration (ERBB2 mutation, n-13;
5663	 fusionand
5664	 mutation or
5665	 V600E mutation, BRAF non-V600E mutation,
5666	 non-V600E mutation, n-1;ERBB2 amplification, n-1;
5667	 mutation,was not reached in patients with
5668	 or
5669	 – not reached;
5670	 exon 14 mutantNSCLC (67%) and
5671	 mutant or
5672	 expression while
5673	 positively regulated
5674	 functioned as a ceRNA to upregulatethe expression of
5675	 and miR-137 were determinedusing SYBR Green PCR Kit (Takara Biochemicals, Kyoto, Japan) andTaqMan miRNA assay (Applied Biosystems, Foster City, CA, USA) onthe
5676	 and U6 small nuclear RNA (snRNA) were used as the in-ternal controlfor
5677	 AC-3′, reverse, 5’-GCG GCAGGT CTT AAG
5678	 positively regulated
5679	 knockdown reduced the proteinlevel of
5680	 increased the protein level of
5681	 positively regulated
5682	 positively regulated
5683	 knock-down inhibited tumor growth, increased miR-137 expression level, anddecreased
5684	 acts as an oncogene in non-small cell lung cancer by epigenetically repressing
5685	 and
5686	 was precipitated with cold diethyl ether and washedthree times with cold freezing solution containing 80% diethyl etherand 20% methanol to remove residual NHS and
5687	 or
5688	 are water-filled vesicles that will collapse into the dehydrateddisks detected by
5689	 image of PEG–PLGA self-assembled structures (A);
5690	  [25],  and
5691	  kinase  blockade  by  Ad-PTENinhibits  invasion  and  induces  apoptosis  in
5692	 were evaluated by
5693	 (ie,increasing and above pretreatmentbaseline) with an associated enlarging mass on
5694
5695
5696
5697	 treatment caused disruption of microtubulepolymerization and
5698	 stimulated the pro-apoptotic ER stress signaling pathway, indicated byelevated levels of BiP, phospho-PERK, phospho-eIF2α, CHOP and
5699	 as an anticancer agent that evokes apoptosis by inducing microtubuledisruption,
5700	 as a positive control or the 34 derivatives of PPT for 72 h, followed by the
5701	 disrupts polymerization of intracellular microtubulesAs
5702	 induces
5703	 damage in
5704	 and γ-H2AX levels with
5705	 triggers
5706	 treatment modulates the cell cycle in NSCLC cell linesCell cycle modulation is one of several downstream events of acti-vation of
5707	 induces endoplasmic reticulum (ER) stressIn previous experiments by our group,
5708	 damage induction by
5709	 induces apoptotic cell death in vitroThe observation that APP induces
5710	 induces apoptotic cell death in NSCLC cell lines andexerts stronger inhibitory effects than
5711	 showed increased lipophilicity comparedwith original compound,
5712	 against NSCLC cell lines is independent of p53and
5713	 prevents polymerization of mi-crotubules by binding to tubulin, similar to
5714	 additionally increased the ex-pression levels of phospho-PERK, phospho-eIF2α,
5715	 promotes severalcellular stress conditions such as
5716	 exerts lower cyto-toxicity to normal healthy cells and higher efficacy than
5717	 ap-pears to induce apoptotic death of NSCLC cells via modulation of sev-eralsuch as disruption ofmicrotubule polymerization,
5718	 and gamma-ionizing radiation enhances cell death and G(2)/Marrest through regulation of
5719	 promoted the NSCLC progression via
5720	 might promote the genesis of NSCLC cells by fa-cilitating
5721	 directly inhibited miR-145 expression,while indirectly reverse
5722	 is upregulated in NSCLCtissues and closely associated with advanced TNM stages, lymph nodemetastasis, distant metastasis, and poor prognosis, besides, it promotesthe miR-181a gene
5723	, sug-gesting that SNPs increasing endometriosis risk in this region actthrough, but further functional studies are required to rule out inverseregulation of both LINC00339 and
5724	 regulated by
5725
5726
5727	 mutations withbrain metastases, with median
5728	 of13 months (n = 21) in a Chinese population without
5729	 inhibitors,
5730	 inhibitorsreaches 60–100%, with median
5731	 TKIs improved median
5732	 and
5733	 or
5734	 in patients with
5735	 mutation-positive diseasehad longer
5736	 mutation-positive disease hada median
5737	 is a tumour sup-pressor involved in
5738	 MMR gene and candidate tumoursuppressor
5739	 damage-induced apoptotic response, and its encoding gene
5740	 repair ofplatinum-induced
5741	 activation, which activates
5742	 is phosphorylated following
5743	 expression and platinumsensitivity [90,91], and
5744	 inhibitormaintenance in
5745
5746	 Repair by
5747	 impact on
5748	 damage triggers golgidispersal via DNA-PK and
5749	 mutations, high PD-L1thatexpression on TCs was associated with a betterresponse toEGFR-TKIs and longer progression-free survival (PFS) and
5750	 amplification,
5751	 loss contributes to erlotinib resistance in
5752	 mutations and
5753	 and
5754	 and
5755	  and  VEGF  expressionin  patients  with  non-small-cell  lung  cancerQunying  Lin a,1,  Lijing  Guo a,  Guosheng  Lin a,  Zhiwei  Chen a,  Tonghuan  Chen a,  Juan  Lin a,Bo  Zhang 1,b,c,  Xiaobin  Gu b,*a Department  of  Respiratory  Medicine,  Affiliated  Hospital  of  Putian  University,  999  East  zhendong  Road,  Licheng  District,  Putian,  Fujian  Province,  Chinab Cancer  Center,  Chinese
5756	 Univariate  analysis P-value HR Multivariate  analysis P-valueGender Age Smoking  status Histology  type TNM  stage Differentiation Lymph  node  status
5757	 (n ¼37; 41%), followed by
5758	 was
5759	 for the patients who developed irAEs > 3 monthsafter starting ICI therapy was
5760	  and
5761	  and
5762	 and
5763	  and
5764	 mutations are found in 25% to 40% of NSCLCs,5–7 with
5765	  and  PI3K/AKT  pathway  are  in  various  stages of clinical trials for treatment of NSCLC patients with
5766	 and
5767	 and RAL in human NSCLC cell lines to show that
5768	  (siRALA, 5′-GACAGGUUUCUGUAGAAGA-3′),
5769	 (siRALA II, 5′-CAGAGCUGAGCAGUGGAUU-3′) and
5770	  (BD Transduction Laboratories, San Jose, CA),
5771	  and  phospho-AKT,  and
5772	  and
5773	  and  the  second  for
5774
5775	  and
5776	  and
5777	  or
5778	  and
5779	 and
5780	  membrane  expression  is  higher  than
5781	 than
5782	  and
5783	  and
5784	  and
5785	  activation  was  also higher  in
5786	 activity and
5787	 mutations trended toward high
5788	 and
5789
5790	,
5791	 and
5792
5793	 versus
5794	 had the greatest effect, with inhibition of monolayer growth  in  two  of  six
5795
5796	 knock-down whereas knockdown of
5797	 pathways, which also signal downstream of
5798	 WT, has high
5799	 G12C and  G12V  mutants  have  high  KRAS  activation  compared with cells transfected with KRAS
5800	 G12C mutant was also seen when compared with H2228 cells overexpressing KRAS
5801	  G12C  and G12V overexpressing cells had a 48% and 127% increase in anchorage independent growth compared with KRAS
5802	 and RALgrowth for cells overexpressing KRAS G12C was RAL depen-dent, as shown by a 83% inhibition in anchorage independent growth with siRNA-mediated depletion of RALA+RALB in H2228 cells expressing KRAS G12C compared with 44% and 34% inhibition in cells overexpressing
5803	 and
5804	 risk score impacts the prognostic stratification driven by the
5805	  and
5806	 and
5807	 and
5808	 and
5809	 and
5810	  and  high
5811	 and
5812	 or
5813	  expression seemed  more  important  in  driving  growth  in
5814	 activating mutation had greater dependence on RAL for anchorage independent growth compared with lines with other codon 12 mutations or KRAS
5815	 pathways downstream of
5816	  pathways  downstream of
5817	 signaling pathways such as PI3K/AKT and
5818	  mutations  in  lung  cancer:  an  oncogenic  driver  that  contrasts with
5819	 and
5820	,#ab199726, abcam), ATM phosphorylation at Ser1981(#ab79891,abcam), Ku-80(#ab119935,abcam), RIP3(#ab152130, abcam),
5821	 DSBs and DNA
5822
5823	 DSBs and corre-sponding
5824	 induction and activation as well as therelease of
5825	 induction, phosphorylation at Ser358, andtrimerization, as well as release of
5826	 inductionand activation as well as release of
5827	 protein,and release of immune-activating chemokine
5828
5829	 DSBs and corre-sponding
5830	 as well as release of
5831	 and
5832	 as well as release of
5833	 induction and activation as well as
5834	 both positively andnegatively regulates
5835	  and
5836	  TKIs  is  the  T790M  gatekeeper  mutation  in  the
5837
5838	  exon19  deletion  showed
5839	  inhibitors,
5840
5841
5842
5843
5844
5845	  TKI  that  ismutant  selective  and  causes  less  inhibition  of
5846	  TKI  that  inhibitsT790M  mutants  and  shows  limited  activity  against
5847	  inhibition  against  L858R  and  T790M  mutants  andspared
5848	  TKI,irreversibly  suppresses  the  ATP-dependent  autophosphorylationof
5849	  mutants  than  against
5850
5851
5852	  and  vascularendothelial  growth  factor  receptor  (VEGFR)-2  dual
5853
5854	  gene  amplification  or
5855	  sparing,irreversible  inhibitor  of  T790M-containing
5856	 76% 24%
5857	 gained was thesum of survival time of the TTP and
5858	,that increase the affinity of EGFR for
5859	 and cyclin-D1 gene and proteinexpression of NSCLC cellsMetronomic VNR (144 h) decreased ABCG2 gene and protein ex-pression in NSCLC
5860	 expression was mediated by the activationof nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), a protein complex that controls transcription of
5861	 for the binding site ofthe
5862	 overexpression promotedthe proliferation, migration, and invasion, but inhibited the apoptosis of NSCLC cells by upregulating CDK1expression, binding with
5863	 regulates
5864	 synthesis ofA549 cells was significantly intensified after
5865	 could be immunoprecipitated using anti-
5866	 regulates
5867	 promoted
5868	 over-expression induced the expression of CDK1, P70(S6K),
5869	 facilitated tu-morigenesis and development in ovarian carcinoma by sponging miR-490-3p and further altering the expression of
5870	 contributes to ovarian carcinoma tumourigenesis and de-velopment by interacting with miR-490-3p and altering
5871	 and
5872	 pro-motes hepatocellular carcinoma development by
5873	 increased the level of
5874	 and
5875	 might bind to
5876	 promoted tumorigenesis and progression of NSCLC,possibly by regulating
5877	 ¼ hazard ratio; LI ¼ lymphatic invasion; NA ¼ not applicable; NSCLC ¼ nonesmall-cell lung cancer;
5878	 translocation the most common fusion (7%)followed by
5879	 and
5880	 and
5881	/(TP  +
5882	 to
5883	 and
5884	 scan (including somewith contrast and some without) and
5885	 and
5886	 size (2 cm vs >2 cm), tumor location(central vs peripheral), and
5887	 size and
5888	 and
5889	 and
5890	 and
5891
5892	 can add accuracy to the CT-defined primary target delineation in
5893	 to
5894	 and
5895	 data were incorporated into CT-based
5896
5897	 in primary GTVdefinition requires a clearly established methodologyparticularly for quantitative determination of the tumouredge, which is typically based on the standardized uptakevalue (
5898	 cannot beaccurately applied to automatically define the primarytumour edge in
5899	 for contouring of primary GTV in
5900	 ¼ anaplastic lymphoma kinase;
5901	 per patient, moAverage PFS per patient, moOS duration gained per patient, mo (AS
5902	101,826287,848128,478,21124,223,330153,091,21483,125287,848122,351,53124,315,995147,038,50
5903	 IHC, V200 forALK FISH, and V230 for
5904
5905	 per patient, moAverage PFS per patient, moDuration of OS gained perpatient, mo (AS
5906	2,545,6547,196,203138,401,325268,977,3041,044,210,2721,461,330,7572,078,1267,196,203129,660,046268,977,3041,046,901,5782,545,6547,196,203138,401,325268,977,3041,044,210,2722,940,7447,196,203183,481,197268,977,3041,036,252,915101,826287,848128,478,211024,223,33083,125287,848122,351,531024,315,995101,826287,848128,478,211024,223,330117,630287,848173,138,959014,622,2461,454,813,25
5907	 and 1% for
5908	 mutated and/or
5909	 tyrosine kinase inhibitors (TKIs)(gefitinib, erlotinib and afatinib) have been approved in first-line forEGFR mutated patients, and the
5910	 T790M mutation and ex-periencing disease progression after a previous treatment with an EGFRTKI [8], while ceritinib (with also a positive opinion for an initial au-thorization of alectinib) has been approved in
5911	 and
5912	 amplifications [13],dabrafenib or vemurafenib for
5913	 mutants an
5914	 mutation and theALK rearrangement assessments were strongly recommended in ad-vanced NSCLC according to histological (adenocarcinoma, large cellcarcinoma, mixed carcinoma with adenocarcinoma and not otherwisespecified –
5915	 and
5916	 and
5917	 and 15 (1%)for
5918	 alteration and 3 (20%) pre-sented an
5919	 or large-cell carcinoma) predictive feature(1523), the most frequently performed tests were
5920	 nor
5921	 mutated and/or
5922	 translocation and
5923	 test was per-formed in the vast majority of patients, while the
5924	 rearrangements areoften mutually exclusive with
5925	 and
5926	 and
5927	 mutated or
5928	 rearrangements are mutuallyexclusive with mutations in
5929	 regulates lung cancer cell proliferation and cellu-lar transformation, and PHF8 knockdown induces
5930	 damage isinvolved in apoptosis induced by
5931	 knockdown increased number of TUNEL-positive cells in lungcancer cells, indicating that PHF8 knockdown induced
5932	 knockdown activates caspase 3, Bax, p21,
5933	 is regulated by
5934	 but the
5935	 parameter, SUVmax, was notsignificantly associated with
5936	 ¼ hazard ratio; MTV ¼ metabolictumor volume; NA ¼ not applicable; PS ¼ performance status; Ref ¼ reference; TLG ¼ totallesion glycolysis;
5937	 parameters before and after the first cycleof chemotherapy and found the prognostic factors of
5938	 and
5939	 ¼ anaplastic lymphoma kinase; ECOG ¼ Eastern Cooperative OncologyGroup;
5940	/
5941	 and
5942	 or
5943	 or
5944	 and
5945	 ¼ anaplastic lymphoma kinase;
5946	 on APCs and prevent theinteraction between CD80 on APCs and
5947	 ¼ complete response;
5948	 or
5949	 and
5950	 brainabdominal
5951	 genes in tumor tissues non-small cell lung cancerJia-Jia Wu1, Shun-Chang Jiao2*1Department of Training,
5952	 +
5953	 group, the survival period and the level of hENTl of DDP+GEM group increased obviously, the level of
5954	 of the tumor tissue  The ERCC1 expression of tumor tissues in the NS group, ES group,
5955	 in
5956	 expressions of
5957	 isoform expression and
5958	 as a measure ofeffect for time-dependent variables, HRs, when obtainedfrom studies using multivariable analyses, propensity-matched analyses, or randomized trials, are risk-adjustedfor other variables that influence
5959	 for
5960	 and
5961	 scan only; 30% with CT inaddition to either
5962	 and
5963	 codes for
5964	 and
5965	 3′-UTR, but not the 3′-UTRs of MDM4, NUCB1, DEFA, or
5966	 3′-UTR, but spared the reporters with the3′-UTRs of MDM4, NUCB1, DEFA, and
5967
5968	 andTAMs was performed with monoclonal anti-rabbit OPNantibody at a 1:200 dilution (rabbit, ab8448, Abcam,Cambridge, MA) and
5969	 ¼ overall survival;TAMs ¼ tumor-associated macrophages;TOPN ¼ osteopontin expressed by tumor-Ann Thorac Surg2015;99:1140–8LI ET ALOPN EXPRESSED BY MACROPHAGES
5970	 andosteopontin (
5971	 (B-Rafproto-oncogene, serine/threonine kinase) mutations,
5972	 preparations, obtainedusing the CellSearch system (Veridex) from patients with
5973	 detection didnot correlate with PFS and
5974	 analysis is to detect the somatic mutations thatClinical Lung Cancer November 2016512 -Table 1 Relative Advantages and Disadvantages ofCirculating BiomarkersBiomarkerAdvantagesCTCsQuantification of CTCsis prognostic inmultiple settings(screening, aftersurgery, advanceddisease)Molecular aberrations(point mutations,rearrangements) aredetectable in CTCsCirculating
5975	 mutation status between cfDNA and CTCsNonrandomized interventionalDiagnostic accuracy of FISH for
5976	 than serum for the detection of
5977	 mutatedCaucasian NSCLC: circulating-free tumor
5978	 for thedetection of
5979	 mu-tations from circulating tumor
5980	 T790M in plasma
5981	" canthar-idate OR Aidi OR Aidi injection OR Addie) AND (""Paclitaxel""[Mesh] ORPaclitaxel OR Taxol OR "
5982	 plus
5983	  proteinsform  ion  channels  mostly  non-selective  for  monovalent  and  diva-lent  cations,  with  some  exceptions  such  as
5984	  channel  activityand  regulating  the  cell  cycle,  include  pathways  mediated  by  aCa2+/calmodulin-dependent  kinase  II  (CaMKII),  which  modulatesCa2+-calmodulin  (CaM)  and  a  nuclear  factor  kappa-  light-chain-enhancer  of  activated  B  cells  (NF␬B),  a  protein  complex  controllingtranscription  of
5985	  by
5986	  has  also  been  reported  in  a  rat  model  forParkinson  disease  in  which  1-methyl-4-phenylpyridinium  (MPP+)is  administered  into  the  right  median  forebrain  bundle  [16],  causingDA  neurons  degeneration  likely  due  to  oxidative  stress  mediatedby  extracellular
5987	  was  detected  both  at  plasma  and  ER  membrane,  andHG-astrocytoma  cells  treated  with  mNPC-CM  presented  a  Ca2+response  associated  with  morphological  hallmarks  of  ER  stress,  anda  robust  upregulation  of  the  ER  stress  gene
5988	  with  siRNAs  prevented  mNPC-CM-induced  tumor  celldeath,  confirming  the  triggering  of  ER  stress  pathway(s)  after  acti-vation  of
5989	  and  AEA  triggered  a  rapid  TRPV1-mediated  extracellularCa2+ influx  and  resulted  in  apoptosis  by  a  mechanism  involving  theintrinsic  pathway  characterized  by  caspase  3/7  activity  increase,loss  of  mitochondrial  membrane  potential  and
5990	  generation  induced  by
5991	  decreased  the  viability  of  humanbladder  cancer  cell  line  5637  in  a  dose-dependent  way   associatedwith  increased
5992	  without  clearlydemonstrating
5993	  silencing  was  dependent  on
5994	  triggered  PI3K  activation  that  both  promoted  TRPV2relocalization  at  plasma  membrane,  and  induced  up-regulation  ofthe  Aml-1a  transcription  factor  that  in  turn  regulated  the  tran-scription  of
5995
5996	  interaction  with
5997	  and
5998	  production  and
5999	  and
6000	  with
6001	  channels
6002
6003	  and
6004	  contributes  to  impairedmitophagy  and  accumulation  of  dysfunctional/damaged  mitochon-dria,  which  further  results  in  increased
6005	  trimers  to  theplasma  membrane  promotes  an  influx  of  Ca2+ ions,  which  is  medi-ated  (at  least  in  part)  by
6006	  channel  regulated  astrocyte  proliferationthrough  the
6007	  [154],
6008	  family,
6009	  pathway  is  commonly  required  forTRPC6,  TRPV2,  TRPM2,
6010	  neurons  primary  culture(sensory  neurons)Neuron  enriched  embryonic  rat  mesencephaliccell  culture  (DA  neurons)Adult  rat  neurons  culure  isolated  from  DRG Embryonic  rat  cortical  neurons  enrichedcultureNeonatal  rat  retinal  ganglion  cell  culture trpv1−/− mice female  rats  sustaining  unilateral  injection  ofMPP+  into  median  forebrain  bundle(Parkinson’s  desease  model)Fresh  brain  tumor  cells  primary  cultures,  U87and  U251  glioma  cell  linesHuman  neuroblastoma  CHP100  cells Mouse,  rat  and  human  HG-astrocytoma  celllinesin  vivo  orthoptic  implantation  of  control  ortrpv1−/− HG-astrocytoma  cellscytotrophoblasts  primary  cultures  from  humanplancentaEmbryonic  rat  osteoblast  primary  culture Rat  thymocytes  primary  culture
6011	 Retinal  ganglion  cells  degeneration  in  trpv1−/− mice  compared  to  wild  type Less  DA  neurons  degeneration  in
6012	  activationIncreased  resistance  to  apoptosis  induced  by  thapsigargin  or  cisplatin  andtranlocation  of
6013	  and
6014	  for  Ca2+ influx  to  induce  further
6015	  channeland  overexpression  of  TRPM2  exacerbated  MPP+-induced  cell  deathTRPM2-S  resulted  in  increased  proliferation  through  phosphatidylinositol3-kinase/Akt  and
6016	  mediated  TNF-induced  necroptosis  by  targetting  the  RIP3  necrosome  tothe  plasma  membrane  and  regulated  Ca2+ influx  through
6017	LNCaP,  DU145 BCTC,  a  specific  TRPM8inhibitorHuman  prostate  cancer  cell  LNCaP  and  PC-3cell  linesnone Trpm8−/− mice,  HEK  293  cell  lines TRPM8  Knock  downcold-shock  responseHuman  prostate  cancer  cell  LNCaP  and  PC-3cell  linesTRPM8  mutant  overexpression,starvatioHuman  colon  cancer  Caco-2  and  HCT  116Human  osteosarcoma  cell  lines  MG-63,  U2OS,SaOS2  and  HOSCannabigerol  (CBG),  TRPM8antogonistTRPM8  silencingsynoviocytes  isolated  from  collagen-inducedarthritis  ratsMenthol Human  prostate  cell  RWPE1,  RWPE2,  LNCaP,DU145  and  PC3human  malignant  melanoma  cell  line  (G-361) TRPM8  overexpression(TRPM8OE),  menthol,testosteroneMenthol TRMPL Trpml  deficient  Drosophila trpml  gene  loss  of  funtion TRPML1MLIV  patients Skin  fibroblasts  from  MLIV  patients trpml1  gene  loss  of  function  ordeletionstrpml1  gene  loss  of  function  ordeletionsMouse  coronary  artery  myocytes TRPML1  silencing TRPML2 S2  Drosophila  cells TRPML3Varitint-waddler  mutated  mice HEK  cells TRPP2HEK  293  cells,Overexpression  of  humanA424P  mutated  trpml2  geneconfering  constitutive  activityA419P  mutation  in  trpml3  geneconfering  constitutive  activityExpression  of  A419P  trpml3mutated  gene  conferingconstitutive  activityTRPP2  overexpressionMadin–Darby  canine  kidney  (MDCK)  cells TRPP2  knock-down Urocortin  induced
6018	  modulatesphagocyte
6019	 = hazard ratio; GCS = global circumference strain;
6020	 = hazard ratio; ECOG PS = Eastern Cooperative Oncology Group performance status; GCS = global circumferencestrain;
6021
6022	 mutations, especially at codon 12, are asso-ciated with worse progression-free survival (PFS) and
6023	 in patients with ES-NSCLC with and without
6024	 mutation was identified as a favorable prognostic factor, with 5-year
6025	 codon 12 mutation or
6026	 mutation was associated with longer
6027	 mutation correlated with longer
6028	 in patients with higher levels of
6029	  and
6030	The BRCA gene is a tumor suppressor involved in the homologous recombination repair pathway, a mechanism for
6031	  and
6032	 and
6033	 was detected and the methylation of
6034	 mRNA expression corre-lated significantly with worse
6035	  and
6036	 repair proteins
6037	 repair by
6038	 synthesis and repair genes
6039	  isoform  expres-sion  and
6040	  and
6041	 and
6042	 induced
6043
6044	 ex-pression is observed in the PC-9-derived afatinib resistant cells, which isaccompanying with
6045	 was regulated by
6046	 were purchased from CellSignaling (Danvers, Massachusetts, USA), and
6047	 induced
6048	 and
6049	 and
6050	-positive lung cancer cell lines, including HCC827 (EGFRE746-A750 deletion) and A549 (EGFR wild type) were selected to in-vestigate the relationship between EGFR and
6051	 and
6052	 and
6053	 regulated
6054	 induced the expression of
6055	 induced
6056	-positive HCC827 and A549 lung cells were analyzed for observing EGFR and
6057
6058	 induced
6059	 andHER2 was used to block EGFR-mediated pathway and we found that afatinib reduced the mRNA levels of
6060	 and
6061	 and
6062	 and
6063	 and
6064	 and
6065
6066	 was regulated by
6067	 reduced
6068	 was associated with ErbB3, IRS-2, and
6069	 and
6070
6071	 levels andphosphorylation [3], suggesting that YM155-direct binding of
6072	 is a downstream oncopro-tein of
6073	 enhanced the expressions oftumor survival-associated
6074	 regulates not only EGFR, but alsoErbB3, IRS2, IGF1R, and
6075	 and
6076	 reducedErbB3 expression, we proposed that YM155 blocked the
6077	 isa downstream protein of
6078	 also influences other oncogenic receptor expression asso-ciating with drug resistance, including ErbB3, IRS2, IGF1R, and
6079	 signaling ab-rogates resistance to afatinib (BIBW2992) in
6080	 and
6081	 and
6082	 active site by
6083	 homeostasis and antioxidantgene regulation, mitochondrial oxidative stress, apoptosis, aging, ironhomeostasis, ATM-regulated
6084	 (and other growthfactors) binds to
6085	 expressionReactivation of
6086	 amplification (10%), METamplification (5–15%),
6087
6088	 inhibitors aresimilar to those of EGFR-TKIs: secondary point mutations, ALKgene amplification [61],
6089	, KIT proto-oncogene receptor tyrosine kinase; IGF-1R,insulin-like growthfactor 1 receptor;
6090	 and
6091	 amplification: a potential mechan-ism of acquired resistance to
6092	 amplification leads to gefitinib resistancein lung cancer by activating
6093	 expression by blocking nucleartranslocation of
6094	 loss in resistant
6095	 and
6096	 (excision repair cross-complementinggroup 1) and
6097	 (methylenetetrahydrofolatereductase),
6098	 (rs11615), ERCC1 (rs3212986),
6099	 alsoplays an essential function on
6100	 repairpathway is
6101	 and
6102	 (rs11615), ERCC1(rs3212986),
6103	 repair genes such as ERCC1,
6104	 stimulates humanpolynucleotide kinase activity at damaged
6105	 677 C → T,
6106	), adecrease in the sum of the target lesion diameter by at least 30%compared to baseline; progressive disease (
6107	 images were taken everymonth until
6108	 and
6109	 or
6110	 (Ser109) (Cell Signaling Technology Cat#46931), p-YAP (Ser127) (Cell Signaling Technology Cat# 13008, RRID:AB_2650553), YAP (Cell Signaling Technology Cat# 14074, RRID:AB_2650491) and
6111	 activation, we examined the phosphorylation ofYAP, MKK3/6 and
6112	 and
6113	 inhibition, Westernblotting revealed that phosphorylation of
6114
6115	 amplification whereas H1975 exhibits a secondaryT790 M
6116	 and then
6117	 and
6118	 inhibitors could inhibit phosphorylation of p38 MAPK andSTAT3, but not
6119	 amplification leads to gefitinib resistance in lung cancerby activating
6120	 Concurrent targetable alterations PD-L1 expression CD8 + TILs
6121	 (clone ES05; 1:30; Dako, Shanghai, China),MSH2 (clone FE1; 1:50; Dako),
6122	 and
6123	 and
6124	 and
6125	 and
6126	 and
6127	 and
6128	 signaling pathway involved in the molecularmechanism of the
6129	 are the absorbance of the
6130	 and
6131	 on the
6132	 inactivation might play a cri-tical role in the effects of the
6133	 has antioxidant, antiproliferative, andantimigration activities in NSCLC cells through
6134	  mutations  and
6135	 was notmandatory in this study, hence the influence of acquired
6136	 amplifica-tion,
6137	 derived from a tissuesample or circulating tumor DNA obtained from a plasma sample todetermine the
6138	 inhibitor (savolitinib),
6139	 amplifica-After
6140	 loss in resistant
6141	 and
6142	 sparing covalent inhibitor ofoncogenic (L858R, ex19del) and resistant (T790M)
6143	 amplification leads togefitinib resistance in lung cancer by activating
6144	 mutations and
6145	 production,amplification of the
6146	 is known toupregulate the expression of
6147	 gene amplification occurs in lung cancers withacquired resistance to
6148	 wasnumerically longer with erlotinib alone compared with onartuzumabplus erlotinib,
6149	 gene amplificationMET
6150	Lung study [18]), it is not knownwhether MET status affects the efficacy of
6151	 TKI-resistantdisease caused by the
6152	 Ma,
6153	 Comoglio,
6154	  activatingmutations  and  T790M  in  NSCLC  specimens  and  cell  linesComplementary
6155	  T790M  mutation  and
6156	  and
6157	 was a nucleocytoplasmic shuttling protein that wasmediated by two NLS and four
6158	 (Cellsignalling Technology, #5625),
6159	 partiallyovercame the gefitinib-inhibited EGFR,
6160
6161	 impaired the transcriptional activity of b-catenin/T-cellfactor (TCF) complex regardless of
6162	 and b-catenin was observedin response to
6163	 on the interaction of
6164	 co-precipitated with endogenousKPNA1 (also known as Importin subunit alpha-5) and
6165	 NLSmutant did not co-precipitate with
6166	 nuclear export by an exportin-dependent pathwayFor the classical nuclear export pathway,
6167
6168	 on export of
6169	 co-immunoprecipitated with endogenous
6170
6171	 and
6172
6173	 mutant on the interaction between
6174	 and
6175	 NLSmutant showed a comparable association of b-catenin, whereasDDX17
6176
6177	 NLS mutant and
6178	 at position T790, activation ofparallel receptor tyrosine kinases (such as ALK,
6179	 augmented theinteraction between b-catenin and
6180	and disrupted the interaction between DDX17 and
6181	 (p68) and
6182	 ¼ hazard ratio; NS ¼ not significant;
6183	)Type ofTrialsII-IIIII-IIIII-IIIII-IIIII-III346 -Clinical Lung CancerJuly 2017Table 2 Summary of Previous Meta-analyses Including Phase II-III Trials With Antiangiogenic TherapiesJacques Raphael et alJournalEur J Clin PharmacolMeta-analysisXiao et al24Liang et al25Hong et al26Sheng et al27Sheng et al28Abbreviations: DCR ¼ disease control rate; HR ¼ hazard ratio; NS ¼ not significant;
6184	 ¼ hazard ratio;
6185	 TKIs in NSCLC, EGFR antibodies in colo-rectal cancer, and
6186	 tumors treated withAT demonstrated increased infiltration of CD4þ and CD8þ Tlymphocytes, which was inversely related to
6187	 amplification, hepatocytegrowth factor (HGF) overexpression,
6188	 binding site of
6189	 amplification and
6190	 also causes
6191	 inhibitorXL880 is a more efficient inhibitor of lung adenocarcinomacells with
6192	 T790M and
6193	) overexpressionIn vivo, HGF stimulation to
6194	 inhibitor
6195	 but not
6196	 promotes the selection of cells with
6197	 accelerates the develop-ment of
6198	 activationAlthough ERBB3 is unique among the
6199
6200	 inhibitor) combinedwith gefitinib resulted in an in vitro synergistic effect ininducing apoptosis, inhibiting cell proliferation, and decreas-ing the expression of phosphorylated
6201	 V600E or BRAFG469A conferred resistance to erlotinib in PC9 cells thatharbored drug-sensitive
6202	 mutations, survival was longer in those with high
6203	inhibitors has led to the design of several clinical trialsassessing the efficacy of EGFR T790M-inhibiting agents, com-bination therapy with EGFR TKIs, inhibitors of
6204	 inhibitor PKC412, aspotent reversible inhibitors of
6205	 and
6206	-TKI (E7050) is effective for suppressing the growth oferlotinib-resistant tumors caused by the gatekeeper T790Mmutation, MET amplification, and
6207	 has also been observed in PF299804-resistantor WZ4002-resistant clones (with no T790M mutation) of PC9,and the IGF1R inhibitor
6208	 and
6209	 amplification and
6210	 kinase causes drug resistance by increasing the affinityfor
6211	 geneamplification or
6212	 amplification occurswith or without T790M mutations in
6213	 amplification in
6214	 amplification:a potential mechanism of acquired resistance to
6215	 and
6216	 and
6217	 as a strategy to overcome crosstalk-relatedresistance to
6218	 receptor tyrosine kinase inhibitors througha multistep mechanism involving the
6219	 ¼ hazard ratio; KPS ¼ Karnofsky performance status; LF ¼local failure;
6220
6221	 of 19 months, the study reported a multivariate
6222	  in  resected  stage-I  NSCLC  (TNM  6)  included 1121aThe
6223	 kinase causes drug resistance by increasing the affinity for
6224	 rate was higher inpatients harboring
6225
6226	mutationNoYesAbbreviations: CI ¼ confidence interval; CRT ¼ chemoradiotherapy; EGFR ¼ epidermal growthfactor receptor;
6227	 ¼ epidermal growth factor receptor;
6228	 in comparison with chemo-therapy alone (13 versus 11 months,
6229	 for
6230	 N F OA B S T R A C TArticle history:Received 20 May 2016Received in revised form 4 July 2016Accepted 19 July 2016Keywords:Belinostat®Seliciclib®Non-small cell lung cancerCaspase-8 activationTruncated BIDWith conventional anticancer agents for non-small cell lung cancer (NSCLC) reaching therapeutic ceiling,the novel combination using histone deacetylase inhibitor, PXD101 (Belinostat®), and
6231	 protein levels was seen while Mcl-1 and
6232	 content of cells was analyzed by flowcytometry (BD
6233	 inhibitor, toaugment the anticancer effects of PXD101, a potent
6234	 and down-regulation of Mcl-1 and
6235	 werefound using other
6236	 and
6237	  5  protein kinase B- a ;
6238
6239
6240	 mutations  14-17   and crizotinib in patients with
6241	  5  anaplastic lymphoma kinase  ;
6242	  5  protein kinase B;
6243	 vs drug back to the level of wild-type
6244	 TKIs  Unfortunately, as with
6245	 family path-way activation (including EGFR),
6246	  5  Janus kinase; mTOR  5  mammalian target of rapamycin;
6247	 and
6248	 and
6249	 is a serine-threonine kinase that links
6250	 amplifi cation occurs with or without T790M mutations in
6251	 kinase causes drug resistance by increasing the affi  nity for
6252	 amplifi cation leads to gefi tinib resistance in lung cancer by activating
6253	 inhibitors occasionally harbor
6254	 signaling causes resistance to
6255	 secondary muta-tion and
6256	 ,  Sima
6257	 (57%),
6258	 imaging characteristics, Nonesmall-cell lung cancer, Progression pattern,
6259	 imaging features and genetic muta-tions of NSCLC, such as those in
6260	 mutation and werenegative for
6261	 (n ¼ 12; 57%),
6262	 for 9 patients and
6263	 or
6264	 fusion partner genes have been identified;(w70%),KIF5B wasfollowed by
6265	 (57%) and
6266	 and
6267	 and
6268	 molecular phenotype in non-small celllung cancer:
6269	 wild-type NSCLC via
6270	 phosphorylation at tyrosine 705 in all tested
6271	  signal-ing  pathway  may  be  a  novel  approach  for  the  treatment  of
6272	 Was An Important Candidate of Sorafenib and SC-1 in
6273	 and p-STAT3 by Immunohistochemistry in
6274	  in  the same manner as sorafenib, has an anticancer effect on
6275	 as Molecular Therapy for NSCLCpresent  study  shows  that  sorafenib  has  an  anticancer  effect on
6276	  pathway  screening maybe an important condition for whether sorafenib has anti-cancer  effect  on
6277	 mutation, there are many gene abnormalities in NSCLC, such as echinoderm microtubule-associated protein-like 4 and anaplastic lymphoma kinase (EML4-ALK) fusions, human epidermal growth factor receptor 2 (HER2), PIK3CA, protein kinase B or
6278	 activation is present in a substantial number of NSCLC  cell  lines  and  NSCLC  tumor  specimens,  especially
6279	 in
6280	 is also crucial in
6281	  wild-type  NSCLC  cell death  and  represses  p-
6282	 seems to be a promising biological target for new therapeutic strategies for the treatment of
6283	 kinase domain mediate
6284	 (>1 cm on short axis) or
6285	 had been quantified, the
6286	 in diagnosis and mon-itoring
6287	 cells based on their ability toresist influx of Hoechst 33342 dye via the activity of ATP-bindingcassette (ABC) transporters like
6288	 and phosphorylation of
6289	 and
6290	 and six
6291	  and
6292	  and
6293	  and
6294	 and
6295	 or
6296	 and
6297	  and
6298	 and
6299	 fusion genes—were used to validate the specificity and sensitivity of each assay in multiplex fashion; they were acquired from
6300	 and
6301	 and
6302	 and
6303	 or
6304	 and
6305	  and
6306	  and
6307	  fusion  gene  junction  comprising  ROS1 exon  32  fused  to
6308	 and
6309	 and
6310	 and
6311	 and
6312	 (ab47010),G6PD (ab87230), GS (ab176562),
6313	 increases oxidative
6314	 production, glucoseconsumption and lactate production determined in A549 cells cultured for 48 h after transfection with
6315	 silencing in A549 cellssignificantly reduced the mRNA levels of oxidative
6316	 expression by
6317	 induces
6318	 is a primary source of cellular NADPH[13], and
6319	 depletion on
6320	 knockdown (B) and NOX4overexpression (C) on GS and
6321	 depletion, decreased glucose uptake, lactateproduction,
6322	 production in control versus
6323	 levels were associated with p-Akt, c-Myc, Glut1, LDHA, PKM2, G6PD,
6324	 directed glucose metabolismnot only to the glycolysis but also to
6325	 could also stimu-lated
6326	 upregulation could maintain relatively high levels ofreduced GSH due to promoting both the
6327	 amounts to CR rate and
6328	   C1236T-TT   and   the
6329	   C8092A,
6330	   C118T,
6331	  and
6332	  and
6333	  Asp312Asn
6334	  C1236T
6335	  rs50872  and
6336	  for
6337	  Asp312Asn  and
6338	  statusWild-type Mutated Unknown ResponseCR
6339	  Asp312Asn  and  the  TT  genotype  of
6340	  His46His  and
6341	  genotype  for
6342	   rs1805087-AG/GG  and
6343	   rs1470383,particularly  the
6344
6345	  rs50872-CC
6346	  and
6347	  C118T-Tallele  and
6348	  Asp312Asn  G-alelle,ABCB1  C1236T-TT  genotype  and
6349	  C1236T  polymorphism  on  toxicity  has  not  pre-viously  described,  although  the
6350	  His46His,
6351	   rs1470383,
6352	  vs  TT)  [15],  no  sig-nificant  association  was  found  for
6353	  rs238416,
6354	  vs
6355	  rs12621220  and These  results  suggested  that
6356	  rs238416,ERCC5  His46His,
6357	  C118T-Tallele  and
6358	  C1236T-TT  and  the
6359	  Lys751Gln,
6360	   inhibitors   afatinib,   erlotiniband   osimertinib,   the
6361	  inhibitorsand  also
6362	 (50 mg/ml) þ 300 mlannexin binding buffer) was added just before analysis using a BDAccuri™
6363	 and
6364	 on
6365	 Mutation is Highly Correlated With
6366	 and
6367	 mutations and
6368	 is known to initiate intracellular signaling pathways, trigger-ing a cascade of well-identified molecular events that protect cancer cells from apoptosis, facilitate invasion,  inhibit
6369	  and
6370	 and
6371	 and
6372	 and
6373	 and
6374	 and
6375	 and
6376	 and
6377	 exon 18−21 and
6378	 electrophoresis system (model 4200; LI-COR) with a laser diode emitting at KRAS mutation is correlated with
6379	 codon 12 is shown in Figure 1, which illustrates the muta-tion of case 15 from
6380	) and KRASGene Nucleotide alteration Amino acid alteration Frequency (%) TotalKRAS   Codon 12   Codon 13    Codon 15   Codon 31   Codon 61   Total EGFR   Exon 18      Exon 19   Exon 20     Total
6381	 mutations, only two cases had coexisting
6382	  or
6383
6384	 and epidermal growth factor receptor (
6385	 and
6386	  mutation  and
6387	  and
6388	 and
6389	  and
6390	 and
6391	 and
6392	  in  hepatocarcinoma  cells  and  Src  kinase,  to  subsequentlyactivate
6393	  (forward:  5(cid:4)-GTGTCC-TACTGGTGGTGATGT-3(cid:4),  reverse:  5(cid:4)-GGGCAATGGCACCATAGGTA-3(cid:4)),
6394	  (∼250  bp)  and  TRPA1∼120  bp)  in  an  agarose  gel,  but  not  amplicons  for
6395	  and
6396	  (∼250  bp)and
6397	  and
6398	  and
6399	  ligands,  such  as  cis-3-hexen-1-ol,  coumarin  and  eugenol  methylether,  led  to  an  increase  inintracellular  Ca2+,  and  silencing  of
6400	  signaling  but  also
6401	  and  subsequent  PI3K  activation,  but  can  alsobe  triggered  by
6402	  stimulatesphosphorylation  of
6403
6404
6405	 ¼ hazard ratio; Neci ¼ necitumumab;
6406	 REceptor (SQUIRE) study conducted in thefirst-line setting, necitumumab combined with gemcitabine-cisplatin chemotherapy significantly improved
6407	   were   the  ECOG,   disease   stage,EGFR   and
6408	   mutations   and   low   frequency   of
6409	  received  platinum-based
6410	  (exons  18–21)and
6411	  mutationPositive Negative
6412	  and  EGFRwild-type  mutations  were  associated  with  a  lower
6413
6414	 indicates an unfavorableprognosis in non-small cell lung cancer: Evidence from the GEO databaseZichao Zhanga,b,1, Tiantian Liua,c,1, Kai Wangc,e,1, Xiao Quc, Zhaofei Pangc, Shaorui Liuc, Qi Liuc,Jiajun Duc,d,⁎a School of Medicine, Shandong University, 44 Cultural West Road, Jinan 250012,
6415	 = overall survival; PFS = progression free survival;
6416	 expression showed only a trend toward shorter
6417	 expression could be a poor prognosticpredictor for
6418	 = overall survival; PFS = progression free survival;
6419	 was not independently associated with different
6420	 expression levels were found to predictshorter
6421	 was expressed at lowerlevel for patients with shorter
6422	 and PFS (A) Kaplan–Meier curve for OS in GSE3141 between 40 low
6423	 in GSE19188 between 53 low
6424	 in GSE29013 between 35 low
6425	 in GSE30219 between 176 low
6426	 in GSE31210 between 102 low
6427	 in GSE37745 between 125 low
6428	 in GSE50081 between 66 low
6429	 expression was related to shorter
6430	 expression indicated shorter
6431	 expressiondata from GSE17710 (Human lung squamous cell carcinoma expressionprofiling) which was downloaded from GEO database, to explore bio-logical pathways involving
6432	 = overall survival; PFS = progression free survival;
6433	 and
6434	 regulated by
6435	  40%  (163/410),
6436
6437	  rearrangements,
6438	  mutations  developed  detectable  resistancemutations  (T790M  or
6439	  mutation Resistance  Mutation Site  of  resistance Resistance  prior  to
6440	  and
6441	  and
6442	  T790M  or
6443	 and
6444	data in the analysis since tumors in CT scans were not well co-registered with those in
6445	 scans, or tumors could be segmented for PET and
6446	 and FDG
6447	 scanswere corrected for attenuation using the mid-ventilation phase ofthe 4D
6448	 and the mid-ventilation
6449	 images werecorrected for attenuation, using a low-dose
6450	 (HU), FDG
6451	 uptake values; the thirdcluster (olive green) had intermediate perfusion values and thehighest HX4
6452	 or
6453	 and
6454	 gene fuses with echinodermmicrotubule-associated roteinlike 4 (
6455	 InhibitorsResistance MechanismALK DominantSecondary Mutations in the ALK GeneALK CNGCNS resistanceALK nondominantPartially ALK dependentIncreased autophosphorylation of
6456	 Inhibitors: Amplification of the
6457	 ¼ anaplastic lymphoma kinase; IC50 ¼ half-minimal inhibitory concentra-tion;
6458	 and
6459	 through mu-tations or phosphorylation (
6460	 through amplification (
6461	 or
6462	 amplification might be overcome with the use of second-generation
6463
6464	 Nondominantbut Partially ALK Dependent), Crizotinib Beyond
6465
6466	 and
6467	 rearrangements are mutuallyexclusive with mutations in
6468	)epositive and/oranaplastic lymphoma kinase (
6469	 and
6470	),isotope bone imaging, and brain CT or magneticresonance imaging (
6471	 and
6472	 and
6473	 and
6474	 and
6475	 and/or
6476	 and/or
6477	 ¼ anaplastic lymphoma kinase; ECOG PS ¼Eastern Cooperative Oncology Group performance status;
6478	 ¼ anaplastic lymphoma kinase; ECOG PS ¼ Eastern Cooperative Oncology Group performance status;
6479	) and/or Anaplastic Lymphoma Kinase (
6480	- or
6481	 ¼ anaplastic lymphoma kinase;
6482	 and
6483	 with 1 distant metastatic organ with > 3 metastaticlesions or multiple metastatic organs, with a median
6484	 N F OA B S T R A C TArticle history:Received 7 March 2014Received in revised form 10 July 2014Accepted 11 July 2014Keywords:Non-small cell lung cancer
6485	 and XRCC2) involved in
6486	 and in
6487	 gene and survival with a SNP in the
6488	 and
6489	 and
6490	 and
6491	 and
6492	 and XPD genes ingermline
6493	 rs11615 Tallele had a lower RR, shorter PFS and shorter
6494	scans  were  not  recommended  in  the  guidelines,  we  also  tested  amodel  in  which  PET  could  substitute  for  a  CXR  or
6495	  or
6496
6497	  for  tumor  staging No  Yes Receipt  of
6498	  for  tumor  staging No  Yes Receipt  of
6499	 mutation  status  of  each  patient  reviewed  all  the
6500	  in  the
6501	  >30 mm   ≤30 mm  Preoperative CT
6502	 mutation status in
6503	 or
6504	 and
6505	 = complete response,,
6506	 double-strand break repair in endothelial cellsHui Gao a,b, Jianxin Xue a, Lin Zhou a, Jie Lan a, Jiazhuo He a, Feifei Na a, Lifei Yang a,Lei Deng a, You Lu a,*a Department of Thoracic Oncology, Cancer Center and State Key Laboratory of Biotherapy, West China Hospital, Sichuan University, Chinab Department of Oncology, Chengdu Military General Hospital, ChinaA R T I C L
6507	 and growth and tends to prolong the
6508	 enhances radiation toxicity of human tumor cells by inhibiting
6509	 kinase domain, amajor cause of crizotinib resistance but showed
6510	 ¼ anaplastic lymphoma kinase; ALT ¼ alanine transaminase; AST ¼aspartate aminotransferase; ECOG ¼ Eastern Cooperative Oncology Group;
6511
6512	 and
6513	 and
6514
6515	 or
6516	 expressionharbored
6517	 tyrosine kinase inhibitors in NSCLCcell lines through de-repression of
6518	 and
6519	   and
6520	   is  silenced   throughpromoter   methylation   in   lung   cancer   and   whether   this   methylation   is   associated   with   LOH   of   the   MCClocus   or   methylation   of   the
6521	   genedoes  not   extend   to  the   neighbouring
6522	   gene  was  discovered  during  the  search  for  the
6523	  and
6524	   is  silenced  through  promoter  methy-lation  in  lung  cancers  and  whether  this  methylation  is  associatedwith  LOH  in  the  MCC   locus  or  methylation  of  the
6525	  and
6526	  methylation  and  the  internal  reference  gene
6527	  between  APC  and
6528	  promoter  methylation  is  rare  in  NSCLCMCC  and
6529	  methylation  (39%)  and  one  of  themalso  showed
6530	   and
6531	   and
6532	   met
6533	   and
6534	 D5S346 INT10 D5S656
6535	  in  differentiation  [27],epithelial  cell  migration  [28,29],
6536	  methylation  and
6537	  and
6538	 mutation was themost common molecular abnormality, followed by
6539	 ¼ progressive disease;
6540	 mutation was found in 6 pa-tients (46%), a
6541	 was longer thanexpected in that study, which was thought to be likely related to thegreater proportion of patients who had never smoked and thepresence of activating actionable mutations such as
6542	   deficient  Sash  mice  (KitWsh/Wsh)  [27]  and  the
6543	   on  the  growth  of  lung  cancerin  vivo,  Sash  MC   deficient  and
6544	   accumulation  in  the  periphery  of  thetumor  area  but  not  in  the  tumor  itself  in
6545	  phosphoryla-tion  was  not  evident  in  the  A549  cells,  it  was  present  in  the  LLCcells  and  a  strong  phosphorylation  was  induced  by  incubation  withhistamine  or  with
6546	  role,  wepharmacologically  “stabilized”  them  in
6547	 and
6548	 (50)Stage IIIB/IV or recurrent PS 0-1 NSCLC withmeasurable tumor lesion and no previoussystemic therapy for lung cancerConcurrent regimen: 4 doses of ipilimumab(10 mg/kg) plus paclitaxel (175 mg/m2) and carboplatin(AUC, 6) followed by 2 doses of placebo pluspaclitaxel and carboplatinPhased regimen: 2 doses of placebo plus paclitaxel(175 mg/m2) and carboplatin (AUC, 6) followed by4 doses of ipilimumab (10 mg/kg) plus paclitaxel andcarboplatinControl regimen: up to 6 doses of placebo pluspaclitaxel (175 mg/m2) and carboplatin (AUC, 6)Not reported70 (3)68 (4)66 (5)Langer 201610KEYNOTE-021Phase 2 RCTAtezolizumabFehrenbacher 20169Smith 201617POPLARPhase 2 RCTRittmeyer 201724OAKPhase 3 RCTOther ImmuneCheckpoint InhibitorsLynch 201215Phase 2 RCTClinicalLungCancerSeptember2017-447Abbreviations:
6549	  to  theATP-binding  site  of  the  mutated
6550	  forward  primer,  5’-TGGACGAATATGATCCAACAAT-3’  and  reverse  primer,  5’-TCCCTC-ATTGCACTGTACTCC-3’;
6551	  and
6552	,  and
6553	  expression  and  by  activatingAKT  and
6554	  expression  andinactivates  p-AKT  and  p-
6555	  protein  expression  and  (C,  E)  p-
6556	  expression  and  activates  p-AKT  and  p-
6557	  protein  expression  and  p-
6558	  andERK1/2,  proteins  that  are  downstream  of
6559	  proteinexpression  and  by  activating
6560	 between
6561	 orTTM was found between the different
6562	 ¼ complete response; IQR ¼ interquartile range;
6563	 mutations with a response to a first-lineEGFR-TKI had longer PFS and
6564	 or
6565	 ¼ complete response;
6566	 or
6567	 ¼ complete response;
6568
6569	 ¼ epidermal growth factor receptor;
6570	-TKIAbbreviations: CI ¼ confidence interval; CNS ¼ central nervous system; EGFR ¼ epidermal growth factor receptor;
6571	 or PFS, two of thetrials demonstrated statistically significant higher
6572	 or
6573	 family inhibitor kb NB 142-70(Kb), at concentrations that inhibited
6574	 family consists ofthree members, PKD1,
6575	 expression was analyzedby quantitative real-time PCR and normalized to
6576	 constitutively active S744/748E mutant plasmid inA549 cells which were not stimulated with PMA and examinedphosphorylation on S6K1, S6, Akt and
6577	 resulted in the atten-uation of S6K1, S6, Akt and
6578	 prevent the potentiation of S6K1induced by suppression of
6579	 siRNAs transfected cells,PMA also strikingly induced the phosphorylation of Akt at Ser473and
6580	 induced by Kb and
6581	 at Ser916, Akt at Ser473and
6582	 and
6583	 and mTOR prevents the activation of S6K1 and S6 induced by suppression of
6584
6585	 resulted in the inhibition of S6K1and its substrate S6 in line with Akt and
6586	 inhibitors, which indicates
6587	 by GPCRagonist leads to prolonged activation of the MEK/
6588	 at the crossroads of
6589	 With
6590	 ¼ complete response; F ¼ female; M ¼ male; N ¼ new lesion;
6591	 With
6592	 With
6593	  Chinab Thoracic  Surgery  Department  of  China
6594	  ACT  CAA  ACC  TCT
6595	  and  p38
6596	 fluorescent in situ hybridization analyses are indicatedwith a
6597	,
6598	 highly depends on the molecularmethods used for analyses, in this letter, we intend first to reportabout our own experience evaluating the TAT of
6599	 on its website by the previouslymentioned molecular genetics laboratory,
6600	 andROS1 analyses are performed in the Pathology department, whereunstained tissue sections dedicated to
6601	 extraction and real-time PCR on-board, has emerged, allowing the full analytical pro-cess of the
6602	 but also in
6603	 and
6604	 and
6605	 and
6606	  +  Pem  +  Cis  =  LY2603618  275  mg   +  pemetrexed  500  mg/m2 +  cisplatin  75  mg/m2;Pem   +  Cis  =  pemetrexed  500  mg/m2 +  cisplatin  75  mg/m2;  PFS  =  progression-free  survival;
6607	  +  Pem  +  Cis  =  LY2603618  275  mg   +  pemetrexed  500  mg/m2 +  cisplatin  75  mg/m2;  Pem  +  Cis  =  pemetrexed  500  mg/m2 +  cisplatin  75  mg/m2;
6608
6609	 and
6610	 METASTASES IN NSCLCAnn Thorac Surg2017;104:1153–60nodal metastasis developed in 14% (24 of 169) of thosewith
6611	  and
6612	 tumor
6613	 response, majorpathologic response, pathologic downstaging, complete(R0) resection rate, disease-free survival, and
6614	 and
6615	 and
6616	 and
6617	 and
6618	 response correlates better with patho-logic response than with
6619	  =  Cumulative  incidence  rate;
6620	 cross-linksIn this study, we evaluated the cytotoxicity of BO-1978 in a batchlines in vitro andof
6621	 damage[50], and decreased Rad51 and DNA-PK, core components of DNAdouble-strand break repair [49, 51], indicating that
6622	 and Janne
6623	 (ie,
6624	 evenfor subcentimeter NSCLCs could be expected to be apromising method of assessing proper treatment modes,especially when a tumor has a pure-solid appearance on athin-section
6625	 ¼ hazard ratio; IALT ¼ International Adjuvant LungCancer Trial; MAGRIT ¼ MAGE-A3 as Adjuvant Non-Small Cell Lung Cancer Immunotherapy;
6626	 mutation status was notpredictive of
6627	 waslonger for patients receiving chemotherapy compared with noadjuvant chemotherapy for those with wild-type
6628	 mutationand found no significant difference in
6629	 mutation status and tumor size foradjuvant chemotherapy on
6630	 mutations in completely resected NSCLC and found thatTP53 mutation status was not predictive of
6631	 mutation-positive NSCLC, no difference wasfound in the
6632	 immunohistochemistry or amplification status demon-strated no difference in
6633	 impact on
6634	 mutation on survival in patients with
6635	 ¼ epidermal growth factor receptor; FISH ¼ fluorescence in situ hybridization;
6636	 antibody or
6637	 mutation status is used as a predictor ofresponse to gefitinib, another oral
6638	 reported for the superior arm, 20 Gy in 5Clinical Lung Cancer March 2016148 -fractions, of the
6639	 and PFS overall is poor, with the caveat that inpatients with
6640
6641
6642	 NSCLCthe
6643	 in
6644
6645
6646	 mutated NSCLC No prior therapyNewly diagnosed Stage IIIB/IV NSCLCEGFR mutated NSCLCEGFR mutated NSCLCEGFR mutated NSCLCPretreated EGFR mutant NSCLCAdvanced squamous NSCLCEGFR TKI treatment-naive, advancedNSCLCEGFR mutated NSCLCNSCLC with progression after EGFR TKIharbouring T790MNSCLC with progression after EGFR TKIharbouring T790MLung Cancer 115 (2018) 12–20Primary outcomePFSSafety and tolerabilityToxicityPFSRecommended phase II dose8-Week Disease control rateMaximum tolerated doseObjective ResponseRecommended phase II doseErlotinib versus nivolumab and erlotinibNivolumab and erlotinibNivolumab and erlotinib Ipilimumab and erlotinibNivolumab and nazartinibPembrolizumab and gefitinib Pembrolizumab anderlotinibPembrolizumab and erlotinibPembrolizumab and afatinibPembrolizumab and afatinibAtezolizumab and erlotinibDurvalumab and gefitinibDurvalumab and osimertinib versus osimertinibSafety and tolerabilitySafety and tolerabilityDurvalumab and osimertinibSafety and TolerabilityGefitinib with a switch to durvalumab AZD9291 with aswitch to durvalumabConfirmed
6647	 mutations and
6648	 (durvalumab) a human IgG1 anti-programmed celldeath-ligand-1 antibody, combined with gefitinib: a phase I expansion in TKI-naivepatients with
6649	 III, Schuller
6650	 of patients with
6651	 and
6652	 of patients with
6653	 of patients with
6654	 of patentswith
6655	  translocations  and
6656	 translocations  compared  with  patients  with
6657	 translocations in all patients with
6658	  and
6659	 mutation and
6660	  and
6661	 and
6662	 followed by reduc-tion of AKT/mTOR and
6663	 between patientswith
6664	 expression and
6665	, PR, or SDMaintenancephaseBevacizumab +onartuzumabBevacizumab + placeboPemetrexed +onartuzumabPemetrexed + placebo
6666	þ ¼ MET diagnostic-positive; Ona ¼ onartuzumab; pac ¼ paclitaxel; Pbo ¼ placebo; pem ¼pemetrexed;
6667	 and
6668	 and
6669	  images  were  acquired  forattenuation  correction  and  anatomic  localization,
6670
6671	   was  extracted   from   microdissected   formalin-fixed-paraffin-embedded   specimens   (FFPE)and  7  different   base   substitutions   in   codons   12  and   13  of
6672	  and
6673
6674	  mutations,  which  occurmore  frequently  in  tumors  of  never  smokers,  some
6675	  mutations  have  beenassociated  with  primary
6676
6677
6678	  mutations  for  response  to
6679	  TKIs,  that
6680	  and
6681	 (n = 19) experienced  poor
6682	 and PFS for
6683	  for
6684	 subset of patients  experienced  significantly  inferior  DMFS  in  compar-ison  with  patients  receiving  CRT  alone,  although  the  differ-ences in
6685	 (co-stimulatory molecules) and
6686	 expressed high lev-els of
6687	 positive cells (>50%) on day 7 after maturationstimulus which correlated with low
6688	 showed a significantly higher expressionof both
6689	 and
6690	 (95%) and HLA-D (94%) and intermediateexpression of
6691	 and
6692	 and
6693	 andCCR7 and a significant decrease of
6694	 and
6695	 DC protocol weobserved that
6696	  gene  mutations  and
6697	  mutations  and
6698	  and
6699	  Amsterdam,  The  Netherlandsh Netherlands  Cancer  Institute,  Plesmanlaan  121,  1066
6700	 (1721 bp) wasamplified by PCR from human genomic
6701	/
6702	 group had a median
6703	 between the
6704	 group was not associated with improved
6705	:PET/CT Ratio OverTime142 -Abbreviations: CT ¼ computed tomography;
6706	 between the 2groups (median OS:
6707	 ¼ computed tomography;
6708	 ¼ computed tomography;
6709
6710	 and
6711	 mutations received erlotinib,and those without EGFR mutations received chemotherapy with orwithout cisplatin based on their
6712	 repair enzymeERCC1 and
6713	 gene expression but not
6714	 (þ)) (C) For complete inhibition of GEF-induced autophagy, a Atg5 Tet-off
6715	 also enhanced thecytotoxic effect of GEF in K562, HL-60, and
6716	 testing methodologies (Sanger sequencing, allele-specificpolymerase chain reaction, and targeted next-generation sequencing) to identify classical and other (ie, exon 18G719X, exon 19 insertions, exon 20 insertions, exon 21 L861Q) EGFR mutations; practical considerations (type oftissue/biopsies with different success rates of
6717	 and
6718	 Testing in Advanced NSCLCTable 1 Summary of CAP/IASLC/AMP Guidelines for EGFR Testing in NoneSmall-Cell Lung CancerWhy Should Tumors Be Tested?Which Tumors Should Be Tested?When Should Testing Occur?What Tumor Specimens Should Be Tested?How Rapidly Should Test Results Be Available?How Should Testing Be Performed? To select for tumors that will benefit from treatment with EGFR TKIs Lung tumors with any AC component—regardless of clinical characteristics (ie, tobacco use) At diagnosis: for patients with TNM stage IV disease; consider for patients with TNM stage I-III disease At recurrence/progression: for patients with TNM stage I-III disease, not previously tested Primary tumors or metastatic lesions may be tested Formalin-fixed, paraffin-embedded; or fresh, frozen, or alcohol-fixed specimens Decalcifying solutions should be avoided Cytologic specimens are acceptable Specimens with a final histopathologic diagnosis should be submitted for testing within:B 24 hours (internal molecular pathology laboratory)B 3 business days (external molecular pathology laboratory) Test results should be made available within 10 business days of receiving the specimen in the laboratory Must be able to detect mutations in specimens with 50% cancer cell content Testing assay should be able to detect all individual mutations that have been reported with a IHC, FISH, and
6719	 testing usingthe Sanger method; testing for
6720	 mu-tations in FFPE samples and tumor cell-free
6721
6722	 Status inPeripheral Blood SamplesRecent studies have also indicated that peripheral blood can beused for mutation detection, because it contains small amounts ofcirculating free
6723	 and
6724	 and
6725	 V384D polymorphism associates withpoor response to
6726	 harboring
6727	 (L858R, exon19 deletion, and T790M mutations) and corresponding wild-type alleleat an ultra-low level by using
6728	 and
6729	 ControlsPositive and negative control plasmids for the
6730	 and
6731	 and
6732	 and/or
6733
6734	 from tumor cells harboring
6735	 from FFPE Samples of Surgically Resected Pri-mary Lung TumorsFor each patient sample, the expected mutation status was deter-mined in the primary tumor DNA via conventional Cycleave assays orthe SARMS assay for
6736	 mutation without an
6737	 from H1975 cells harboring
6738	 (L858R, exon 19 deletion, and T790M) inFFPE samples from NSCLC patients; this assay allows the detection ofmutations in different exons with multiple primer sets via digital PCRon genomic
6739	 exon 19 deletion, when a wild-type
6740
6741	 T790Mmutation and
6742	 and
6743	   and
6744	 gene was identified ineight studies in both Caucasian and Asian populations,rs401681 (in CLPTM1L gene) was identified in five studies,while rs2736100 in the
6745	 is not only essential for maintainingtelomeres through the protection of chromosomal ends fromdegradation, but also prevents inappropriate
6746
6747	 binding cleft of
6748
6749	 polymorphismrs2736100 and
6750	 and
6751	 polymorphismrs2736100 C allele and
6752
6753	 and
6754	 and
6755	 expression to
6756	 in
6757	 polymorphism, telomerasetelomere function and
6758	 and
6759	 and
6760	 through Ets-mediated trans-activation of
6761	 polymorphism rs2736100-C isassociated with
6762	 tyrosine kinaseinhibitors (EGFR-TKIs), which inhibit EGFR autophosphorylation byinterfering with the
6763	 gefitinib plusCDDP + PEM resulted in a significantly shorter
6764	  and84
6765	  and  at  position  790  in  the
6766	  and
6767	  mutant  NSCLCs,  with
6768	  and
6769
6770	  and  ten
6771	 imaging in hepatocellular carcinoma:correlations between
6772	 Synapto-phisin
6773	 gene [rs1801131 (1298A>C),rs1801133 (677C>T), and rs2274976 (1793G>A)], and 2 exonic0-untranslated region of the
6774	 and
6775	 and
6776	 1298A>C polymorphism has been previouslyassociated with lower PFS in patients receiving second-line peme-trexed therapy for advanced NSCLC9 and reduced
6777	)-amplified  SKBR3  breast  cancer  cells  treated  with the  HER2 TKI  lapatinib,  and
6778	 TKI, and melanoma cells treated with a
6779	 amplification,
6780	 forcobas®
6781	 from 25 NSCLCpatients who underwent cytological analysis between September 2016and May 2017 after acquiring resistance to
6782	 concentration was measured using the Qubit dsDNA
6783	 activating mutations, we performed ddPCRusing samples containing EGFR mutant
6784	 gene copy was measured and calculated usingFastStart Essential
6785	 from HCC827 (human
6786	 activating mutations, we performed ddPCR usingsamples containing EGFR mutant
6787	 and
6788	 and
6789	 and
6790	 amplification(approximately 14-fold) and no cases had
6791	 amplification, cMET or
6792	 and
6793	 profilingreveals heterogeneity of
6794	 profilingreveals heterogeneity of
6795	 amplification leads togefitinib resistance in lung cancer by activating
6796	 over-expression and an
6797	 L858Rmutation in circulating free
6798	 amplification but negative for
6799
6800
6801
6802	 and MET, whereas 22 samples weresuitable for
6803	 and
6804	 (SupplementaryTable 3, patient 6) had high tumor
6805	 at the tumor level was less pre-valent than that of
6806	 in-hibitor INC280 combined with gefitinib in patients with
6807	 gene copy number, measured as either the ratio tothe centromere of chromosome 7 (true amplification) ormean MET gene copies per cell (which could includeboth true amplification and high polysomy), is likely toinfluence the chances of MET acting as either a truedriver or codriver in an individualtumor and, byextension, the ability of the biomarker to predict benefitfrom MET inhibition either alone or in combination withan
6808	 amplification and
6809	 inhibitors, they may bemore amenable to combination treatment strategies,including those involving
6810	 amplification oc-curs with or without T790M mutations in
6811	 amplification in
6812	 and
6813	/
6814	 ismediated by the JAK-STAT pathway,12 and the level of inflam-mation measured using the mGPS predicts clinical outcomes inpatients with NSCLC,11 it was hypothesized that the addition ofruxolitinib, a potent and selective inhibitor of
6815	 or
6816	 every6 ± 2 weekscPrimary Endpoints• Part 1: RP2D• Part 2: OSSecondary Endpoints• PFSd• ORRd• Safety/tolerabilityAbbreviations:
6817	 ¼ complete response;
6818	 did not improve
6819	 and Bax (Santa CruzBiotechnology, Santa Cruz, CA, USA, 1:1000), c-fos and cyclin A2(Boster, Wuhan, China, 1:800), c-jun and caspase-3 (Cell SignalingTechnology, MA, USA, 1:1000),
6820	 beingdamaged by
6821	 stimuli and may be the rate-limitingprocedure for repairing ROS-induced damage by providing 30-hy-droxyl for
6822	 and
6823	 and
6824	 or
6825	 or
6826	 mutationaltesting was not available,mutations in this gene are neither prognostic nortargetable, and are generally mutually exclusive ofEGFR and
6827	 and
6828	  and  CHRTIntramural5/wk  for  8  weeks  of  which  3times  supervised  aerobic(walking,  cycling  (Borg
6829	  10  Breathlessness  Scale;  BORG
6830	 Arbane,  2014 Andersen,  2011 290(180–440)/290(200–450)NR D5  110/135 Steps/day   n Cheville,  2013 3200 Walking   time  min Hoffman,  2014
6831	 and 1-year
6832	 rateswere 4% and 5%, respectively, with an aggregate
6833	  and
6834	 mutations result in tumor development through their intrinsic  ability  to  hyperactivate  the  MEK-ERK  pathway,5  non-V600E  BRAF  mutations induce this pathway at lower levels and are significantly coincident with
6835	  mutation status, in contrast to
6836	 mutation and one patient had  an  activating
6837	  mutations  do  occur  in  concert  with  other activating mutations, in particular
6838	 inhibitors in advanced disease: a case report published in this journal by rudin et al14 found a
6839	 and
6840	 1001, Duarte,
6841	 tyrosine kinase activity, efficiently blocks oncogenic
6842	 data demonstratesthat NLNS is a significant predictor of
6843	 using a semistructured questionnaire of 10 items thatfocused on patients’ overall opinion about MT, their acceptance ofMT in the case of different median
6844	 if MT wouldincrease their life expectancy by 1 year, 6 months, 3 months, or 1month or would improve symptom relief or prolong radiologic tumorcontrol in the absence of an
6845	 ¼ epidermal growth factor receptor;
6846	 to be acceptable if theexpected
6847	 for an
6848	 fora median
6849	 with only the expec-tation of radiologic tumor stabilization in the absence of
6850	 After 4 to 6 Cycles of Chemotherapy, rather than Have aTreatment-free Period?” (B) “Would You Be Interested in Undergoing MT if It Would Improve Your Life Expectancy by About1 Year, 6 Months, 3 Months, or 1 Month?” (C) “Would You Be Interested in Undergoing MT if It Would Provide No SurvivalBenefit but Would Result in Symptom Control or Radiologic Tumor Stabilization?”Maria Vittoria Pacchiana et alAbbreviations:
6851	 benefit, suchas 1 month, the percentage of physicians expecting patients to favor
6852	 would be acceptable if theexpected gain in
6853	 and Decrease in Life Expectancy(Comparison of Paired Data)aPatients Would Choose MTNo/UnsureYes1-y
6854	 ¼ maintenance therapy; NE ¼ not evaluable;
6855	 ¼ maintenance therapy;
6856	   mutation   andan
6857	   Scan   and
6858	   or   combined   with
6859	  and
6860	  TKIs  to  the
6861
6862	  binding  site  of  the
6863
6864	  TKI  which  targets  both  EGFR  andT790M  mutants  and  yet  spares  the  EGFR
6865	  mutant  selective,  targeting  common  sensitizingEGFR  mutations,  T790M  and  also  had
6866	  TKIs,  EGF816  (Novar-tis  Pharmaceuticals)  has  pre-clinically  activity  targeting  sensitizingEGFR  mutants  as  well  as  T790M  mutants  with  60-fold  selectivityover
6867	  mutationEGFR   amplification Bypass   signalling  tractsIncreased
6868	  signalling  was  reported  includingnovel
6869	  copy  num-ber,
6870	  TKIs  targeting  T790Mmutant-specific  NSCLC  whilst  sparing
6871	  inhibitor  AZD9291  isassociated  with  increased  dependence  on
6872	  iseffective  for  the  detection  of
6873	 TN FP
6874	  and  decrease  in  Bcl-2  which  altogether  initiated  caspase-dependentapoptosis  were  predominantly  due  to  down-regulation  the  expression  of
6875	  expression  to  trigger  proapototic  protein
6876	 Bcl-2 Bcl-xl
6877	  withEGFR-siRNA  to  examine  the  expression  of
6878	  and  Bcl-2,after  ablation  of
6879	  promotes  apoptosis  bydirectly inhibiting  antiapoptotic  members  and/or  activatingBAK/BAX,  the  antiapoptotic  member  Bcl-2  can  prevent  apoptosis,down-regulation  of
6880	  and  decrease  in  Bcl-2  whichaltogether  initiated  caspase-dependent  apoptosis  were  predomi-nantly  due  to  down-regulation  the  expression  of
6881	 revealed that 5-year
6882
6883
6884	 3 (Oligonucleotide Modeling Plat-form,
6885	 scan showed abnormal FDG avidity only in theleft upper lobe nodule and left hilar lymph nodes and an
6886	  and
6887	  at weeks 6 and 12 (equivalent to the start of cycle 3 and end of cycle 4), then every 3 months for the first 3 years after randomisation, and every 6 months in years 4 and 5 after randomisation;  brain
6888	 scan and visual correlation with
6889	 = computed tomography;
6890	 = computed tomography;
6891	 regulates drugsensitivity by modulating
6892	 scan of the thorax and theupper part ofthe abdomen, a bone scintigraphy orfluorodeoxyglucose-positron emission tomography scan,and brain CT or
6893	 expression plays differing roles in non-small-cell lung cancer patients with or without
6894
6895	 = median survival time; RR = response rate;
6896	 326 study was
6897	 = median survival time;
6898	 for non-
6899	 for those who received
6900	 ¼ not otherwise specified;
6901	 performed worse in terms of
6902	 mutation status showed that the
6903	 (n ¼ 24; adjusted
6904	 ¼ epidermal growth factor receptor; NA ¼ not applicable;
6905	 and
6906	 (2001-2009) and stratified PETutilization as isolated or in conjunction with separatededicated
6907	 imaging) or (2)“
6908	 preceded the use of
6909	 because they believe that PET is supe-rior to
6910	-only imaging (ie, PET orPET/
6911
6912	 imaging, both with and withoutseparate
6913	 imaging during the surveillance periodmay represent appropriate follow-up of clinicalsymptoms or test results concerning for diseaserecurrence,though some PET imaging likelyrepresents inappropriate use and replacement ofguideline-recommended conventional
6914	 genomic
6915	 CCC
6916	 TKI Treatment in Transgenic MiceAfter tumor formation was confirmed by
6917
6918	  risk  was  virtually  unchanged  after  adjusting  by age,  smoking  status,  and  MLD  in  the  multivariate  analy-sis (adjusted
6919	 and/or
6920	 image acquisition,
6921	 or
6922	  or
6923	 or
6924	  for  mediastinal staging of lung cancer: which
6925	 rearrangements,
6926	 splicing variants were observed in cases with  or  without  ALK  rearrangements,
6927	 mutation, n (%)   Positive/mutated    Negative/wild type
6928	  splicing  variants  were  noted  to  coexist  not  only with ALK rearrangements in some samples but also with other oncogenic  driver  mutations  (in  specific
6929	 as a template would not be able to identify a splicing mutation or exon skipping variant within
6930	 and
6931	 secondary mutation and
6932	  and
6933	 and
6934	 and
6935	 Prism
6936	 pathway genes,P53 Arg72Pro (rs1042522), P73 G4C14-to-A4T14 (rs2273953 andrs1801173), and
6937	 pathway in cellularprocess in response to
6938	 Arg72Pro, P73 G4C14-to-A4T14, and
6939	 Arg72Pro polymorphism for
6940	 and PFSIn combined analysis of
6941	 Pro/Pro-P73OS was found (PtrendGC/GC genotype having the highest
6942	 Arg/Pro-P73 GC/GC, P53Pro/Pro-P73 GC/AT ⫹ AT/AT, or P53 Pro/Pro-P73 GC/GChad poor PFS and increased
6943	 Arg72Pro and
6944	 Pro andMDM2 G variants on increase in
6945	 72Pro and
6946	 genes, with thegenotypes associated with increased
6947	 Arg72Pro and
6948	 Arg/Pro, Pro/Pro, P73 GC/GC, and
6949	 is gradually shorter with increasing numberof unfavorable genotypes, and the
6950	 pathway components may define patient popu-lations in their abilities to produce apoptosis of cancer cells inresponse to
6951	 72Pro allele had both significantly poor
6952	 and
6953	 72Pro variant displays morecompacted affinity for the TAFII32 and TAFII70 transcrip-tional factors compared with the 72Arg variant and thus hadhigher ability to transactivate
6954	 canbind to the N-terminal domain of P73 because of the struc-tural similarity of P73 and
6955	 in apoptosis, one may expect that the functionalpolymorphisms in the P53, P73, and
6956	 and
6957	 and
6958	 wasdefined as a ⱖ50% decrease in the sum of volumetric mea-surements and having continuously stable nontarget lesionsfrom the baseline in at least two consecutive
6959	 and less than
6960	 and
6961	 and
6962
6963	 and
6964	 can also transform normal primary
6965	 and NHBE cells showed a dramatic increasein cell proliferation upon overexpression of
6966	 alsotransforms
6967	 overexpression only led to a slightupregulation of
6968	 and
6969	 protein expression of 3T3 cells overexpressing GLDC, PSPH, PSAT1, GCAT, SHMT1, and
6970	 (3T3-GD) or
6971	 (3T3-GD) or
6972	 cells overexpressing
6973	 cells overexpressing
6974	 cells overexpressing either
6975	 Overexpression and Knockdown(A–D) Relative fold change in levels of (A) glycine-related metabolites, (B) glycolysis intermediates, and (D) pyrimidines in 3T3 cells with GLDC overexpression(3T3-GD/Ctrl),
6976	 cells overexpressing
6977	 and
6978	 (GD-sh) or
6979	 knockdown (CACO2-GD-sh) or
6980	 proliferation was unaffected by retroviralknockdown of
6981	 and the glycine metabolism enzyme
6982	 mutation or
6983	 and
6984	 rearrangements  in  primary  lung  adenocarcinoma  with  identified
6985	 and
6986	  and
6987	 099, a phase III trial of chemotherapy with or  without  cetuximab  in  patients  not  preselected  for
6988	 tyrosine kinase inhibi-tors plus bevacizumab have shown improvements in PFS, but have failed to demonstrate statistically improved
6989	 pathways  biomarkers  (mutational  status,  gene  copy  number, protein expression) and
6990	  gene  copy  number,  by  fluo-rescent  in  situ  hybridization  (FISH),
6991	  mutation  had numerically longer PFS and
6992	  099 study6 showed no benefit in PFS (primary endpoint) despite improved RR and
6993	  FISH  as  a  coprimary  endpoint, based on our previous observations from S0342 that EGFR FISH-positive  patients  demonstrated  improved  response, PFS, and
6994
6995	   and
6996	  three-dimensional  low-attenuationblue  co-registered  to 1H
6997	 studies could show an
6998	 studies, using better-tolerated agents—pemetrexed9 or erlotinib10—have shown significant
6999
7000	  in  case  of  an  expected  median
7001	  for  an expected
7002	  benefit  of  3  months  was  acceptable  for two-thirds at T0, but decreased slightly to 56% at T2, whereas one-third of respondents no longer considered
7003	  but  longer  symptom  relief  by
7004	  were  questioned  regarding a  “nonrealistic”  median
7005	 and
7006	  and  high
7007	  and
7008	 in patients with
7009	 breakage caused by  erlotinib  is  different  from  that  caused  by  radiotherapy or  platinum-based  chemotherapy,  and
7010	  dou-ble-strand breaks, where
7011	 with CtIP but not with
7012	 in a subset of  sporadic  breast  tumors  was  found  to  be  a  mechanism  of
7013	 and
7014	 interacts with two regions of CtIP, it does not further repress transcription by CtIP on the Gal4 promoter, in contrast to its effect on
7015	 and CtIP on outcome to
7016	 +
7017	  and
7018	 expres-sion according to
7019	 interacts  with  the  cofactor  CtIP  and  BRCA,  and  inhibits the  transcriptional  activity  of
7020	 expression  had  significantly  longer  PFS,  as  did  those  with high
7021	  and high
7022	 levels had shorter PFS, the 17 patients with high levels of both BRCA1 and
7023	 and
7024	 and
7025	 for low
7026	  mRNA  levels  predict  poor 298Copyright © 2013 by the International Association for the Study of Lung CancerJournal of Thoracic Oncology  •  Volume 8, Number 3, March 2013 BRCA1 and
7027	  and
7028	 T790M muta-tion  and
7029	  involved  in  the  transcription  regulation  of  p21  is  disrupted upon
7030	 interacts with  the  cofactor  CtIP  and  the  tumor  suppressor
7031	  in NSCLC and targeting ROS1-rearranged NSCLC patients with
7032	 is located on chro-mosome  6  and  encodes  full-length  ROS1,  a  2,347  amino acid  transmembrane  tyrosine  kinase  (
7033	 and
7034	 fusion proteins, the downstream signaling pathways are similar to
7035	 with
7036	 with
7037	 fusion,
7038	 mutations (6%–33%)17 and
7039	  and
7040	 assays and fusion-specific RT-PCR com-bined with Sanger sequencing of the polymerase chain reaction products have been applied to identify
7041
7042	 inhibitor, demonstrated in vitro activity against HCC78 cell lines,35 attenuated phosphor-ylation of downstream
7043	 kinase domain is as strong as with the
7044	 with
7045	 fusions of second-gen-eration
7046	 as a ‘druggable’ receptor tyrosine kinase:  lessons  learned  from  inhibiting  the
7047	  to  the  receptor tyrosine kinase
7048	 and
7049	 and
7050	 expression showed tendency forprolonged
7051	 expres-sion, age, stage,
7052	 expression, it is worth-while to investigate the role of
7053	 and
7054	 mutation sta-tus,
7055	 and
7056	 mutation status, and
7057	 expression with
7058	 expressionshowed tendency for prolonged median
7059	 positivepatients survived the shorter compared with the TUBB3 nega-tive patients (median
7060	 muta-tion status,
7061	 expression was a poor prognostic marker forRFS and
7062	 was not a prognostic factor interms of either RFS or
7063	 expression is astrong prognostic marker in terms of RFS and
7064	 according to
7065	 expression (dotted line) didnot show significant prognostic impact in terms ofeither RFS (C) or
7066	 Mutation Status,
7067	 expression was different accord-ing to
7068	 repair by
7069	 and
7070	 synthesis and repair genes RRM1and
7071	 expression by immunohisto-chemistry and
7072	 aloneS aloneInduction
7073	 and
7074	 (70%),
7075	 mutations persample, and 2 samples contained two
7076	 (30%),
7077	 mutation rate was similar between tDNAand plasma ctDNA, mutation rates in
7078	,
7079	 and
7080	 mutations in circulating tumor
7081	 mutations in circulating free
7082	 and TP53gene mutations in human breast cancer tumors frequently detected by iontorrent
7083	 and
7084
7085
7086
7087	  more  efficiently  than  CTX  in  the  A549,  H460and  H358  cell  lines  harboring
7088	  phosphorylationin  A549  cells  which  were  reported  to  have  low
7089	  mutation  and  low
7090	  mutation  andlow
7091	  and  mutant
7092	  and
7093	-TKIs  showed  poor  efficacyin  wild-type  EGFR  and/or  mutant
7094	  mAb   seemed  to  be  independent  of  mutationalstatus  of  EGFR  and
7095
7096	 scan andpresumably metastatic or in case of positive
7097	 in cerebrospinal fluid (
7098	 expression, and sex were independent prognostic factors in patients with wild-type
7099	 expression has differ-ent prognostic significance in patients with differing
7100	 inhibitors should be given early to NSCLC patients with
7101	 and
7102	 expression and
7103	 Protein Expression and
7104	  expression,  and  sex were the three independent prognostic factors in patients with  wild-type
7105	  muta-tions can activate
7106	 signaling may regulate
7107	 in patients with
7108	 M (%) EGFR
7109	 in NSCLC with or without
7110	  pathways  might  differ  with  different
7111	 expression was an independent poor prognostic factor in NSCLC patients with  wild-type
7112	  expression may differ depending on the
7113	  and
7114	 expression in patients based on
7115	 expression was an independent poor prognostic fac-tor in patients negative for
7116	  inhibitors  should  be  given as  first-line  treatment  to  patients  with  MET  expression  and  wild-type
7117	 amplification leads to  gefitinib  resistance  in  lung  cancer  by  activating
7118	  gene  amplification or
7119	)   mutations   derived   more   survival   benefit   than   those   with   wild-type   EGFR   tumorsin   terms   of
7120	  benefit  fromerlotinib  maintenance  therapy  than  those  with
7121	  benefit  in  patients  with
7122	-TKIs  islimited  in  maintenance  therapy  for  patients  with  EGFR  wild-typetumors  Notably,  final
7123	 1and
7124	 and
7125	 signaling pathway, whereas
7126	 exon 20 nor
7127	 revealed that a wild-type
7128	 amplification, orintrinsic resistance mechanisms, including
7129	 associated with de novo resistance toE X P E R I M E N T A L C E L L R E S E A R C H 3 2 2 ( 2 0 1 4 ) 1 6 8 – 1 7 7175of ERK1/2, they further demonstrated that down-regulation ofDUSP6, a negative regulator of
7130	-TKI resistancecaused by Src activation in wild-type or L858R mutant EGFR NSCLCcell lines exposed to
7131	 amplification leads to gefitinib resistance in lungcancer by activating
7132	 to simulate
7133	 in the presence of
7134	 inhibitor INC-280 alone had no discernible effect on cell growth, it was able to restoresensitivity to erlotinib and promote apoptosis in NSCLC models rendered erlotinib resistant by
7135	 may become aber-rantly activated via gene amplification or ligand stimulation byhepatocyte growth factor (HGF) and, once active, is sufficient tobypass the antiproliferative and proapoptotic effects of
7136	 inhibitors incombination with
7137	 ¼ epidermal growth factor receptor;
7138	 phosphorylation stimu-lated by exogenous
7139	/MET Signaling Network inHGF-mediated Erlotinib-resistant NSCLC Cell LineModelsAs a single agent, erlotinib potently down-regulated phos-phorylation of EGFR and its downstream mediators of signalingincluding the docking protein GAB1, AKT, and
7140	 protein iscommonly expressed in NSCLC,we observe only limited MET phosphorylation in our panel ofline HCC827 where basalcellphosphorylation is observed (Figure 3A, first panel,lane 1);however, it appears to be dependent on
7141	 activation, character-ized by MET copy number abnormalities or elevated
7142	 ¼ protein kinase B;
7143
7144	 TKI osimertinib, which successfully targetsthe T790M “gatekeeper” mutation, means that future resistancemechanisms may increasingly utilize bypass pathways such asHER-2 or
7145	 amplification leads togefitinib resistance in lung cancer by activating
7146	 amplification occurs with or withoutT790M mutations in
7147	 activities were measured by ARVO
7148
7149	 [22,31]; (2) activation of Met by amplification of themet gene [24]; and, (3) activation of Met by the overexpressionof
7150	  repair  by
7151	  and
7152	  (15) ADSC  (9) ADC  (34)SCC   (6) Case  1  ADC Case  2  ADSCCase  3  ADC Case  1  ADC Case   2  ADC Case  3  ADC Case  4  ADC Case  5  ADC Case  6  ADC Case  7  ADC Case  8  ADC Case  9  ADC Case  10  ADC FISH-pattern 0–10%
7153	  signal  in  the  majority  of  theircells  may   be  more  likely  to  lead  to  lower  percentages  of  positivecells  than  polysomic  cells  with  more  than  one  rearranged  ALK  sig-nal  per  tumor  cell  nuclei,  because  cells  with  just  one
7154	   and
7155	   mutational   status   was   assessed   in  circulatingtumor
7156	  mutation  testing  was   performed  oncirculating  tumor
7157	  mutationDel19 L858R  +  Other T790M  in  ctDNA  at  progressionNo Yes  EGFR   mutation  in  ctDNA  at  progressionNo Yes  Brain   metastasesNo Yes Prior  palliative  radiotherapyNo Yes Line  of  erlotinib  treatment1st 2nd   or  more 
sPD-1Increase Decrease/undetectable sPD-1  at  clinical  progressionDetectable Undetectable
7158	  was  found(crude
7159	  (adjusted
7160	  mutationDel19 L858R  +  Other T790M  in  ctDNA  at  progressionNo Yes  EGFR  mutation  in  ctDNA  at  progressionNo Yes  Brain  metastasesNo Yes  Prior  palliative  radiotherapyNo Yes  Line  of  erlotinib  treatment1st 2nd   or  more 
sPD-1Increase Decrease/undetectable sPD-1  at  clinical  progressionDetectable Undetectable
7161	  or
7162	 and
7163	) was calculated as thepercentage of patients with a CR or
7164	 and KRASmutations -and for
7165	 and
7166	 and
7167	 (p = 1),
7168	 may targetto specific sites ofmetastasis, based on local
7169	 and
7170	 and
7171	 Z cytotoxic T-lymphocyte-associated protein 4; ICI Z immunecheckpoint inhibition; KPS Z Karnofsky Performance Status;
7172	 Z cytotoxic T-lymphocyte-associatedprotein 4;
7173	 than
7174	 (n ¼ 5),
7175	 mutations and
7176	 rearrangements in lung cancer specimenshas been hampered by issues similar to those described for thedetection of
7177	 and
7178	 gene rearrangements (n ¼ 6), EGFRmutations (n ¼ 5), and
7179	 (HER2), ALK, and
7180	 rearrange-ments (n ¼ 5),
7181	 rearrangements was per-formed to detect the following known ROS1 gene fusion partners:CD74, SLC34A2, LRIG3, SDC4, SLCA2, TMP, and
7182	 gene fusions, andthree had different fusion partners: SCL34, EZR, and
7183	 and ALKrearrangements (6%-7%),
7184	 gene is on the same chromosomeas the
7185	 and
7186	 and
7187	 rearrangements in lungadenocarcinoma by immunohistochemistry and comparison with
7188	 ¼ hazard ratio;
7189	 trials,includingRTOG 1106, which uses a midtreatment
7190	 NR Retrospective NR NR Retrospective Prospective Prospective Prospective NR NR NR Prospective Prospective Prospective Retrospective NR Retrospective NR NR Prospective NR Retrospective Prospective NR Retrospective 199 121 111 86 86 134 57 40 652 52 120 37 822 86 30 34 47 64 58 31 35 43 18 230 21 42 Plasma Plasma Plasma Plasma Plasma Plasma Serum Plasma Plasma Serum Plasma Plasma Plasma Serum Plasma Plasma Serum Serum Serum Plasma Plasma Plasma Plasma Plasma Plasma Serum II–IV IIIB,  IV I–IV IIIB,  IVIIIB,  IV III,  IVIIIB,  IV III,  IVIII,  IV 1–IV 1–IV III,  IV 1–IV IIIB,  IV NR IIIB,  IV 1–IV I–IV IIIB,  IV III,  IVIII,  IV Advanced NR IIIB,  IV Advanced IIIB,  IV ADC,  Ad-SCC NSCLC NSCLC ADC,  SCC,  UnclearADC,  Ad-SCC ADC,  othersADC,  SCC NSCLC NSCLC ADC,  SCC ADC,  others ADC ADC,  SCC,  others ADC ADC ADC,  others ADC,  SCC ADC,  SCC,  LCC ADC,  SCC,  LCC ADC,  SCC ADC NSCLC NSCLC NSCLC NSCLC ADC,  SCC,  LCC Allele-specific  PCR  assay
7191	  mutations  in  circulating  tumor
7192	  mutations  inplasma
7193	  signalingpathway  somatic
7194	 fi ndings were unclear, contrast-enhanced
7195	 scan acquired immediately prior to the
7196	 and
7197	 and
7198	  loss  of  function  caused  severe  CoQ10deficiency  and  defective  oxidative  phosphorylation  in  the  mito-chondria,  resulted  in  markedly  reduced
7199
7200	  mutation  and
7201	 scans bymeans of the IBEX program, improved the accuracy of a model topredict
7202	 metrics such as mean and maximum
7203	 features for evaluation of
7204	 wasreported to significantly increase from inner to outer areas inuterine cervical cancer, and a significantly positive correla-tion was also detected between
7205	 and
7206	 inhibition have emerged as novel molecular targets with potential therapeutic implica-tions, including mutations in the genes KRAS, BRAF, HER2, PI3KCA and DDR2, as well as
7207	 and
7208	 mutations usingmultiplexed assays, and for
7209	 (25%), sensitizing
7210	 and
7211	 and
7212	 mutations,
7213
7214	 mutations are predominantly found in non-squamous his-tology, being detected in approximately 11% and 26% of adenocar-cinomas in Asian and Western patients, respectively [28] and areusually mutually exclusive with
7215	 did differ between
7216	 rearrangements do not seemto overlap with other mutations, such as ALK,
7217	 continued open-labelcabozantinib, patients with SD were randomized to cabozantinibvs placebo, and patients with
7218	 mutation and 8% hadknown
7219	 and PFS based on VS stratification were alsoobserved in patients with known
7220	 (onewith an
7221	 and
7222	 kinase, leading to phosphorylation of down-stream effectors such as
7223	 mutated NSCLCreported an
7224
7225	 isoforms – ARAF,
7226	 and VEGF receptor 2 (VEGFR2)-mediated signalling, as well as a number of other receptor tyrosinekinases, including RET, KIT, AXL, and
7227	 hasbeen reported to be overexpressed in NSCLC [113], to synergizewith
7228	 and
7229	 and
7230	 and
7231	 and
7232	 was also a potential markerof early
7233	 overexpression upregulated the expression levelof the metastasis suppressor gene E-cadherin and downregulatedthe metastasis-related gene
7234	 also led to decreased expression of
7235	 and E-cadherin and
7236	 might exert similar role as
7237	 ¼ complete response;
7238	 suppressed the proliferation of gastric cancer cellsby regulating the
7239	 and U6 were used tonormalize the expression levels of the
7240	 enhancedepithelial-mesenchymal transition through suppressing E-cadherin andregulating
7241	 suppresses the pro-liferation of gastric cancer cells by regulating the
7242	 enhances epithelial-mesenchymaltransition (EMT) through suppressing E-cadherin and regulating
7243	 functions as a competing endogenousRNA to regulate
7244	)CBDCA þ weekly PTXCBDCA þ weekly PTX þ BevCBDCA þ weekly PTXCBDCA þ PTX þ BevCBDCA þ nab-PTXCBDCA þ nab-PTXPlatinum þ VNRCDDP þ VNRPlatinum þ VP-16Platinum þ VP-16n104631510112591219675211Median PFS (months)Median
7245	   mutation,
7246	  and  rearrange-ments  (either  inversions  or  translocations)  involving
7247	  mutation  and  for
7248	  mutation  analysis  was   performedusing  standard
7249	  mutation  analysis,
7250	  or  inability  to  per-form/complete  sequencing  for
7251	  mutation  analy-sis,  226  for
7252	  mutation  analysisSubmitted  samples,  n  (%)
7253	  and
7254	  mutation,
7255	  mutation
7256	  and
7257	  and
7258	  and
7259	  and
7260	  identified  three  risk  groups:  low-risk,  defined  as  patientswith  metachronous  metastases  (5-year
7261	  benefits  of
7262	  benefit,
7263	 family memberand
7264	 and
7265	 family member and
7266	 A),AP-PCR conditions and reaction mixtures are as described previ-ously [5] including one additional primer GAPDHS: 5(cid:4) – CGG AGTCAA CGG ATT TGG TCG
7267	 and
7268	 and
7269	 and
7270	 and
7271	 lived shorter (a); patients without mutated
7272	 and
7273	 and
7274	 and
7275	 and
7276	  or
7277	  extraction  and
7278	  and
7279	  mutation  hada  higher  rate  of  family  history  of  lung  cancer  when  compared  tothe
7280	  rearrangement  with  expression  of
7281	  and
7282
7283	 or
7284	 molecule gene [CD83],
7285	 is very low or unde-tected and the housekeeping gene
7286	 is a third member of the Ras familythat includes
7287
7288	 isepigenetically repressed in human and mouse lung tu-mors and is not requisite for survival of
7289	 and
7290	 were then stained with
7291	 and
7292	 and
7293	 and
7294	 or SMARCA4, or both, 12cases (80%) lacked
7295	 and
7296
7297	 deficiency is considered a rare event and currentlylimited to SCCOHT, an exceptionally rare entity, we and others recentlyhave observed loss of SMARCA4 and
7298	 and
7299	 and
7300	 was correlated withabsent bronchioalveolar (so-called) lepidic growth pattern, whereasloss of
7301	 and
7302	 and
7303	 (i) and reduced
7304	 or
7305	 protein expres-sion were
7306	 and
7307	 or
7308	 andSMARCA2 and frequent co-inactivation of
7309	 alterations and
7310	 (INI1) and
7311	 value, we calculated the target gene copy mean numberafter three times F-MSP, the methylation of
7312	  were  significantly  related  to
7313	  max  PTV  D95 Univariate  analysis
7314	  max  PTV  D95 Univariate  analysis
7315	  for  AIS  and
7316	  for  the
7317	  was  not  found  to  be  sig-nificantly  associated  with
7318
7319	   in32%  and
7320	 stress on DHE-induced ER stress andapoptosisWe then assessed the effect of DHE on
7321	 increasedTo analyze the roles of ER stress on DHE-mediated
7322	 and
7323	 mRNA and protein levels ina MKK3/6–p38
7324	 vectors significantly rescued the decreasedp38 MAPK activity, and restored the
7325	 andc-Jun N-terminal kinase (JNK) pathways have been confirmed tomediate the ectopic expression of
7326	 expression in NSCLC is unknown, and therole of p38
7327	 or p38
7328	 forward primer,50-AAGCCCAGGATGCCATTG-30, MSH2 reverse primer, 50-CATTTGACACGTGAGCAAAGC-30;
7329	 expression and thephosphorylation levels of MKK3/6 and p38
7330	 protein levels, and this wasaccompanied by the activation of MKK3/6–p38
7331	 maintained thepemetrexed-induced
7332	 activity decreased
7333	 protein levels by pemetrexed resulted from the increase inits protein stability via the activation of p38
7334	 signalingwas involved in the up-regulation of
7335	 signaling could protect
7336	 signaling by SB202190 significantly increased thelevels of ubiquitin-conjugated
7337	 signalingincreased
7338	 protein levels and protein stability via the p38
7339	 by 17-AAGdecreased the pemetrexed-induced expression of
7340	 and with the activation ofp38
7341	 repair proteins MLH1,
7342	  was   associated   withshorter
7343	 and the downregulation of TIMP2, RGS2,and
7344	 (inhibitor of
7345	 and
7346	 (trans-glutaminase 2) is involved in the modulation of the
7347
7348	 or
7349	 mutation testing by therequest of clinicians were reviewed and evaluated for the suitability offurther molecular analyses by 1 pulmonary pathologist (either
7350	 was extracted from 3suitable 5-mm thick section cuts from the formalin-fixed, paraffin-embedded tumor tissue, and
7351	-Guided Biopsy and Personalized MedicineFigure 2 Flow Chart of Patients Who Underwent CT-Guided Lung Biopsy and Were Histologically DiagnosedAbbreviations: CT ¼ computed tomography;
7352
7353	 Mutational Analysis: Review of 134 SpecimensRequested and Submitted for Molecular TestingVariableHistological Subtype of NSCLC(n [ 134)AdenocarcinomaNSCLC-NOSSCCAdenosqaumous carcinomaLarge cellSuitability for EGFR Testing(n [ 134)SuitableUnsuitableCharacteristics of Suitable TumorSpecimensTotal area of cancer cells in thetumor specimen section, %Total
7354	 ¼ computed tomography;
7355	 mutation status, other genetic abnormalityanalysis such as K-ras mutation and
7356	 and
7357	 and
7358	 methyltransferases (DNMT1,
7359	 and
7360	 and
7361	 expression and showed a significant in-crease in WIF-1 protein levels in cells transfected with DNMT3Aor
7362	 and
7363	 and
7364	 and
7365	 and
7366	 shRNA,
7367	 and
7368	 and
7369	 and
7370	 and
7371	 and
7372	 and
7373	 genes allows constitutive
7374	  or  TT  genotype  had  a significantly  better  oS  and  DFS  than  the  rs6495309
7375	 or TT genotype exhibited a better oS and DFS than the rs6495309
7376	 or TT genotypes exhibited a significantly better oS and DFS in patients with SQs and ACs compared with the rs6495309
7377
7378
7379
7380	 and 16 mg of
7381	 increases
7382	 and
7383	  TKI Control Incidence PGroupGroup Overall Drug   typeGefitinib Erlotinib Study   locationJapanese Non-Japanese  in  Asian Non-Asian Treatment  armEGFR  TKI+
7384	  TKI Control GroupGroup Overall Drug   typeGefitinib Erlotinib Study   locationJapanese Non-Japanese  in  Asian Non-Asian Treatment  armEGFR  TKI+
7385	) mutations or anaplastic lymphomakinase (
7386	  SD
7387	  (solute  carrier  family  31,  member1),
7388	  plus rearrangements in
7389	 mutations are considered an alternative oncogenic driver in NSCLC that are almost never observed in tumours  harbouring
7390	 and
7391	 and
7392	 tyrosine kinase inhibitors and
7393	  and
7394	  or
7395	  or
7396	 or
7397	 and
7398	 mutations 70%; progression-free survival 9·7–14·7 months)3,18,19 and
7399	  and
7400	  alterations, constitutive autocrine
7401	  and
7402	 mutations and
7403	 06520-8034, USAb Zhejiang Cancer Hospital, Hangzhou, Zhejiang, ChinaReceived 16 October 2006; received in revised form 26 November 2006; accepted 4 December 2006KEYWORDS
7404	 (A60G),
7405	 is a lead protein in thisgroup, and is responsible for recognition of
7406	 also acti-vates the BRCA1,
7407	 damage occurs either dueto ionizing radiation or therapeutic agents, damage sen-sors are activated, and phosphorylate downstream proteins,such as
7408	 and
7409	 (A60G, an A to G transition at nucleotide 60of intron 62, rs664143),
7410	 allelic discriminationsoftware provided by
7411	 (Asn118Asn) genotype differedbetween patients who responded and who did not respondTable 2Genotype and treatment response to chemotherapy among advanced NSCLC patientsGenotypeCR + PRSD + PDCrude
7412	 mRNA andincreased activity of
7413	 and
7414	 311388), 5(cid:2)-TCA GTT
7415	  until  the  nextfollow-up
7416	 mutation status were included, thesepatients demonstrated
7417	   and   potential   targets   BMI-1,   PTEN,   p-AKT   innon-small-cell   lung   cancerJing   Hu a,1,   Yan-Long   Liu b,1,   Song-lin   Piao c,   Dong-dong   Yang d,   Yan-Mei   Yang e,   Li   Cai a,∗a Department  of  Breast  Medical  Oncology,  The  Third  Affiliated  Hospital  of  Harbin  Medical  University,  Harbin,
7418	   mediates   cell   survival   and   pro-liferation   by   promoting   the   expression   of   BMI-1   and   upregulation   of   activated
7419	   and   potential   targets   BMI-1,
7420	  and  its  potential  targets  BMI-1,
7421	  antibody(Abcam,  ab4812,  diluted  at  1:50),  BMI-1  (LifeSpan  Biosciences,LS-C98480,  diluted  at  1:60),  phospho-AKT  (p-AKT)  (Bioworld  Tech-nology,  BS4007,  diluted  at  1:50),
7422
7423	  corre-lated  with  high  BMI-1,  p-AKT  and  low
7424	  group  and  cluster  A  (USP22+  and  BMI-1+  and  p-AKT+and   PTEN−)  group  were  associated  with  significantly  shorter
7425
7426	  and  its  potential  targets  BMI-1,
7427	  positively  correlated  with  highlevel  of  BMI-1  and  p-AKT,  and  negatively  correlated  with  lowlevel  of
7428	 and K-ras Mutation StudyAll the cases that were determined to be
7429	 rearrangement demon-strated an absence of
7430	 pattern is not yet clear, it might beassociated with various breakpoints of the
7431	 rearrangement in the test setdemonstrated ADC histology and the absence of
7432	 and
7433	  at  1 year,  assessment  of  changes  in  fluorodeoxyglucose  (FDG)  standardized  uptake  values (SUV) on
7434	 Median tumor diameter, cm (min-max) Median T Stage T1 T2 Peak
7435	 (years) Median PFS (years) 5 year
7436	  isoform  expression  and
7437
7438	 scan of the whole body, bone scintigraphy and enhanced whole-abdominal
7439	 andepidermal growth factor receptor (
7440	 ¼ epidermal growth factorreceptor; IHC ¼ immunohistochemistry;
7441	 in the
7442	 Immunohistochemistry-Positive PopulationAbbreviations: CI ¼ confidence interval;
7443	 IHCpopulation, although the
7444	 for
7445	 Jr, Herbst
7446
7447	 MSPI Polymorphism on the Relationship BetweenTP53 Mutation and
7448	 mutation and
7449	 MSPI and
7450	 mutation and
7451	 mutation and
7452	 and
7453	 and
7454	 is frequently inacti-vated through mutation (1) and
7455	 reflected by TP53 mutation or p53 overexpressionand
7456	 mutation and
7457	 mutation and
7458	 Mutation and
7459	 polymorphism were deter-mined by RFLP-PCR analysis of genomic
7460	 (exons 5e6, 7, or 8e9) (Sangon Biotech),Tag
7461	 Mutation and
7462	 (95% CI) on
7463	 mutation or
7464	 genotype had a significant relation-ship with
7465	 mutation and CDKN2Amethylation interacted in all participants or in subsetsdefined by
7466	 mutation or
7467	 risk genotype,occurrence of
7468	 was more likelyto be methylated when
7469	 mutationand
7470	 muta-tion and
7471	 mutation nor
7472	 polymorphisms alone cannot significantly influ-ence the incidence of
7473	 and
7474	 Mutation and
7475	 and
7476	 and
7477	 mutation interacted with
7478	 risk genotype to determine whetherthere is a possible link between
7479	 mutation and
7480	 and
7481	 genes in Chinese patients withnon-small cell lung cancers: relationship with aberrant promoter meth-ylation of the
7482	 or
7483	 and
7484	 and mutations of K-ras, p53, and
7485	 and
7486	 scan, repeat
7487	 and
7488	 was 19 months with a 5-year
7489	 to clini-cal mediastinal staging with
7490	 allows for the inclusion of involved hilar and mediastinal nodes not appreciated on
7491	 = computed tomography;
7492	s (or 49, considering that the CYP4A11and CYP4A22 can not be distinguished by TaqManÔ Gene Expres-sion Assays) are expressed at various levels in non-tumoral andtumoral lung tissues, as expression was undetectable for only 8 ofthe 57 CYP genes (CYP1A2, CYP3A4, CYP3A43, CYP4F2, CYP4F8,CYP11B1,
7493	 and
7494	 and
7495	 and
7496	 and
7497	 and
7498	 and
7499	 mRNA were detected in lung tissue from cigarettesmokers, but not in tissue from non-smokers, indicating that thetranscription of CYP1A1 is highly inducible by tobacco smoke con-taining
7500	 and cigarette smoking has been reported andspecifies that the pulmonary
7501
7502	 mRNA expression in lung is much highercompared to that of
7503	 as suggested by the control RT
7504
7505	 and moderate
7506	 and
7507	 and
7508
7509
7510	 and CYP4F8 mRNA and low to moderatelevels of CYP4F3,
7511	 [80],
7512	 which is active in the metabolism ofmany drugs, such as erythromycin, and
7513	 andCYP4F12 mRNA expression in AC and a decreased
7514
7515	 enzyme (oxysterol 7a-hydroxy-lase) catalyzes 7a-hydroxylation of
7516	 andCYP3A4 to 25-hydroxyvitamin D3 [111], which is further convertedin the kidney to 1,25-dihydroxyvitamin D3, the biologically activeform of vitamin D3, by
7517	 (cholesterol side-chaincleavage or cholesterol desmolase),
7518	 and CYP11B2, and very low to low expressionof CYP11A1, CYP17A1,
7519	 and undetectable levels of
7520	 were detected at moderate levels in BM and atrespectively moderate and very low levels in PP, whereas
7521	 has beendescribed as mainly constitutive, whereas
7522	 and
7523	 is expressedalong with
7524	 and
7525	 TTG TTT TTT
7526	 (20 mg) and
7527	 from nanocomplexes indi-cates the stable interaction between
7528	 was found in the nuclei of NSCLC cellstreated with P/ES, which confirmed that PAMAM performed afavorable cell internalization ability and could release
7529	 into NSCLC cells,remarkably inhibit cell proliferation and induce apoptosis, anddown-regulate the expression of the protein Survivin, EGFR,p-ERK1/2, Cyclin D1, p-AKT, Bax, and Pro-caspase-3, whileup-regulate the expression of
7530	 pathway regulates
7531	 and
7532	 AND
7533	 AND
7534	 inhibitors may arise not onlythrough specific EGFR mutations such as T790M, but alsothrough amplification or overexpression of the
7535	 amplifiedpatients also had the
7536
7537	 mutant tumours harbour a smallclone of
7538	mutations have been found in mucinous invasive adenocarci-LUNG CANCER SUBTYPES, EGFR AND
7539	 gene copy assessment or
7540	 result in various isoforms of the fusionLUNG CANCER SUBTYPES,
7541
7542	 wild-type tumours, 33% had
7543	 or
7544	 AND
7545	 and
7546	 amplification occurs with orwithout T790M mutations in
7547	 AND
7548	 and
7549	 in acquired gefitinib resistant non-small cell lungcancerHonggang Wang a, d, Zhenghua Fei b, d, Hao Jiang c, *a Department of Respiration, Jinhua People's Hospital, Jinhua, Zhejiang 321000,
7550	 Chinac Department of Oncology, Zhejiang Hospital, Hangzhou, Zhejiang 310013, PR Chinaa r t i c l e i n f oa b s t r a c tArticle history:Received 19 May 2017Received in revised form15 June 2017Accepted 19 June 2017Available online 30 June 2017Keywords:P21Acquired resistanceNSCLCPolyphyllinCell cycleBlockade of
7551	 T790Mmutation,
7552	 amplification leads togefitinib resistance in lung cancer by activating
7553	 and
7554
7555	   or
7556	 in
7557	 weremore likely to have nodal sampling/dissection, and moreLNs retrieved, this was not reflected in more nodalupstaging or in an improvement in
7558	R, only two signifi-cant models were identified: EGF and
7559	 and
7560	 and
7561	 models when compared to
7562	 and
7563	 expression is a possible reason leading to thedifferent miRNAs targeting
7564	 binds to EGFR, and then to
7565	 to
7566	 to
7567	 = computed tomography;
7568	 = cyclophosphamide; DOX = doxorubicin; ETP = etoposide; IALT = International AdjuvantLung Cancer Trial; NCIC = National Cancer Institute of Canada; NSCLC = non–small-cell lung cancer; OLCS = Osaka Lung Cancer Study;
7569	 sequence variations,such as L858R and delL747-P753insS, selectively activateantiapoptotic pathways by way of the increased phosphory-lation of the EGFR downstream effectors,
7570	 and
7571	 and DNA-dependent protein ki-nase can participate in the
7572	 T790MA mutant-enriched PCR assay for EGFR T790M was atwo-step PCR with intermittent restriction enzyme digestionto selectively eliminate
7573	 samples fromFFPE blocks of these specimens were prepared by slicingseveral paraffin sections, adding xylene to dissolve the0000505C for 30 seconds, and 72C for 30 seconds, 55-TGTTGGGTATTTGTTTTATTTTTAT-30-ACAAACTCTTACTATCCCAAAAAC-3Semi-nested PCR for
7574	 3130xl
7575	 mutants,theQuikChange Lightning Site-Directed Mutagenesis Kit(Agilent Technologies, Santa Clara, CA) was usedaccording to the manufacturer’s protocol with
7576	 muta-tions in exon 19 (Ex19-del), exon 21 (L858R), and exon 20(T790M) were analyzed with a PCR invader assay at aTable 1 Characteristics and
7577	 methylation of
7578	 YFP-Figure 1 Methylation analysis of
7579	 of the
7580	 of the
7581	 codon 790 canbe a mutational hotspot because of
7582
7583	 tumors than K, there was still sig-nificant retention of AMPK activation in KL tumors comparedwith KA tumors, suggesting that additional upstream kinasessuch as
7584	 FEB
7585	 and
7586	       5%
7587	 7%
7588	        3%
7589
7590	 or
7591	 and
7592	 (VDUP-1 #K0205-3), Tfe3 (#14779), 4EBP1 (#9452), P-S6K (#9205), S6 (#2217), and
7593	 because results fromin vitro studies with human liver microsomes predicted thatpemetrexed would not cause clinically significant inhibitionof metabolic clearance of drugs metabolized by CYP3A,CYP2D6, CYP2C9, and
7594	   mutations   in   patients   with   non-small   cell   lung   cancer:A   systematic   review   with   meta-analysisDaquan   Meng,   Mingli   Yuan,   Xiaojuan   Li,   Lijun   Chen,   Jie   Yang,   Xin   Zhao,   Wanli   Ma,   Jianbao   Xin∗Department  of  Respiratory  and  Critical  Care  Medicine,  Key  Laboratory  of  Pulmonary  Diseases  of  Health  Ministry,  Union  Hospital,  Tongji  Medical  College,Huazhong  University  of  Science  and  Technology,  1277  jiefang  Avenue,  Wuhan  430022,
7595	  mutations  [4],
7596	  >  1implies  worse  survival  for  the  group  with
7597	  mutations  in  NSCLC  involve  codon  12,  andthe  combined
7598	  mutations  on  patients’  disease  freesurvival  (DFS)  or  progression  free  survival  (PFS),  while  some  trialsreported  the  data  about  overall  survival,  aggregating  these  trials  toget  combined
7599	  for  41  studies  evaluating  the  cor-relation  between
7600	  forAsians  was  much  larger  than  non-Asians,  implied  that
7601	  was  statistically  significant  in  stage  I  and  stage  I–IIIa,suggesting  that
7602	  and
7603	  and
7604	  and
7605	  mutations  at  codon  12  in  plasma
7606	  and
7607	  and  insignificant
7608	  mutations,  EGFR  copy  numberand
7609	  and
7610	  and
7611	  on  clinical  outcome  of
7612	 via down-regulating
7613	 in non-small-cell lung cancer cells, which involved itsnovel down-regulatory effect on
7614	 PD PD PD PD PD PDB Small-cell lung cancer706050403020100–10–20–30–40–50–60–70)%( ezis noisel tegrat ni en ilesabmorf egnahc tsetaerG)%( ezis noisel tegrat ni en ilesabmorf egnahc tsetaerGTriple negativeHR-positive/HER2-negativeHER2-positive/any HRSD SDPDSD SD SDPD SD PDSD SD SD SD SD SD SDPDSD SD SD SDPDSD SD SD SDPDSD SD SD SD
7615
7616	 and
7617	 methylationheterogeneity for all genes except
7618	 loci in five independentlung samples obtained from noncancerous individuals werevery similar, except in the case of
7619	 wassequenced at the Institute of Molecular Biology
7620	 anti-rabbitantibodies were purchased from Santa Cruz Biotechnology (SantaCruz, CA, USA),
7621	 and
7622	 and
7623	 and
7624	 and
7625	 and
7626	 and
7627	 and
7628	 and
7629	 and
7630	 and
7631	 and
7632	 and
7633	 were 50-ATCATCCCTGCCTCTACTGG-30 and 50-TTTCTAGACGGCAGGTCAGGT-30, those for
7634	 and
7635	 and
7636	 and
7637	 and
7638	 and
7639	 and
7640	,
7641	 and
7642	 and
7643	 and
7644	 (A 400)and
7645	 (F red 400) and
7646	 expression in NSCLC is the same to
7647	 and
7648	 and
7649	 and
7650	 and
7651	 and
7652	 and
7653	 or
7654	 and
7655
7656	 was co-localized with
7657	 and
7658	 and
7659	 and
7660	 and
7661	 and
7662	 and
7663	 of
7664	 and
7665	 and
7666	 is a global signaling network that sensesdifferent types of damage and coordinates a response that includesactivation of transcription, cell cycle control, apoptosis, senescence,and
7667	 damage signalingapparatus are a pair of related protein kinases–ATM (ataxia telan-giectasia mutated) and
7668	 damage on consensussites recognized by
7669	 is the BRCA1, which includes BRCA1-associatedring domain protein (BARD1), BRCA2, partner and localizer of BRCA2(PALPB2),
7670	 through the
7671	 complexes play redundant roles orpromote multiple distinct steps in
7672	 ubiquitylates histones at
7673	 and
7674	 is the principal enzyme involved in themetabolic inactivation of paclitaxel, while
7675	 and
7676	 in the pentaglutamate form, the predominant intracellular form thatstrongly inhibits TS,
7677	 repair, ERCC1,
7678	 repair:association with attenuation of the interaction of
7679	 repair by
7680	 protein complex required for the
7681	 to specific ubiquitin structures at
7682	 to
7683	 is a mediator ofthe mammalian
7684	 is required for subnuclear assembly of Rad51and survival following treatment with the
7685	 expression restores radiation resistance in BRCA1-defective cancercells through enhancement of transcription-coupled
7686	 and
7687	 repair proteins
7688	   SNP   2572C   >   T  genotype   groups,we   found   that   the  FPGS   protein   expression   was  significantly   higher   in   the
7689	   genotype   group   than   in   the   TT   +
7690	  activity  was  related  tothe  gain  of  resistance  to
7691
7692	  genewere  detected  using  StepOnePlus  Real-Time  PCR  Systems  (AppliedBiosystems,  Foster  City,
7693	  protein  expression  level  wassignificantly  higher  in  the
7694	  SNP  15362C  >  Tgenotype  groups,  the
7695	  SNP  2572C  >  T,  the  FPGS  protein  expression  level  was  significantly  higher  inthe
7696	  genotype  was  not  found  amongthese  15  adenocarcinoma  cell  lines,  and  there  was  no  significant  difference  in  FPGSexpression  between  the  TT  and
7697	  and  TT  +
7698	  genotypegroup  than  in  the  TT  +
7699	  was  significant  shorter  inthe
7700	  genotype  group  than  in  the  TT  +
7701	  had  no  significant  difference  between  the
7702	  and  TT  +
7703	   mutation Regimen TT  +
7704	  (n  =  87) Grade  1–2 Grade  3–4
7705	  and
7706	  expression  was   relatedto  the  response  to  antifolate  drugs,  such  as  PEM  and
7707	  genotype  group  than  in  the  TT  +
7708	  SNPs  in15  lung  adenocarcinoma  cell  lines  and  found  that  the  expressionlevel  of  FPGS  was  significantly  higher  in  the
7709	  genotype  group  and  the  TT  +
7710	  andTT  +
7711	  in  theCC  genotype  group  than  in  the  TT  +
7712
7713	  genotype  group,  the  RR,  PFS  and
7714	  and
7715	 mutation,we also detected
7716	exon 20 insertion allele fraction, and the copy number of ERBB2 and
7717
7718	 mutationsin addition to other uncommon driver genomic alter-ations, for patients whose NSCLC tumors are negative forgenomic alterations in EGFR, ALK, and
7719	 and
7720	 ratiowas an independent factor influencing the
7721	 ratio couldaccount for less than half of the variance in the
7722	 and in
7723	 and
7724	 differences, with a higher
7725	 ratio using several trial characteristics as indepen-dent variables, including the
7726	 ratio was anindependent factor influencing the
7727	 ratio was significantly and primarilyexplained by the
7728	 and
7729	 ratio could explain one sixth to halfof the variance in the
7730	 ratio indepen-dently affected the
7731	 and
7732	 between the arms with those in
7733	 ratio was an independent factor influencing the
7734	 (me-dian survival time) ratio and
7735	 Ratio and the
7736	 and TTP were providedinfrequently (in only 8 of the 67 trials), leading us to use theMST and
7737
7738	 and
7739	 vs Pembro + ImmunotherapyPlatinum + Alimta ± pembroPlatinum doublets vs Platinum doublets + Nivo vs Nivo ± Ipi1st1st1st1st1stJuly 2015PFS and
7740	 TKI-inhibitor or
7741	 testing in three patients; one patient hadtissue sent, but
7742	 or
7743	 mutation, which can occur concomi-tantly with
7744
7745	 and
7746	 inhibitor, MAPK/ERKkinase inhibitor, or insulin-like growth factor receptor inhibitorwith or without
7747	 and
7748	 loss contributes to erlotinibresistance in
7749	 variation with heart dosimetry and ECGchangesTables 2 and 3 list
7750	 inhibitors for 30 min: the JNK inhibitor SP600125 (2 mM), the p38 inhibitor SB203580(10 mM), and the
7751	 amplification has been implicated inresistance to
7752	 kinase domain mutationresults in constitutive phosphorylation and activation of HER2 and
7753	 and
7754	 amplification: a potential me-chanism of acquired resistance to
7755	 mutations and epidermal growth factor receptor (EGFR), KRAS, and
7756	 (exons 1–9),
7757	 mutations, 1 case concurrently had anEGFR mutation and 4 cases had
7758	 mutations were not found in the tumorswith
7759	 mutations are relatively common in NSCLC, andthus analysis of PTEN mutations may facilitate a comprehensive understanding of the genetic alterationsrelated to the
7760	 genein a large number of NSCLCs and confronted PTEN mutations withthe EGFR, ERBB2,
7761	 (exons 18–21), ERBB2(exons 19 and 20),
7762	 mutations with clinicopathologic char-acteristics and mutations of the EGFR, ERBB2, KRAS, and
7763	 mutations, 1 case con-currently had an
7764	 mutations were not found in the tumors with
7765	 mutation in NSCLC,whereas mutations of LKB1 and KRAS genes are rarely found intumors with an
7766	 mutation thereis already activation of the PI3K–AKT–mTOR pathway, as well asthe
7767	 mutations werenot found in tumors with a
7768	 tyrosine kinase (
7769
7770	 mutations respond to EGFR
7771	 mutations were only present in ever-smokers, PTEN muta-tions may contribute to resistance to
7772	 regulates
7773	 and
7774	 is required for a responseto
7775	 receptor-expressing tumors cells counter-acts the antitumor action of
7776	   and   Borg
7777	   Trust;   the   staff   onCaroline  Ward   at   SGUL   and   Dorcus   Ward   at
7778	   National   Research   Ethics   Service,South  East   London
7779
7780	 of
7781	 when added to cisplatin/vinorelbine in patients withadvanced NSCLC expressing
7782
7783	 amplification in
7784	 T790M mutation and
7785	 signaling and Mcl-1 and Survivinexpression to potentiate ABT-263-induced apoptosis in Non-small Cell LungCancer cells harboring
7786	 or
7787	 activity and modulates expression of Mcl-1, Survivin and Bim, therebysynergizing with ABT-263 to trigger apoptosis in NSCLC cells harboring
7788	 or
7789	 is a receptor tyrosine kinase that activates cellular signalingpathways such as the PI3K/AKT, STAT, and
7790	 and
7791	 and
7792	 or
7793	 mutant (H1299) and
7794
7795	 or
7796	 mutationQ61K, and MV522 with
7797	 or
7798	 is inactivated by DHA in NSCLC cells with
7799	 and
7800	 is inactivated by DHA in NSCLC cells with
7801	 (2 µM) alone or in combination for one day and the phospho-
7802	 was knocked down by shRNA or (B) in the presence or absence of stattic, andH1975 cells were treated with DHA (15 µM),
7803	 (STAT3-CA) or empty vector (vector) were treated with DMSO orcomb of DHA and
7804	 was in-activated,the phosphorylation of JAK2,
7805	 inactivation by DHA con-tributes to ABT-263 and combination treatment-induced cell killing;and
7806	 or
7807	 or
7808	 mutation [13] and
7809	 phosphoryla-tion at Y705 can be triggered by the
7810	 by inhibiting
7811	 or
7812	 or
7813	 and
7814	 and its activatorJanus activated kinase (JAK) are controlled by cytokines includinginterleukin (IL)-6,
7815	 mutantlung cancer cells (A549, and H460) are significantly more sen-sitive to OT52 compared to
7816
7817
7818	 binding affinities of
7819	 phosphorylation isregulated by
7820	 and
7821	 and
7822	 and
7823	 or
7824	 upregulates expression of pro-survival Bcl-2 genes, weinvestigated the expression levels of another
7825
7826	 regulator protein expressions including p-Src(y416), c-Abl, PP2A, SHP-1, and
7827	 and
7828	 was normalized by a-tubulin (L), and Nuclear
7829	 and Bcl-2family proteins (Bcl-xL or Mcl-1) in
7830	 mutations can stimulate Bcl-xL expressionthrough
7831	 gene up-regulates BCL-XL protein via
7832	  and
7833	 295 80 761 141 519 91 35 3 1610 315 SD 433 56 1303 129 1042 63 30 2 2808 287
7834	  gene  status Mutated19-Del L858R Other Wild   type Total
7835
7836	 mutations and
7837	 re-arrangement, 21% had a positive
7838	 translocation, 24% had an
7839	 mutations,
7840	 and
7841	 mutation detection in 74 blinded non-small cell lung carcinomasamples: a total of 5550 exons sequenced by 15 molecular French laboratories(evaluation of the
7842	 density changes are com-mon and sometimes do not allow to differentiate recurrence fromfibrosis where
7843	 samples obtained from a series of patients withadvanced NCSLC treated with chemotherapy, we assessed the asso-ciation between the
7844	 and PRwere combined as responders, and SD and
7845	 (see Supplementary Tables 1 andTable 6Association between
7846	 is asso-ciated with decreased platinum–
7847	 expressionmay lead to a converse upregulation of the
7848	 and
7849	 and
7850
7851	 ¼ insulinlike growth factor;
7852	 ¼ insulinlike growth factor;
7853	 and
7854	 and
7855	 and
7856	 interaction subnetwork of 47 proteins of the
7857	 and
7858
7859	 includ-ing ADAM17, EPHA4, EPHB3, IRAK1,
7860
7861	 complexof relevant EGFR adaptor proteins, namely
7862	 and ERBB3as well as
7863	 and
7864	 and Akt pathways were inhibited by erlotinibtreatment followed by
7865	 pathway was responsive to receptoractivation by
7866	 pathway as well as adown-regulation of the ErbB3 protein level in erlotinib resistantHCC4006 cells was verified by Western blotting analysis, deactivationof the Akt pathway was neither deducible from the
7867	 and Akt confirmed the relevance of these pathwaysfor cell proliferation in both, HCC4006 cells sensitive to erlotinib and inthe erlotinib resistant situation and might therefore represent potentialtherapeutic strategies, though independent of the
7868	 (HCCE+/HCC+) were annotated to the KEGG
7869	 loss contributes to erlotinib resistance in
7870	   is   present   in   a  subgroup   of  NSCLC,   which   is   significantlycorrelated   with
7871
7872	  PRISM  3130
7873	  mutation  were  calculatedin  a  multivariate  logistic  regression  model,  including  gender,  age,smoking  status,  histology  and  MCPyV  LT
7874	  (Positive  vs  Negative) StagingI   vs  II I   vs  III I   vs  IV HistologyAd   vs  Scc Ad   vs  Ad&Scc ≥65) Gender  (Female  vs  Male) Age   (<65  vs Smoking  status  (Non-smoking  vs  Smoking) MCPyV  LT  DNA  (Positive  vs  Negative) StagingI   vs  II I   vs  IIII   vs  IV
7875	  and  mutationsin  the
7876	  and  different
7877	  and
7878	 for soft tissue led to smaller tumourvolumes than
7879	 compared with thepre-therapeutic
7880	 Immunoscore yielded a significant independent prog-nostic effect for all patients for DSS, DFS, and
7881	 ¼ not reached;
7882	 re-arrangement (n = 29) or a driver mutation in
7883	 orKRAS mutation or an
7884	 vs
7885	 in Stage III (ALK vs
7886	 and
7887	 inhibitor  RG7388  can  reactivate  p53  signaling  and  inhibit tumor  growth  in  clinically  relevant  NSCLC
7888	 sequencing of
7889	 protein or amplification are highly sensitive to RG7112, we examined the MDM2 amplification status in our
7890	  and
7891	 Inhibitor for Non–Small-Cell Lung CancerAegnahcdof l ANRmBVehicleVehicle     n=580mg/kg   n=5PHLC 12 *****p21
7892
7893	 antagonist with superior selectivity and potency, we demonstrated that RG7388 stimulates rapid p53 accumula-tion in clinically relevant NSCLC
7894	 antagonist RG7112  on  the
7895	 repair by
7896	 (T790M) alters thedrug-binding ability to the
7897	 TKIs develop amplification ofthe gene encoding
7898	 TKI support the strategy of maintaining theinhibition of EGFR inhibitor-sensitive clones, whichmay continue to be therapeutically controlled beyondinitial
7899	 mutantpatients treated with an EGFR TKI between 2002 and2010 with radiological
7900	 status, who haddeveloped
7901	 inhibitors beyond
7902	 mutant NSCLC patients who developedPD by RECIST on gefitinib, but who continued treat-ment and found a median
7903	 TKI after drug holidayThere is a biological rationale for re-exposure of previ-ously EGFR-driven tumour clones after
7904	 TKI with chemotherapyThe identification of multiple molecular mechanisms ofacquired resistance which may develop during EGFRinhibitor therapy and the development of multiple sitesof new disease has led to the hypothesis that the addi-tion of cytotoxic chemotherapy to the continuation oftargeted treatment may be a more effective antitumourtreatment strategy for selected patients with a higherburden of disease or more sites of
7905	 acknowledge
7906	 amplification leads to gefitinib resistance inlung cancer by activating
7907	  and  CD8  or
7908	 5, SD 1;arm B: PR 0, SD 220 patients with advanced NSCLCPR 2, SD 9,
7909	 1,
7910	 ¼ complete response; DCR ¼ disease control rate;
7911	 ¼ overall survival;
7912
7913	 ¼ complete response; DCR ¼ disease control rate;
7914	 on both normal and tumor cells and isapproved by the FDA for treatment of
7915	 and thyroid transcription factor 1 protein expression,but not for
7916	 ⫽ epidermaland Drug Administration;GEM ⫽ gemcitabine; IALT ⫽ International Adjuvant Lung Cancer Trial; IDEAL ⫽ Iressa Dose Evaluation inAdvanced Lung Cancer; NSCLC ⫽ non-small cell lung cancer;
7917	 ⫹ VCR ⫹
7918	 and CBDCA ⫹
7919	 vs CDDP ⫹ GEMvs CDDP ⫹
7920	 vs CDDP ⫹ VNRCDDP ⫹
7921	 vs CBDCA ⫹ DTXvs CDDP ⫹ VNRCDDP ⫹ DTX vs CDDP ⫹ VDSCDDP ⫹
7922	 ⫹
7923	 ⫹
7924
7925	 mutations (L858R and delL747-P753insS) had increased
7926	 domain of
7927	 and the 38consecutive patients who had responded to first-line therapy andreceived
7928	 group had EasternCooperative Oncology Group (ECOG) PS 1; therefore,
7929	 of the
7930	 with best supportive care showed better
7931	 group, althoughmore stage IV patients were included in the
7932	 and 17
7933	 and
7934	 (Demeditec, Germany),
7935	 and
7936	 and
7937	 and
7938	 and
7939	 and
7940	 or
7941	 and
7942	 and
7943	 and
7944	 and
7945	 and
7946	 and
7947	 and
7948	 and
7949	 and
7950	 and
7951	 and LRG1,but not
7952	 and
7953	 and
7954
7955	 tyrosine kinase inhibitor thatdecreased Rad51 protein and mRNA stability along with thedown-regulation of
7956	 signal pathway may potentially con-tribute to NSCLC cell survival against MMC-induced
7957	 double-strand break repairsignalling: the case of
7958	 gene modifies cancer risk inBRCA2 but not
7959	 and
7960	   and
7961	   mutations   and   27/127   (21%)   had   an
7962	   mutated   cohort   when   compared   to  the
7963	   mutated   tumor   when   compared   toALK   translocated   or
7964	  mutations,  or  V-Ki-ras2  Kirsten  rat  sarcoma  viraloncogene  homolog  (KRAS)  mutations  or
7965	  or
7966	  and  KRASmutation  status  and
7967	  mutation  analysis  and  55%  had
7968	  mutation,  17/155  (11%)  had  KRASmutations,  27/127  (21%)  had  an
7969	  mutation  testingYesNo
7970	  mutation  +
7971	  mutated,  only
7972	  mutationa (n  =  97)
7973	  mutation  and
7974	  translocation  and
7975	  mutationa (n  =  53)
7976	  mutation  and
7977	  translocation  and
7978	  translo-cated  than
7979	  mutation  weresignificantly  more  likely  to  have  a  family  history  of  lung  cancer  ascompared  to  patients  with  an
7980	  gene,  was  associated  with  a  combined
7981	  mutations  were  the  most  frequent  genotype  (43%),followed  by
7982	  mutations,
7983	  translocationor  a
7984	  gene  polymor-phisms,  including  intron  1
7985	  and
7986	 AAC GGC ACA G-30; antisense, 50-GCG AAT TCCTAG
7987	 CTG CCG TTT
7988	 Ganti, A Kessinger, M Sitki Copur, JL MezaData Acquisition: SE Radniecki, K Swenson,
7989	 Ganti, A Kessinger, SE Radniecki, K Swenson, MEKos, S Kruse, H DeSpiegelaere, M Ketcham,
7990	 Ganti, A Kessinger, SE Radniecki, K Swenson, MEKos, S Kruse, H DeSpiegelaere, M Ketcham,
7991	,RF, EF, CF,
7992	 in NSCLC cell reduced the expression of b-catenin and
7993	 over-expression in NSCLC cells induced the expression of b-catenin and
7994	 acts as an oncogene in non-small cell lung cancerby epigenetically repressing
7995	 acts as an oncogene innon-small cell lung cancer by epigenetically repressing
7996	 suppression by pacritinibmay play a role in overcoming the EGFR-TKI resistance mediated by
7997	 family inmammals consists of four members: JAK1, JAK2,
7998	 has been shown to be a key molecule medi-ated by
7999	 has been suggested to playa role in the carcinogenesis of early stage
8000	 inhibition was shownto activate
8001	 and
8002	 antibodies werepurchased from Santa Cruz Biotechnology, a
8003	 and
8004	 and C4 indicate phosphorylated
8005	 activation in both cell lines(dots
8006	 (B1 and B2),
8007	 and
8008	 inhibition bythe pacritinib occurred independently of
8009	 and
8010	 interacts with sev-eral molecules including PI3K, SRC, the growth factor receptor-boundprotein 2 (Grb2), SH2 domain-containing transforming protein (Shc),Grb2-associated-binding protein 1 (Gab1), and
8011	 induced
8012	 and expanded myeloid-de-rived suppressor cells through
8013	 phosphorylation andsubsequently suppressed downstream ERK, AKT, and
8014	 and the indirect downregulation of c-MET may bemore important than the
8015	 inhibition and likely resulted from inhibition of one of theother kinase pathways such as
8016	 inhibitor pracinostat (SB939) is efficacious and synergistic withthe
8017	 and
8018	 was suppressedwhen cells were pretreated with
8019	 induced the phosphoryla-tion of FAK and
8020	 caused a significant increase in the lamellipodiaformation and cell invasion, and these are suppressed by FAK inhibitor FAKi-14, PI3K inhibitor wortman-nin and
8021	 triggers
8022	 acts as a crucial oncogenic molecule in regulatingtumor progression such as tumor growth, invasion, angiogenesisand metastasis by binding to cell surface integrins such as amb3and amb5, and
8023	 areresponsible for LIMKs phosphorylation and activation,17 to investi-gate the upstream effectors of LIMK/cofilin, the expressions ofPAKs and
8024	 markedly increased the expression ofROCK1 in a dose dependent manner, whereas
8025	 increased the phosphorylationof cofilin, which was effectively decreased by
8026	 increased
8027	 signaling path-ways contribute to the migration and invasion of cancer cellsmedicated by
8028	 led to a significant increase of the phosphorylationof FAK and
8029	 effectively inhibitscofilin activity through
8030	 and Bax (Santa CruzBiotechnology, Santa Cruz, CA, USA, 1:1000), c-fos and cyclin A2(Boster, Wuhan, China, 1:800), c-jun and caspase-3 (Cell SignalingTechnology, MA, USA, 1:1000),
8031	 beingdamaged by
8032	 stimuli and may be the rate-limitingprocedure for repairing ROS-induced damage by providing 30-hy-droxyl for
8033	 ¼ hazard ratio;
8034	 trials,includingRTOG 1106, which uses a midtreatment
8035	 PRISM 7500 software (Applied Biosystems, Foster City,CA, USA) to interpolate the standard amplification curve of
8036	phosphodiesterase 1 activities in non-small cell lung cancer tissueAnn-Katrine Jakobsen a, Kristina Lystlund Lauridsen a, Evelyn Benuja Samuel a, Joanna Proszek a,Birgitta Ruth Knudsen b,c, Henrik Hager a,d, Magnus Stougaard a,⁎a Department of Pathology, Aarhus University Hospital, Denmarkb Department of Molecular Biology and Genetics, Aarhus University, Denmarkc Interdisciplinary Nanoscience Center (iNANO), Aarhus University, Denmarkd Department of Clinical Pathology, Vejle Hospital, Denmarka r t i c l ei n f oa b s t r a c tArticle history:Received 23 January 2015and in revised form 4 May 2015Accepted 14 May 2015Available online 16 May 2015Keywords:Lung cancerTopoisomerase ITyrosyl-DNA phosphodiesterase 1BiosensorCryosectionTopoisomerase I (
8037	 has incell line based assays been shown to counteract the effect of
8038	 and
8039
8040	 mediated
8041	 and
8042	 or
8043	) activity specifically and func-tion by converting intracellular TOP1 activity into
8044	 activity status is currentlyperformed before
8045	 is an essential nuclear enzyme important for the release of to-pological stress introduced during processes such as transcription andreplication, where the
8046	 doublehelix causing
8047	 covalently trapped to the
8048	 is required for repair of chromosomal single-strand breaks arising independently of
8049	 can remove several different moietiesfrom the 3′end of
8050	 for the repair of a number of
8051	 activity may counteractCPT induced
8052	 and
8053	 and
8054	 and
8055	 and
8056	 oligonucleotides and chemicalsAll oligonucleotides were obtained from DNA Technology A/S (Aar-hus, Denmark) except the
8057	 nanosensor had the sequence 5′-ATTO488-phosphothioate-AAA
8058	 nanosensor, TOP1-Id16, had the se-quence 5′-AGA AAA ATT TTT AAA AAA ACT GTG AAG ATC GCT
8059	 activity assay hadthe sequence 5′-C6amine-CCA ACC AAC CAA CCA AAT AAG
8060	 and
8061	 and
8062	 and
8063	 buffer, divided intothree aliquots, and used for determining the protein concentration (by photospectrometric measurement), for measuring the activity of TDP1 (using the TDP1 nanosensor), and
8064	 nanosensor is composed of a
8065	 nanosensor, is composed of a
8066	 nanosensor to the tissue extract, the endogenous TOP1 cleaves the nanosensor releasing three bases of
8067	 and
8068	 and
8069	 and
8070	 and
8071	 activity and change in
8072	 and
8073	 and
8074	 and
8075	 and
8076	 and
8077	 activity have been reported tocounteract
8078	 activity would require increased
8079	 damage, the importance of
8080	 activity and
8081	 and
8082	 activity andchange in
8083	 activity causes increased
8084	 and
8085	 inhibitors currently approved for use in patients a possibil-ity could be to combine
8086	 and
8087	 and
8088	 and
8089	 and
8090	 and
8091	 and
8092	 and
8093	 and
8094	 serine 81 promotes interaction with
8095	 overexpression in human cells counteracts
8096	 repair enzyme
8097	 repairs nuclear and mitochondrial
8098	 modification of the neuroprotective protein
8099	 and
8100	 and tyrosyl
8101	 in
8102	 between
8103	 was alsosignificantly inferior in the
8104	 in the
8105	 was similarly influenced between the
8106	 therapy also negatively affected PFSand
8107	 outcomes is aninteraction between
8108	 was strongly associatedwith poorer PFS and
8109	 between the
8110	 mutations between the
8111	 mutation might allow much lower erlotinibdoses than are standard to be effective, thereby circumventingreduced erlotinib absorption caused by
8112	 data demonstratesthat NLNS is a significant predictor of
8113	  or
8114	 mutations,
8115	 revealed a
8116	 mutations,
8117	  can  ubiquitylate  the  proapoptotic  proteins  Smac/Diablo, active caspase-9 and HTRA2/OMI  through its
8118	  extraction  was  performed according to  a  standard  phenol-chloroform  extraction 162Copyright © 2012 by the International Association for the Study of Lung CancerJournal of Thoracic Oncology  •  Volume 8, Number 2, February 2013
8119	 AAG CAG
8120
8121	 (1:500; GTX101766, Gene Tex, Irvine, CA,USA),
8122	 (1:500; Rev 031506 K, Neomarkers, Fremont, CA, USA),HSP70 (1:1000, MA-006,
8123	 (1:500; GTX101766, GeneTex), α-SMA (GTX100034, Gene Tex) and
8124	 and
8125	 ¼ anaplastic lymphoma kinase; CI ¼ confidence interval;
8126	 SiteBRAHEPPULBRA-BRAHEP-Abbreviations: BRA ¼ brain; HEP ¼ liver; LYM ¼ lymph node; OSS ¼ bone; PD ¼ progressive disease;
8127	  activation  by  transfecting  the  cancer  cells  with  constitutively  activeMKK1/2  or  AKT  expression  vectors  significantly  restored  the  17-AAG-reduced
8128	  expressionand  ERK1/2  and
8129	  and
8130	  expression  and  ERK1/2and
8131
8132	  phosphorylation  and
8133	  protein  levels  correlate  positivelywith
8134	  activity  in  human  colon  cancer  WiDr  cells  via  theactivation  of
8135	  protein  andmRNA  levels  in  NSCLC  cells  through  ERK1/2  and
8136	 losscontributes to erlotinib resistance in
8137	 mutant NSCLC hadlower risk of locoregional failure compared to EGFR wild-type(WT) patients after chemotherapy and conventional RT,18-20while patients with KRAS-mutant locally advanced NSCLC haddecreased
8138	 was isolatedfrom tumor in paraffin-embedded tissue specimens and polymerasechain reaction using primers specific for codons 12, 13, and 61 ofthe
8139	 mutation status, andnone was tested for
8140	 ¼ not otherwise specified; NSCLC ¼ nonesmall-celllung cancer;
8141	-mutant tumors, and 3were KRAS WT, including one with an
8142	 MutationStatusThere was no statistically significant difference in
8143	 mutations status, but the high dosedelivered with SBRT may obscure any underlying variability inClinical Lung CancerJanuary 2015 - 29SBRT Outcomes in KRAS-mutant NSCLCTable 3 Patterns of RecurrenceAll Patients(n [ 75)KRAS Mutant(n [ 7)KRAS
8144	 ¼ hazard ratio; NSCLC ¼ nonesmall-celllungcancer; SBRT ¼ stereotactic body radiotherapy; SCC ¼ squamous cell carcinoma; VMAT ¼volumetric modulated arc therapy;
8145	 ¼ hazard ratio; NSCLC ¼ nonesmall-cell lung cancer; SBRT ¼ stereotactic body radiotherapy; SCC ¼ squamous cell carcinoma; VMAT ¼ volumetricmodulated arc therapy;
8146
8147	   rs9266825)   were   significantly   associated   with
8148	   rs11391,
8149	   in  patients  HWE   Best  genetic  model  P Adjusted
8150	  rs9266825  was  also  significantlyassociated  with
8151	  rs11391  was  significantly  associatedwith  increased  risk  of  death  (dominant  model:  adjusted
8152	  rs2790AA AG  GG  Additive  model AA  AG   +  GGHDAC2   rs11391TT
8153	  +  GG  and  rs9266825
8154	  rs4246215  (homozygouscomparison:  adjusted
8155	  rs11391TT
8156	  rs4246215,
8157	  (95%  CI) P Adjusted  OR  (95%  CI) aP Deaths
8158	  rs9266825)  were  sig-nificantly  associated  with
8159	  is  involved  in  efficient  5(cid:3)-flap  during  long-patch  base  excision  repair  and  the  maturation  ofOkazaki  fragments  in
8160	  677  C→T,
8161	  is  an  independentpredictor  of  survival  in
8162	  and
8163	  polymor-phisms  are  associated  with
8164	 and
8165	 according to initially used imaging technique wassimilar in patients whose disease was detected in the asymptomaticstate either with chest x-rays or
8166	 and
8167	 and
8168	  refer-ence
8169	  reference
8170	  mutations  were  evaluated  by  comparing  resultsobtained  with  the  Scorpion
8171	  harboringan
8172	  with  wild-type
8173	  mutations  incirculating  free
8174	  signaling  pathway  somatic
8175
8176	  fornon-invasive  detection  of  drug  resistance  mechanisms  in
8177	  T790Min  plasma  cell-free
8178	  T790M  with  plasma
8179	 camera system equipped for
8180	 and
8181	 is acquired in conjunction with a
8182	 imaging also has been noted to reduceinter-observer variation when used to guide target volume delin-eation in
8183	 targetvolumes using the information gleaned from
8184	, images from a staging PET/
8185
8186
8187
8188	 procedure onthe
8189	 and
8190
8191
8192
8193
8194	 with
8195	 images show insufficient contrast between tumor and non-tumor tissue where atelectasis is present, thereforedelineation should be defined by
8196	 is positive for tumor but
8197	 based auto-contouring is the variability of
8198	 component of the scan is complementary to that containedwithin the
8199
8200	 component ismore akin to 4D imaging while the
8201	 overthatCTV and PTV expansions to a
8202	 combined with
8203	 and
8204
8205	 and planning
8206
8207	 provide the 3D extent oftumor motion for individualized internal target volumes? A phantom study ofthe limitations of
8208	  kinasein  a  competitive  manner  with
8209	 expression among post-Open access under
8210	 and
8211	 and
8212	 and
8213	 and
8214	 and
8215	 and
8216	 or
8217	 scanning is more accurate than
8218	  and  also  assist
8219	  phosphorylation  but  does  not  bind  to  N-terminal
8220	 and
8221	 and
8222	 and/or
8223	 inhibition with antibodies or
8224	  performed  theexperiments  and  wrote  the  manuscript;  ZG,  LH,  HL,
8225	 and low TS: Cis/PemPrimary:
8226	 gene mutationand have low
8227	 mutation, median
8228
8229	 and PFS for patients harboringcommon versus uncommon
8230	 for uncommon
8231	 ¼ anaplastic lymphoma kinase;
8232	 mutation as well as
8233	 for All Uncommon
8234	 MutationSara Pilotto et alAbbreviations: CI ¼ confidence interval;
8235	 MutationAbbreviations: CI ¼ confidence interval;
8236	 ¼ duration of treatment;
8237	 ¼ not reached;
8238	 compared with classical
8239	 with gefitinib wassignificantly shorter in patients with rare
8240	-mutated NSCLC patients exhibits the bestoutcome among rare EGFR mutations, with a median
8241	 mutation aswell as an
8242	 and
8243	 mutations on responseto
8244
8245	 MutationsPatient12345678910111213141516171819SexMFFFFMMMMFFFMFFFMMMAge, yECOG PS706579597373746570746877735763857171780012012221111110102SmokingStatusFormerNeverFormerFormerNeverFormerFormerFormerFormerNeverFormerNeverNeverNeverNeverFormerFormerFormerNeverSmoking Habit,Pack-YearsStage atDiagnosis>40NA>4010NA>30 to 40>40>10 to 20>40NA>40NANANANA1010>30 to 40NAIVIVIIIBIVIVIBIVIVIVIVIVIVIVIIAIVIIAIVIIIAIIIB>30 to 40NA>40NA20212223242526272829303132333435Abbreviations: ECOG PS ¼ Eastern Cooperative Oncology Group performance status; F ¼ female; M ¼ male; NA ¼ not available;
8246	 high wassignificantly associated with unfavorable
8247	 is anindependent predictor of
8248	 expressionlevel in the tumor tissue of colon but failed to provide evidence of itsprognostic value in terms of relapse-free survival and
8249	 pathway also led to someconsequences that were demonstrated to favor cell growth viamultiple processes, including reduction in
8250	  [22],
8251	  and
8252	  and
8253	  and
8254	  and
8255	  [41],
8256	  and
8257	  promotes  non-small  cell  lung  cancer  cellproliferation  through  epigenetically  regulating
8258	 above the reference range (reference range: ø10 mg/L, 57%) and therefore a pretreatment mGPS = 1 (62%) and pretreatment
8259	 [21]Mori K [22]Jalal S [23]Isobe K [24]Ramalingam
8260	  mRNA  levels  relative  to
8261	 and
8262	 fragment for
8263	 promotes DC maturation and IL-12 production in DCsNext, we analyzed the levels of CD80, CD83,
8264	 is a protein chaperone it is possiblethat besides up-regulated MHC expression and antigen presenta-tion, CALR may also promote the fold and trafficking of CD80,CD63,
8265	  or
8266	  or
8267	  and
8268	haracteristics Age  in  years:  median  (range) GenderMale Female SmokingNo Yes ECOG  performance  status0 1 2 StageIIIA IIIB IV HistologySquamous  cell  carcinoma Adenocarcinoma Differentiation  statusWell Moderately Poorly ChemotherapyGem  +  cisplatin Gem  +  carboplatin
8269	  and
8270	  +
8271	  for
8272	  for
8273	Consistent  with  the  significance  of  the  hENT1  G-706C  polymor-phism  in  the  response  to  gemcitabine-containing  chemotherapy,log  rank  analyses  showed  that  OS  in  patients  with  GG  genotype  ofthe  hENT1  G-706C  polymorphism  was  significantly  longer  than  inthose  with  the
8274	  (95%  CI)aAdjusted  PaGenotype GG
8275	  (95%  CI) Log-rank  testx2PGG
8276	  genotypes  were  associated  with  lowchemotherapy  response  rates  and  proved  to  have  an  independentpredictive  value  for  reduced
8277	ariable Age  (60  vs  <60) Gender  (male/female) Smoking  status  (yes  vs  no) Stage  (IV  vs  IIIA  or  IIIB) ECOG  status  (2  vs  0  or  1) Histology  type  (squamous  cell  carcinoma  vs  adenocarcinoma) Differentiation  status  (poor  vs  well  or  moderate) Chemotherapy  regimens  (Gem  +  carbo  vs  Gem  +  cisplatin)
8278	  hazards  ratio,  95%  CI  95%  confidence  interval,  HR  >  1  indicates  that  patients  have  a  worse
8279
8280	/HGF expres-sion by immunohistochemistry (IHC) and MET gene amplification by  dual  color,  dual  hapten  bright  field  in  situ  hybridization  in  19
8281	  rearrangement  is  found  to  be  primarily mutually exclusive with
8282	/HGF  expression 646Journal of Thoracic Oncology  ®  •  Volume 9, Number 5, May 2014Journal of Thoracic Oncology  ®  •  Volume 9, Number 5, May 2014 High MET Expression in
8283	  and
8284	 or
8285	 IHC,
8286
8287	 mutation was detected in three of 50 ALK(−) 648Copyright © 2014 by the International Association for the Study of Lung CancerJournal of Thoracic Oncology  ®  •  Volume 9, Number 5, May 2014 High
8288
8289	 and
8290	  rearrangement  and
8291	 expression (score 2) and weak
8292	 pathway alteration in 906 surgically resected NSCLC  cases,  which  were  further  divided  by
8293	 inhibitor in a previous case report, a NSCLC patient with de novo MET amplification but no
8294	  inhibitor  plus
8295	  signal-ing  pathway,  using  assays  to  investigate  MET  and
8296	 amplification leads to  gefitinib  resistance  in  lung  cancer  by  activating
8297	  amplification  occurs  with or  without  T790M  mutations  in
8298	 rearrangements are mutually exclusive with mutations in
8299	 and
8300	 gene copy number in lung cancer using
8301	 (ctDNA) detection of acquired
8302	 increased PFS and
8303	 prolonged PFS and
8304	 (due to increaseddetection of T790M),
8305	 interact with
8306	 and
8307	 and
8308	 and
8309	 and
8310	 was in close proximity of both
8311	 and
8312	 immunoreactivitywas shown to be a negative prognostic factor in
8313	 and
8314	 is a negative regulator of receptor tyrosinekinase (RTK) signaling, and has been shown to inhibit all four ErbBfamily members (EGFR, ERBB2,
8315	 [27],
8316	 can be proteolyticallycleaved at the ectodomain; the soluble LRIG1 that is shed then nega-tively regulates
8317	 and
8318	 has been shown to directly interact with and oppose theaction of
8319	 and
8320	 and
8321	 and
8322	 forward primer, 5′ – AAGGTACCAGTTCAATATATGGGTACGGTC – 3′; LMO7 reverse primer, 5′ –GAGGTACCCATGGCGGTTGGC – 3′;
8323	 sequencing con-firmed that
8324	 was marked withfluorescence creating a fluorescent
8325	 and
8326	 and
8327	 or LIMCH1, together with either
8328	 A, and a stronger band corresponding to
8329	 A, and all bands corresponding toLIMCH1 (LIMCH1 A, B, and C) co-precipitated with
8330	 and
8331	 clones and eleven ofthe
8332	 and
8333	 and
8334	 and
8335	 or
8336	 expression was consistently poor (data not shown), andtherefore the final experiments were performed using
8337	 and
8338	 was immunoprecipitated from cells co-transfected withLRIG1 and
8339	 species (LIMCH1 B and LIMCH1 C) were not detectedin the
8340	 was immunoprecipitated, theLMO7 A band, as well as all three
8341	 and
8342	 and
8343	 and
8344	 and
8345	 and
8346	 and
8347	 was in close proximity to
8348	 and
8349	 fluorescence signals per cell was higher in the cells la-beled with specific antibodies against
8350	 and
8351	 and
8352	 and
8353	 and
8354	 was associated with poor survival in NSCLCNone of the
8355	 and
8356	 or
8357	 for
8358	 or
8359	 signals in cells that weretransfected with control siRNA or siRNA against
8360	 and
8361	 and
8362	 and
8363	 and
8364	 interacted physically with
8365	 im-munoreactivity, adjusted for
8366	 interacted physically with both
8367	 and
8368	 or
8369	 and
8370	 and
8371
8372	 andLIMCH1 co-localized with
8373	 was also shown to be in closeproximity to endogenous
8374	 and
8375	 or
8376	 molecular species interacted with
8377	 and
8378	 and
8379	 and
8380	 and
8381	 and
8382	 and
8383	 interacted also prog-nostically with
8384	 and its paralog
8385	 and
8386	 ¼ progressive disease;
8387	 mutations, with and without
8388	 damage and
8389
8390	  and  NIKKaplan-Meier  analysis  showed  that  the  expression  of  OTUD7Bin  NSCLC  patients  (log-was  significantly  associated  with
8391	  showedlonger
8392	  of  patients  with  combination  ofhigh
8393	 NIK
8394	  regulates
8395	  deubiqui-tinates
8396	  had  shorter
8397	  +  NIK-group  is  the  best  with  the  longest
8398	  and
8399	 and LT groups are shown in Figure 4,indicating no significant difference in the
8400	 group than in the LT group,no significant differences in
8401	-
8402	 inhibitors to treat mutant Kras G12D and
8403	 value  for  FATS  gene  in  each  sample  wasobtained  from  three  independent  experiments,  and  normalized  by−that  of
8404	  are  involved  in
8405	 by tumorhypoxia provides a nonmutational explanation foritsAnn Thorac Surg2015;99:2195–7CASE REPORT WATANABE ET ALMETASTASECTOMY AFTER KIDNEY CANCER2195We report on an 82-year-old man who underwent a rightnephrectomy and was diagnosed with
8406	 T790M-mutant non-small-cell lungcancersZhuo Liu a,1, Luhong Wang c,1, Min Feng a, Yuanyuan Yi a, Wenhan Zhang a, Wenjuan Liu a, Lei Li c,Zhihao Liu b,c, Yanxia Li a,⇑, Xiaodong Ma c,⇑a Department of Respiratory Medicine, The First Affiliated Hospital of Dalian Medical University, Dalian 116011,
8407	 T790M while sparing the EGFR
8408	 T790M over
8409	   mutationsand
8410	   mutations   in   advanced   NSCLC   may   be   associated   with   higher   ORRs   to  chemotherapy,but   may   have   nothing   to  do  with   PFS   and
8411	  genotypeof  patients  with  NSCLC  to  determine  whether  EGFR-TKI  therapy∗ Corresponding  authors  at:  Tumor  Research  and  Therapy  Center,  Provincial  Hos-pital  Affiliated  to  Shandong  University,  324  Jingwu  Weiqi  Road,  Jinan,  Shandong250021,
8412	  mutations,  test  methods,  numbers  ofpatients  in  the  EGFR  mutation  and  wild-type  groups,  chemotherapyinformation,  objective  response  rates  (ORRs),  and  HRs  and  95%CIsfor  PFS  (or  TTP)  and
8413	  was   cal-culated  for  PFS  and
8414	  genotype  (scorpi-ons  amplification  refractory  mutation  system  [Scorpions  ARMS]or  direct
8415	  genotypes  were  detectedby  direct
8416	 3 3 3 3 1 1 1 353 217 145 71 105 87 75 49 54 28 65 75 113 214 128 71 65 81 46 142 156 80 85 159 145 Case 48/111 46/137 20/54 11/34 25/56 1/9 8/25 4/20 3/14 5/11 7/24 6/14 3/14 61/129 19/55 2/5 6/41 11/32 3/10 4/19 12/93 2/43 9/24 12/40 19/55 Control
8417	  for
8418	  mutations  and
8419	  favored  patients  with
8420	  sequencing Scorpions
8421	 HeterogeneityNumber  of  data
8422	  muta-tion  status  on  ORR,  PFS  (or  TTP),  and
8423	  following  chemotherapy  wassignificantly  different  between  patients  with
8424	  muta-tions  in  Asian,  first-line,  studies  providing  HRs  and  CIs  and  direct
8425	  mutation-positive  NSCLC  tookEGFR-TKIs  before  or  after  chemotherapeutics,  which  can  exert  aninfluence  on
8426	  mutation  on  PFS  and
8427	  test  method  subgroup  analysis,  there  were  no  signif-icant  differences  comparing  ORRs  between  patients  with  mutatedand  wild-type  EGFR,  a  statistically  significant  difference  was   foundin  the  direct
8428	  including  sex,  smoking  sta-tus,  histology,  and  aberrations  in  other  genes,  such  as
8429	  mutation  status  and  chemotherapy  effectsspecifically,  and  most  of  them  were  retrospective  observationalstudies
8430	  and
8431	  and
8432	 andthe presence of an
8433	 ¼ epidermal growth factor receptor;
8434	 tyrosine kinaseinhibitors (TKIs) in patients with sensitizing mutations in exons18 to 21 of the EGFR gene23 and
8435	 testing is more challenging than
8436
8437	 and
8438	 and
8439	 ACC AGC
8440	 ACU ACG UGU AAG GUG CTT 3′ Reverse:5′ GCA CCU UAC ACG UAG UUG CTG 3′; 2) Forward: 5′ GGU GCU GUAAAC AGG UUU GTT 3′, Reverse: 5′ CAA ACC UGU UUA CAG CAC CTT A3′; 3) Forward: 5′ GGC CAA GAC CAU
8441	 CCA GTC
8442	 TGT GGC CTC AGG ACTCT 3′ and Reverse: 5′ CAG GAC
8443	 mutations and relationship to EGFR, ERBB2, KRAS, and
8444	 (Cetuximab)(cid:129) EGFR (Cetuximab)(cid:129) VEGF-A (Bevacizumab)(cid:129) VEGF-A (Bevacizumab)(cid:129) IGFR (Figitumumab)(cid:129) IGFR (Figitumumab)Tumor cells or lysatesTumor cells or lysates(cid:129) allogeneic or autologous(cid:129) allogeneic or autologous(cid:129) genetically – chemically modified(cid:129) genetically – chemically modifiedDendritic cells (from blood)Dendritic cells (from blood)(cid:129) pulsed (peptides – proteins - tumor lysate)(cid:129) pulsed (peptides – proteins - tumor lysate)(cid:129) transfected (RNA - c
8445
8446	 protein formulated with monophosphoryllipid A (MPL), a
8447	 (a
8448	 is another
8449	 is a target of particular interest inNSCLC as it was recently observed that high co-expressionof both IGF1R and
8450	 re-ceptors have been developed, acting at the catalytic site of thekinase and interfering with the activation of natural sub-strates or with
8451	 (most com-monly small in-frame deletions in exon 19 or an L858R amino-acid substitution)in increased EGF-inducedactivation and gefitinib-induced
8452	 re-ceptors other than
8453	 repair genes
8454	 mutations or
8455	 mutations or
8456	 and
8457	 and
8458	 mut
8459	 mutations, 35 patientsshowed
8460	-mutated or
8461	-mutated or
8462	 mutationsand
8463	 mutations and
8464	 mutations or
8465	 mutations or
8466	 mutations and
8467	 rearrangements (n = 376), PD-L1 negative groupexhibited longer
8468	 mutations or
8469	 and
8470	 mutations or
8471	 mutations and
8472	 and
8473	 or
8474	 tyrosinekinase (
8475	 and inhibitor to
8476
8477
8478	 inhibitors, including two FDA-approved drugs, apan-kinase inhibitor staurosporine and four compounds that arecurrently under clinical or preclinical investigations, as well as thenatural substrate ATP, against a panel of 26 clinically relevantmutations in ALK
8479
8480
8481	 domain,which are thought to directly influence the binding of inhibitor li-gands to
8482	 inhibitorsThe ALK inhibitors can be classified into reversible and irre-the former inhibits the kinase activity of ALK byversible;competing with
8483
8484	 natural substrate,
8485
8486
8487
8488	 TKe
8489
8490
8491
8492	 by manually adding aphosphate moiety; the obtained structure model of
8493
8494
8495
8496	 proteins, 1 mM substratepeptide (biotin-ahx-EQEDEPEGIYGVLF-OH [34]) and 30 mM
8497
8498
8499
8500
8501
8502	 and Abl withsmall-molecule inhibitors erlotinib, gefitinib, imatinib, SB203580and AEE788, and other 4 are
8503
8504
8505
8506
8507
8508
8509
8510
8511
8512
8513
8514
8515	 scans of the chest showed the pri-mary lung tumor to be located in the LUL (n = 44), LLL (n = 30),lingula (n = 1), central left lung (n = 6), RUL (n = 31),
8516	 or
8517	 with ZOL, 4 mgevery 4 wk IVIshiwata, 2011 Phase II, 2 arms, (control arm:patients who refused to enterstudy), 2 centers, 2007–200935/35CT with ZOL,4 mg IV every4 wk (4–6 cycles)ComparatorArmFollow-UpPrimary StudyObjectiveSecondary StudyObjectives3 mo9 moEffect of ZOL/IBAon bone turnovermarkersFeasibility ofcombination of CTwith ZOLTumor response(RECIST), pain, SREQoL, SRE, toxicity, painMethod and Frequencyof Pain Measurement6-Point intensity scale(McGill-Melzach), atbaseline and at 1 and 3 moLung Cancer Symptomscale, every 4 wk, QOL-ACDCT every 4 wk,IBA 50, mg/dorallyCarboplatin(AUC ¼ 6) every4 wk withpaclitaxel (70mg/m2) everywk or Nedaplatin(90 mg/m2)every 4 wk withpaclitaxel (70mg/m2) everywk (4–6 cycles)NoneRetrospective,centers unknown, 2007–2010135/135CTwith ZOL, 4 mg every4 wkDel Signore,2012 (abstractonly)Yoh, 2012Phase not mentioned, singlearm, centers unknown,2007–200935/35Davidov, 2013Phase not mentioned, openlabel, single arm, single center,2004–200853/53NoneNoneCT with ZOL, 4 mgevery 3–4 wk , 4 cycles,ZOL continuedafterward untilunacceptable toxicityZOL, 4 mg with CT,(gemcitabine 1250mg/m2 d1,8 andcisplatin 80 mg/m2 d1,every 3–4 wk), numberof cycles not specifiedNotspecifiedTime to first andsecond SREPain, QoLNotspecifiedFeasibility ofcombinationof CT with ZOLToxicity, SRE, painscore, best objectiveresponse, OSVAS each clinical visit,EORTC QLQ-C30BPI baseline and after6 wkNotspecifiedSerum calciumand
8518	   mutations,   TP53   polymorphisms   (Arg72PRO)   and
8519	   mutations,   TP53   polymorphisms   (Arg72PRO)   and
8520	   or
8521	  (ataxia-telangiectasia,  mutated;  double  strandedbreaks)  and
8522	  >  TA  transversions,  and  are  mostly  located  in  theDNA  binding  domain  of  the
8523	  damage  thefunction  of
8524	  over-expression  can  be  caused  by  either   gene  amplification  orthe  presence  of  SNP309T  >  G  (rs2279744)  in  the  promoter  region  ofMDM2,  which  increases  the  binding  affinity  for  the
8525	  mutations  resulted  in  a  worse  prognosis  with  ashorter
8526	  mutant  patients  showed  a  worse
8527	  (95%  CI) p-valueNA NA NA NA NA NA NA NA NA NA ↓ NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA
8528	   T309G  polymorphism  withpoor
8529	  and
8530	  mutationsTP53  mutations  seem  to  negatively  influence  the  response  tocisplatin  doublet  therapy  as  a  significant  better
8531	  was  observed  between
8532	  and
8533	  mutantTrend
8534	   overexpression  occurs,  several  compounds  havebeen  developed  which  can  block  the  interaction  between  MDM2and  p53  like
8535	  and  PFS  and  reduced  the  response  tocisplatin  based  therapies  in  NSCLC,  while  the  role  of
8536	  antagonist  RG7112  on  the
8537	  and
8538	  and
8539	 siRNA, integrin av siRNA,
8540
8541	 ligands, we exam-ined whether
8542	 or control siRNA followed by stimulation with
8543	 induces tumor cell migration and avb3 integrinexpression through interacting with
8544	 promotes
8545
8546	 than in those with
8547	 and those with
8548	  or
8549	  benefit  associated  with  RTin  stage  IIIA  (adjusted
8550	  tyrosine  kinase  or  anaplastic  lymphoma  kinase  (
8551	-driven or
8552	+  NSCLC must have received an EGFR tyrosine kinase inhibitor, and patients with
8553	  (preferred)  or
8554	+ or
8555	 and
8556	  or
8557	 mutations and
8558	gene mutations were excluded from EML4-
8559	 wasfused with
8560	 TKIs inpatients with EGFR-mutated NSCLC, specific
8561	 and
8562	 mutations, andthe
8563	 muta-tions, median survival time (MST) was better in the casesthat had an EGFR mutation than in the cases that did not,and this finding was observed both in the
8564	 mutations is only one ofprognostic factors, or whether they are also predictors ofthe efficacy of taxanes, such as
8565	 receptorrepair by
8566	 observed on this trial was similar to the HR observedon the FLEX trial, and this trial was not sufficiently powered todetect a difference in
8567	 sig-nificantly improved
8568	 and
8569	 gene fusions or
8570	 in patients with NSCLC was stoppedearly when a planned interim analysis concluded that the studywould not meet its primary endpoint of improved
8571	 and
8572	 amplificationoccurs with or without T790M mutation in
8573	 in whom brain metastases were found on theadditional
8574	  phosphorylation  in  all  cell  lines, 696Copyright © 2013 by the International Association for the Study of Lung CancerJournal of Thoracic Oncology  •  Volume 8, Number 6, June 2013 Erlotinib and Chloroquine in
8575	  and
8576
8577
8578	 and
8579	  2026,  The  Univer-sity  of  Chicago,  5841  South  Maryland  Avenue,  Chicago,
8580
8581	  and
8582	 results are not prog-nostic for various outcomes such as local fail-ure, regional failure, distant metastasis, DFS,or
8583	 SUVmax did not pre-dict LC, regionalfailure, distant metastasis,or
8584	 = computed tomography; DFS = disease-freesurvival; EBUS = endobronchial ultrasonography; FDG-PET= 18F-fludeoxyglucoseepositron emission tomography; HR= hazard ratio; ITV = internal target volume; LC = localcontrol; NSCLC = nonesmall cell lung cancer;
8585	 repair of alkyl adducts by
8586	 ¼ overall survival;
8587	 and
8588	 Z not otherwisespecified;
8589	 Z hazard ratio;MVA Z multivariable analysis;
8590	 Z hazard ratio; NA Z not applicable;
8591
8592
8593
8594
8595
8596
8597
8598	 achieved longer PFS and improved
8599	 and PFS in femalepatients, regardless of histology,
8600	 levels were thencorrelated with response measured using the RECIST criteriain
8601	 expression levelsin
8602	 levels measured in
8603	 mutationstatus and
8604	 belongs to theperipheral myelin protein 22-kDa (PMP22) gene family of small hydro-phobic membrane glycoproteins, which include four closely relatedmembers: PMP22,
8605	   scans
8606
8607	 (siRNAeMDM2) (50-GCUUCGGAACAAGAGACUC-30 (sense)), and scrambled siRNA non-specific to anyhuman gene (siRNAeScr) [50-CGG UGA
8608	 in p53 null or mutant cancer cells, which mightbe ruled by
8609
8610	 ¼ chemotherapy (not specific); DCR ¼ disease control rate; EGFR-TKIs ¼ epidermal growth factor receptoretyrosine kinase inhibitors; ES ¼ ever smoker; Exon 19 del ¼ exon 19 in-frame deletions; Exon 21 L858R ¼ exon 21 L858Rsubstitution;
8611	 value of greater than 1 reflecteda better ORR or DCR in nonsmokers, while a
8612	 muta-tion might be replaced by other critical growth regulatory genes,most frequently
8613	 phosphorylation, thus impairing receptordegradation, but also resulted in a different EGFR conformation andsignaling that were resistant to TKIs in the TKI-sensitive EGFRClinical Lung Cancer March 2015 - 147Smoking Status and EGFR-TKI EfficacyFigure 2 Meta-Analyses of Nonsmoker Versus Ever Smoker in EGFR-Mutant NoneSmall-Cell Lung Cancer Patients ReceivingEGFR-TKIs for (A) ORR, (B) DCR, and (C) PFSAbbreviations: CI ¼ confidence interval; DCR ¼ disease control rate; EGFR-TKI ¼ epidermal growth factor receptoretyrosine kinase inhibitor;
8614
8615	 ¼ hazard ratio;
8616	 and theserpin peptidase inhibitor
8617	 constituents: Neoadjuvant gemcitabine-cisplatin chemotherapy resulted in upregulation of typeI-III collagens and syndecan, whereas elastin andmatrix metalloproteinase (MMP)13 were downregulat-ed,Incontrast, curcumin treatment of NSCLC celllinesinduced cell death and a downregulation of COL5A1,LAMA5 and the integrin subunits
8618	 and
8619	 regulate not onlyEMT [38], but also the expression of
8620	 constituentCollagensI-IIIIVV A1VIXIA1XVII A1Collagenous matrixActivation of collagen-binding integrinsLamininsLaminin 5Laminin5γ2Laminin γ 2ProteoglycansSyndecansSyndecan-1Syndecan-2Syndecan-4GlypicansGlypican-3Glypican-5DecorinPhysiological role(s)Role in lung cancerStructural functionsImpact on expression on epigenetic regulatorsligands for
8621	 and elastin [25]Col IV α5(IV):
8622	 signaling activation [32]Overexpressed in NSCLC with lymph node metastasis andrecurrence [47]Hypomethylation linked to invasion, metastasis [22]Impact on epigenetic regulators of gene expression [27,29]Increases resistance to chemo and radiotherapy, enhancesmetastatic behavior [49,50], enhances stromal stiffness [53]High expression related to poor prognosis [57,58]Protects against apoptosis, poor prognosis of lung SCC[63,66]interaction with CD44: stimulates invasion [61],enhancement of EMT, increased invasion [69]Increased expression of laminin binding integrin α6β4: poorprognosis, vascular invasion of NSCLC [70]α3β1 mediated interaction between type IV collagen andlaminin increases invasiveness of lung cancer [72]TGFβ1 inducible β3 integrin facilitates the ECM-degradingactivity of lung cancer cell invadopodia [73–75]Cell surface expression:favourable prognosis [80,01],increased shedding, and serum level: poor prognosis [83],role of cytoplasmic fragment [85,86]
8623	 constituentPhysiological role(s)Role in lung cancerFibromodulinRegulation of angiogenesis [111]Roles in inflammation and apoptosis [113] Correlates with pleural invasion and larger tumor size ofLumicanVersicanHyaluronan and
8624	 expression in lung SCC cells viaactivation of c-Jun through
8625	 silenc-ing, whereas the ADAM17-generated
8626	 of
8627	 and
8628	 dysregulation in lung cancerhas been attributed to genetic and epigenetic alter-ations, including an association of specific polymor-phisms of the
8629
8630	 overexpression in cell lines reducedmigration,invasion, proliferation and anchorage-independent cell growth and inhibited xenograft tumorgrowth, which was attributed to reduced signalingthrough
8631	 is not only an importantstructural compound of the
8632	 is amarker for cancer stem cells in lung cancer [117], thusproviding a link between
8633	 and activated STAT3[131], indicating a parallel activation of
8634	 function is not onlyrestricted to proteolytic degradation of
8635	 downregulation in thecancer stem cell associated side population of A549lung cancer cells provides a link between the
8636	 exon 18, 19, and 21, ALK/EML4translocation and
8637	   by   miR-512-3p   contributes   tosuppression   of   metastasis   in   non-small   cell   lung   cancerXingli   Zhu a,∗,1,   Guanghui   Gao b,∗,1,  Kaili   Chu a,   Xiufang   Yang a,   Shengxiang   Ren b,   Yao   Li a,Hai   Wu a,   Yan   Huang a,   Caicun   Zhou ba State  Key  Laboratory  of  Genetic  Engineering,  Institute  of  Genetics,  School  of  Life  Sciences,  Fudan  University,  Shanghai  200438,
8638	   pull-down   assay   indicated   that   overexpression   of   miR-512-3pcould   decrease   the   activity   of  RAC1   with   a  higher   efficiency   than   that   of
8639	   activity   via
8640	  has  beenshown  to  regulate  the  activity  of
8641	  can  form  a  complex  with  theadaptor  protein  NEDD9,  and  promote  mesenchymal  migration  byactivating
8642	  3(cid:3)-UTRsite  1
8643
8644
8645	  3(cid:3)-UTR  site  1
8646	  3(cid:3)-UTR  site  1
8647	  knockdown  by  siRNA  also  caused  thesimilar  effects  on
8648	  at  least  par-tially  through  its  ability  to  downregulate
8649	  was   also  shown  to  interact  with
8650	  could  activate
8651	  demonstratedthat  miR-512-3p  regulates  cell  adhesion,  migration  and  invasionvia
8652	  can  also  activate
8653	  through  targeting  both
8654	  (NCA-90)  and
8655	 group experiencedGrade 3
8656	 (gradeP2) in the PT group was somewhat higher than in the
8657	 is identified as a regulator of
8658	 through Ets-mediated transactivation of
8659	 was not asso-ciated with the types of the IIRPCs patterns,
8660	 level with sex, age,pattern, histology, smoking history or
8661	 tyrosine kinase inhibitors gefitinib/erlotinib and to
8662	-rearranged NSCLC not previously treated with an ALK inhibitor, two patients had a confirmed
8663	  inhibitors, eight  (53%)  had
8664	 and
8665	 activates the receptor
8666	 mutations, EML-4ALK fusions, 2%
8667	 ¼ epidermal growth factor;
8668	 ¼ epidermal growth factor receptor; EURTAC ¼ European erlotinib versus chemotherapy;G ¼ gefitinib; Ge ¼ gemcitabine; I-PASS ¼ Iressa Pan Asia study; NEJSG ¼ North-East Japan study group; NSCLC ¼ non-small-cell lung cancer; OPTIMAL ¼Erlotinib versus chemotherapy as first-line treatment for patients with advanced EGFR mutation-positive NSCLC;
8669	 and
8670	 and
8671	 and NF-kB signalling modulate dependence of lung cancers onmutant
8672	 polymorphism detection, genomic
8673	 mutations and
8674	 genotypes, sex differences, smokingstatus, and
8675	 mutations might representa unique subpopulation in lung cancer, we also investigatedwhether
8676	 amongpatients with wild-type or mutant
8677	 generearrangement status and
8678	 and
8679	 mutation and loss of
8680	 Z odds ratio;
8681	 density and
8682	 and
8683	 and
8684	 and
8685	 or
8686	 and
8687	 and
8688	 and
8689	 and
8690	 were obviously increased inboth miR-141-overexpressing cell lines as a result of miR-141 tar-geted reduction of
8691	 and
8692	 and
8693	 and
8694	 and
8695	 or
8696	 and
8697	 and
8698	 and
8699	 and
8700	 and
8701	 and
8702	 30-UTR and
8703	 and
8704	 and
8705	 and
8706	 and
8707	 and
8708	 and
8709	 and
8710	 and
8711	 and/or
8712	 and PHLPP2, using
8713	 and
8714	 and
8715	 and
8716	 and
8717	 signal path-way,
8718	 and
8719	 and
8720	 and
8721	 and
8722	 and
8723	 and
8724	 of 1, 5-linked arabinose or
8725	 was subjected to PCR amplification using primers designed to detect deletion site (2903 bp) in intron 2 of the
8726	 MutationValidation between Blood Samples and FFPE SlidesWe confirmed the validity between blood samples (leu-kocyte
8727	 amplification leads to  gefitinib  resistance  in  lung  cancer  by  activating
8728	  amplification  occurs  with or  without  T790M  mutations  in
8729	  (Bim)  and
8730	 or
8731	 homolog, interacts withNADPH oxidase,
8732	 and P27, were also regulated by
8733	 and P27 were determined by real-time PCR (B) and Western blot (C) inA549 cells transfected with empty vector (EV) or
8734	 and P27 in A549cells transfected with siRNA oligos targeting
8735	 and
8736	 or
8737	 gene10  and
8738	 mutant,
8739	  gene  were  independent  pre-dictor  for
8740	  in  patients  carrying
8741	 mutant lung adenocarcinomas, the
8742	  inhibitor, overcame
8743	 and
8744	 tyrosine kinase (
8745	 mutated tumorsMarch 2015March 2013April 2015October 2013Induction, chemoradiation and consolidationwith erlotinib in patients with known EGFRmutation statusErlotinib with radiationChemoradiation with panitumumab (cetuximabarm closed)Erlotinib with radiationAbbreviations:
8746
8747
8748
8749	 kinase,
8750	1/2 byFR180204, a selective ERK inhibitor, antagonizes down-regulationof Ecaherin and cell migration induced by EML4-ALK, whereasinhibiton of
8751	 and
8752	 has also been postulated as a predictor of responseto
8753	 levels were measured in NSCLC patientsharboring
8754	 levels mayinfluence
8755	 TKI be prescribed in first or in second line? Themutagenic effect of chemotherapyAny randomized phase III trial in EGFR-mutant NSCLC patientswith EGFR TKI monotherapy has demonstrated an improvementin
8756	 benefit of sequential strategy with
8757	 kinasecauses drug resistance by increasing the affinity for
8758	 TKI resistance due to BIMpolymorphisms can be circumvented in combination with
8759	 and
8760	 and
8761	 30-UTR but not that ofMut 30-UTR of
8762	 or Mut
8763	  is  able  to  convert  androstenedione  toestrone  (E1)  –  weak  estrogen,  which  then  can  be  transformed  to  E2,the  most  biological  active  estrogen,  by
8764	  binds  to  estrogen-ER  complexes,  facilitating  their  translocation  to  the  nucleus,binding  to
8765	 had been quantified, the
8766	 in diagnosis and mon-itoring
8767	 and
8768	 or multiple PFSs from multi-ple treatments were provided in a single trial, pop-ulation size was reduced by dividing it by the numberof
8769	 ¼ epidermal growth factor receptor;
8770	 ofever-smokers was lower than that of never-smokers,with
8771	 thandid the male subgroup for both PFS and
8772
8773	 and
8774	  and
8775	  and
8776	 and
8777	 of the chest/abdomen and chest
8778	 or
8779	 mutation testing system, which is based on Mach–Zehnder Interferometer (MZI) sensor and isothermal solid-phase
8780	 amplifi-cation system for detection of
8781	 (L858R) gene inhuman genomic
8782	 (wild-type or mutant) and
8783	 amplification in a labelfree and real-time manner, either wild-type (CTG) or mutant pri-mer (CGG) of
8784	 extracted fromNCI-H1975 (L858R mutation) was tested, which has a single basedifference from the wild-type allele of
8785
8786	  value, ␭HU,  andNIC  were  determined  in  the
8787
8788	  and  PET/CT,  the  sensitivity␭HU  in  the
8789
8790	   (kg/m2)  (n  =  138)a±  SD Mean ECOG  PS0 1  2  3  Unknown Smoking  statusEx-smoker Smoker Non-smoker Number  of  pack/year  (n  =  104)aMean ±  SD Metastatic  or  locally  advanced  diseaseYes Histological  typeSquamous  cell  carcinoma Predominantly  squamous  cell  carcinoma StageIIIB IV  Metastatic  sites  (n  =  118)Lung Bone Brain Liver Lymph  nodes Adrenal Others
8791	   body  mass  index,  ECOG  Eastern  Cooperative  OncologyGroup,  PS  performance  status,
8792	 and
8793	 secondarymutation and
8794	 ¼ complete response;
8795	   C1236T-TT   and   the
8796	   C8092A,
8797	   C118T,
8798	  and
8799	  and
8800	  Asp312Asn
8801	  C1236T
8802	  rs50872  and
8803	  for
8804	  Asp312Asn  and
8805	  statusWild-type Mutated Unknown ResponseCR
8806	  Asp312Asn  and  the  TT  genotype  of
8807	  His46His  and
8808	  genotype  for
8809	   rs1805087-AG/GG  and
8810	   rs1470383,particularly  the
8811
8812	  rs50872-CC
8813	  and
8814	  C118T-Tallele  and
8815	  Asp312Asn  G-alelle,ABCB1  C1236T-TT  genotype  and
8816	  C1236T  polymorphism  on  toxicity  has  not  pre-viously  described,  although  the
8817	  His46His,
8818	   rs1470383,
8819	  vs  TT)  [15],  no  sig-nificant  association  was  found  for
8820	  rs238416,
8821	  vs
8822	  rs12621220  and These  results  suggested  that
8823	  rs238416,ERCC5  His46His,
8824	  C118T-Tallele  and
8825	  C1236T-TT  and  the
8826	  Lys751Gln,
8827	 major mutations, 12 patients with
8828	 mutation-positive patients, the order of BEV-containing regimen and TKI didnot influence on
8829	 mutations nor
8830	 mutations nor
8831	 mutations nor
8832	 mutations or
8833
8834	 mutations and 83 patients nottested for
8835	 group and
8836	 group, and 10 patients inthe
8837	 of the
8838	 group, 1 patient withan
8839	 mu-tations or
8840	 ob-served in the
8841	 and
8842	  in  patients  with  an  OS  eventbefore  the  trial  was  stopped,  and  thus  not  influenced  by  externalknowledge  of  treatment  assignment,  showed  a  lower
8843
8844	 and
8845	 mutation or
8846	 mutation,
8847	TA may also bepotentially improved through automated CT ROI definitionbased on the
8848	 molecular phenotype in non-lung cancer:
8849	 Radiogenomic characterizationof EGFR, K-RAS, and
8850	 mutation in both strategies were assumedto be the same as they all received CBDCA +
8851	 treatment and
8852	 is beter in PP arm than
8853	  may   be  characterized  as  an  atypical
8854	  genes  along  with ˇ-actin  housekeep-ing  gene  were  amplified  by  quantitative  reverse  transcriptionpolymerase  chain  reaction  (qRT-PCR)  using  the  TaqMan  chem-istry  (Thermo  Fisher,  Waltham,  MA,   USA)  on  the
8855	  mutations  andexpression  of  MAGE-A3  and
8856	  may   be  explained  by  the  effect  of  exposure  totobacco  smoke  on
8857	 inhibition synergizes with NQO1-targeting agents   in inducing apoptotic cell death in non-small cell lung   cancer cells LIU Hui-Ying 1,2, LI Qing-Ran 1, CHENG Xue-Fang 1, WANG Guang-Ji 1*,
8858	 which modulates several tumor suppressors such as p53 and
8859	 substrates Tanshione IIA  (TSA)  and  β-lapachone  (β-lap)  induced  a  rapid  depletion  of  NAD+  pool  but  adaptively  a  significant  upregulation  of
8860	 activity, and thereby the increased accumulation of acetylated
8861	 inhibition can synergize with
8862	 inhibition  may  synergize  with  TSA  and  β-lap  in  inducing apoptotic  cell  death  of  non-small  lung  cancer  cells,  thus providing  a  rationale  for  the  development  of  combination therapy  using  NAMPT  inhibitors  and
8863	  expression  is  adaptively  elevated  upon
8864	 substrates exposure induced a significant increase in
8865	 inhibition sensitizes cancer cells to
8866	 is deacetylated by
8867	 inhibitor FK866 on the cytotoxicity and apoptosis inducing effect of
8868	  targeting  agents’  anti-tumor  can  be affected  by  regulating  NAD+,  especially  by  regulating
8869	 inhibitor  FK866,  a  drug  in  several  phase  1/2  clinical  trials,   whose antitumor activity has been reported in a broad range of  malignancies,  to  facilitate  the  anti-tumor  effect  of
8870	,  TSA  and  β-lap  may  represent  NQO1 targeting  agents  which  arose  excessive
8871	  induced  cell apoptosis was characterized by excessive
8872	  and
8873	 substrates induced NAD+ depletion and
8874	  inhibitor  FK866  on
8875	 inhibitor FK866 on
8876	 controlling intracellular
8877	 pathway in the investigation of the  mechanism  of  cell  apoptosis induced  by
8878	  activity induced  by
8879	 predicts  pathological  complete  response to  neoadjuvant chemotherapy  in  breast  cancer  patients  treated  with
8880	 mutations, 12 of  15  (80%)  with
8881	  mutations  or
8882
8883	 in July 2009, in addition to routine mutational analysis of
8884	 when added to the ongoing standard characterization of
8885	 and
8886	  (exons  18–21),
8887	 mutational analysis; specimens were most frequently also tested for mutations in
8888	 mutations, 336  samples  (98%)  were  also  successfully  tested  for
8889	 mutations in 56 of 336 specimens (17%) , 79
8890	 and either
8891
8892	 and
8893	  exon  19  deletion  and  a
8894	 and either
8895	: 41, EGFR + PIK3CA: one,
8896	  muta-tions  and  crizotinib  for  patients  with
8897	  rearrangements, and
8898	  and
8899	  and
8900	 amplification, and
8901	 mutations or
8902	 amplification leads to  gefitinib  resistance  in  lung  cancer  by  activating
8903	 and
8904	  +
8905	   +
8906	 DDP   +  TXTDDP   +  NVB Chemotherapy  responseCR  +
8907	  of  the
8908	 Thymidine Kinase Inhibitors (EGFR-
8909	 Z not otherwise specified;
8910	 Z hazard ratio; NA Z not applicable;
8911
8912	 genotype was associated with a significant-ly better response to cisplatin–vinorelbine compared with the combined3435
8913	 genotype (8 patients) as compared to
8914	 and
8915	 or the
8916	 or the
8917
8918	 and
8919	 and
8920	  and
8921	 in multicovari-ate analyses were then tested for their association with
8922	 not being reached and with median
8923	, we then assessed  whether  the  factors  associated  with TTR  in  multi-covariate  Cox  models  were  also  associated  with
8924	 model, the
8925	 IX is regulated by site-specific
8926	 entering as apreoperative staging modality recently, increased number ofmediastinal lymph nodes dissection, and widespread use ofhigh-resolution
8927	 lysis buffer (Milli-pore) and sonicated until
8928	 CpG methylation are in-volved with the regulation of expression of the
8929	 inhibitorTable 2 – Primers and cycling conditions for
8930	 expression by
8931	 methyltransferase inhibition resulted inan elevation of EP1, while
8932	   and
8933	   is  silenced   throughpromoter   methylation   in   lung   cancer   and   whether   this   methylation   is   associated   with   LOH   of   the   MCClocus   or   methylation   of   the
8934	   genedoes  not   extend   to  the   neighbouring
8935	   gene  was  discovered  during  the  search  for  the
8936	  and
8937	   is  silenced  through  promoter  methy-lation  in  lung  cancers  and  whether  this  methylation  is  associatedwith  LOH  in  the  MCC   locus  or  methylation  of  the
8938	  and
8939	  methylation  and  the  internal  reference  gene
8940	  between  APC  and
8941	  promoter  methylation  is  rare  in  NSCLCMCC  and
8942	  methylation  (39%)  and  one  of  themalso  showed
8943	   and
8944	   and
8945	   met
8946	   and
8947	 D5S346 INT10 D5S656
8948	  in  differentiation  [27],epithelial  cell  migration  [28,29],
8949	  methylation  and
8950	  and
8951	 and the med-ian PFS of the experimental arm; the median OS of the control armwas estimated as the sum of the median PFS of the control armplus SPP; assuming an exponential survival distribution the
8952	 patients [49] the
8953	  Non-squamous:
8954	 data were pooled, the esti-mated
8955	 relative improvements among the three‘big killers’ it could be informative to rank the
8956	 popula-tion; in MCRC, the
8957	 Z bromodomain and extraterminal;
8958	 to cisplatin adductformation and/or impaired function of
8959	 inhibitors alter
8960	 frequencieswere similar in both cell types, ranging from 0 to 10 per1000
8961	 assay is that the level ofcytogenetic damage can be analyzed in relation to the cellcycle phase during which the
8962	 by locali-zation of TIP60 to sites of
8963	 family, whereHDAC1, HDAC2, and
8964	i185in TICs than in bulk cells with HDAC inhibitors and/or thatthe
8965	 damageresponse analyses on DNA-PKcs and
8966	 signaling facilitatesrepair of
8967	 and
8968
8969	 0 to 3 were groupedas low
8970	 4 to 12 were grouped as high
8971	 expression level in cancer cells correlatedwith intratumoral
8972	 immunoreactivity and intratu-moral
8973	 and
8974	 showedapproximately significant effect on overall survival in theSQCC subgroup and had a higher
8975	 and
8976	 expression in cancer cells significantlycorrelated with intratumoral
8977	 expression in cancer cells significantly correlated with intratumoral
8978	 was counted by
8979	 immunoreactivity in cancer cells and intratumoral
8980	 expression and
8981	 tyrosine kinase inhibitors in NSCLC cell lines through de-repression of
8982	   and
8983
8984	  and
8985	   expression  correlated  to  that  ofHIF1␣  and  VEGFa,  whereas
8986	  and
8987	  and
8988	  and
8989	  – neuroglobin,
8990	  (B),  HIF1␣  (C),
8991	  was  markedly  induced  after  hypoxia  and  DFXtreatment  only  in  HTB182,  while
8992	   or
8993	  and
8994	   and  to  a  lesser  degree,  after  adjustment  for  pro-moter  methylation,  with
8995	  and
8996	  and
8997	   expressionwas  independent  of  HIF1␣  expression  in  these  studies,  low  level  ofassociation  was  observed  between  MB  and  other  hypoxia  markers,including  HIF2␣,  CAIX,  prolyl  hydroxylase  2  and
8998	  expression  is  under  epigenetic  control  and  con-firmed  NGB  and
8999	  and
9000	  mis-match  repair  protein
9001	 and
9002	 (cDNA) of human
9003	 and miR-137expressions was carried out using a miScript SYBR Green PCR Kit(Qiagen USA) on an
9004	 and U6 small nuclear RNA (snRNA) expressionswere served as loading controls for
9005	 or
9006	 and
9007	 and
9008	 and
9009	 and
9010	 (5%)(RTOG)7 GII (23%)5 GIII (16%)Kong [28] 109 patientsDonato [36]32 patientsBral [30]40 patientsAdkison [27]46 patients(RTOG/EORTC)11 GIII–IV (14%)1 fatal lung haemorrhage(SWOG)9 GI
9011	 = prescribed dose, $ = paper does not differentiate between acute and late toxicity, VXgy = % volume receiving X dose,
9012	 = prescribed dose, $ = paper does not differentiate between acute and late toxicity, VXgy = % volume receiving X dose,
9013	 were amplified fromgenomic
9014	 is known as a tyrosine kinase that is activated as analternative pathway after resistance to
9015	 in melanomacells resistant to
9016	) PAthScan Showed Wild-Type EGFR and Increased Total METExpression in Gefitinib-Resistant Cell Lines Compared With Parental PC-9Jae Joon Han et alAbbreviation:
9017	 ¼ extracellular signal-regulated kinase;
9018	 or
9019	   activity   and   histone   acetylationstatus,   and
9020	   activity,   increased   histoneacetylation   status,   and   inhibited
9021	  inhibiting  drugs  with  epige-netic  therapies,  such  as
9022	  inhibition  on  protein  targets  relevant  to
9023	  activity  and  increased  histone  acetylation,  andmay   also  inhibit
9024	 = hazard ratio, PS = performance status,
9025
9026	 and
9027	 METASTASES IN NSCLCAnn Thorac Surg2017;104:1153–60nodal metastasis developed in 14% (24 of 169) of thosewith
9028	 family in
9029	 stabilizes
9030	 and
9031	 NSCLCthe
9032	 in
9033
9034
9035	 mutated NSCLC No prior therapyNewly diagnosed Stage IIIB/IV NSCLCEGFR mutated NSCLCEGFR mutated NSCLCEGFR mutated NSCLCPretreated EGFR mutant NSCLCAdvanced squamous NSCLCEGFR TKI treatment-naive, advancedNSCLCEGFR mutated NSCLCNSCLC with progression after EGFR TKIharbouring T790MNSCLC with progression after EGFR TKIharbouring T790MLung Cancer 115 (2018) 12–20Primary outcomePFSSafety and tolerabilityToxicityPFSRecommended phase II dose8-Week Disease control rateMaximum tolerated doseObjective ResponseRecommended phase II doseErlotinib versus nivolumab and erlotinibNivolumab and erlotinibNivolumab and erlotinib Ipilimumab and erlotinibNivolumab and nazartinibPembrolizumab and gefitinib Pembrolizumab anderlotinibPembrolizumab and erlotinibPembrolizumab and afatinibPembrolizumab and afatinibAtezolizumab and erlotinibDurvalumab and gefitinibDurvalumab and osimertinib versus osimertinibSafety and tolerabilitySafety and tolerabilityDurvalumab and osimertinibSafety and TolerabilityGefitinib with a switch to durvalumab AZD9291 with aswitch to durvalumabConfirmed
9036	 mutations and
9037	 (durvalumab) a human IgG1 anti-programmed celldeath-ligand-1 antibody, combined with gefitinib: a phase I expansion in TKI-naivepatients with
9038	 synthesis and repair includingthymidylate synthase (TS), BRCA1, ECCR1, RAP80, and the proto-oncogene,
9039	 wt
9040	 PCR,We also evaluated the concordance indetecting of
9041	 amonglines of treatment, histology and
9042	 ¼ hazard ratio; LRPFS ¼ locoregional progression-free survival;
9043	 ¼ hazard ratio; KPS ¼ Karnofskyperformance status score; LRPFS ¼ locoregional progression-free survival;
9044	 is significantly associated withpoor
9045	The GPS was computed on the basis of serum con-centrations of
9046	 was an independent prognostic factor forboth RFS and
9047	 was shown to be a significantindependent predictor of RFS and
9048	  and
9049	 Mediates Cisplatin-Induced Elevation ofAnti-Apoptotic MoleculesTo identify the underlying mechanism that induces overexpression ofthe antiapoptotic protein family, NSCLC cell lines, A549 and H460,were treated with various doses and times of cisplatin and thephosphorylation of JNK and
9050	 activation, the effect of
9051	 was relayedto phosphorylation of
9052	 and
9053	 is one of key downstream mediatorsof activated
9054	  rearrangement  or  an
9055	  was  associated with decreased levels of phosphorylated
9056	  in  the  modulation  of
9057	 also was improved with erlotinib versus placebo in the
9058	 outcomes for the placebo group demonstrates that high
9059	  wild-type  population found similar results for PFS and
9060	  expression  above  the  median  appears  to  be  a  nega-tive prognostic factor for
9061	 expression above the median may be a positive predic-tive factor for erlotinib treatment, regardless of
9062	 expression is indeed independent of
9063	 and
9064	 and
9065	 and
9066	 90095c Center of Excellence in Molecular Genetics of Cancer and Human Diseases, Chulalongkorn University, Bangkok 10330, ThailandA R T I C L
9067	 expression was also reported to correlate with
9068	 construct (pHAGE-PR-B, pHAGE-PR-BΔSH3 or pHAGE-GFP), and X-tremeGENE
9069	 construct : psPAX2 : pMD2Gwas 1:2:1, and the ratio of the DNA construct : X-tremeGENE
9070	 and the
9071	 and is sen-sitive to EGF-mediated cell proliferation [41], thereby allowing usto explore a crosstalk between
9072	 expression normalized with
9073	 expressionnormalized with
9074	 is required for PR-mediated inhibition of NSCLC cellproliferation in the absence and presence of progestinThe growth of NSCLC cells such as A549 cells is often dependentupon the activation of the
9075	 expression normalized with
9076
9077	 may compete with otherPPD-SH3 interactions that are important for intracellular signal trans-duction and the trafficking of
9078	 PPD and mediate PR inhibition of
9079	 PPD mediated progestin-dependent activation of c-Src and its downstream
9080	 activation by increasing
9081	 PPD, a PXXPXRmotif, as a crucial PR domain required for PR-mediated inhibitionof NSCLC growth and
9082	  levels  and  inhibitnecrotic  cell  death  in
9083	  executes  the  necroptosisinduced  by
9084	 and/or
9085	   group   and   69  inthe
9086	   mutant   tumors   had   a  lower   DCR   after   the   first-line   platinum-based   CT,   but   this   dif-ference   did   not  translate   in   PFS   or
9087	  and
9088	  rearrangements  [5,6],  other  “actionable”molecular  mutations  may   be  explored  and  used  to  select  targetedtherapies  such  as  amplification  of  HER2,
9089	  mutations  are  usually  mutually  exclusive  withEGFR  mutation  and
9090	  and
9091	   amplification;
9092	  and
9093	  translocations  and  HER2,
9094	   and
9095	  in  patientstreated  by  platinum-based
9096
9097	   group  (mutated
9098	  group,  36%of  patients  received  only  one  line  of  chemotherapy,  28%  receivedonly  two   lines,  and  33%  more  than  two   lines,  compared  with  22,22  and  55%  in  the
9099	   and
9100	  mutation(N  =  39),  N  (%)KRAS  wild  type(N  =  69),  N  (%)Chi2 testMUT   group(N  =  39),  numberof  patients  (%)WT  group(N  =  69),  numberof  patients  (%)Number  of  lines1 2  ≥3  Data  missingaFirst-line  treatmentBi-
9101	  tyrosin-kinaseinhibitors  (TKIs)  of  tumor  harboring
9102	  for
9103	  for  codon  13
9104	   and
9105	   cohort  does  not  allow  to  analyzethe  impact  of  the  numerous  different
9106	  mutated  tumors  respect  to
9107	  and
9108	  on  clinical  outcome  of
9109
9110	 proteins dissociate from theorigin, and this prevents a second round of
9111	 in lung can-cer [15–18], there have been no reports determining relevance of
9112	 in lungcancer [15–18], there have been no reports determining relevanceof
9113	 knockdown in H1299and A549 cells is expected based on its essential role in
9114	 LIs and Ki-67 LIsand the significantly higher MCM4 LIs than Ki-67 LIs in the presentstudy are consistent with the results of
9115
9116	 expression in tumors and male gender,smoking, non-adenocarcinoma histology, more poorly differenti-ated tumors and advanced pT classification agree with previousreports showing that high
9117
9118	 replication to onceper cell cycle: the role of Cdc6p and
9119	 proteins in
9120	 complex: its role in
9121	 and Axin relative to an internal control
9122	 on the changes of GSK-3β,
9123	 arm the median
9124	 and R8-PLD at a Dox concentration of100 lM for 1 h or 4 h, washed with PBS and viewed with a Zeiss
9125	 was more abundant in SCC compared with AC,whereas the reverse was true for
9126	 and
9127	 and
9128
9129	 and
9130	DUSP6EGFRERBB3STAT1LCKMMDAbbreviations: AC ¼ adenocarcinoma; CSF1 ¼ colony stimulating factor for macrophages;
9131	 and
9132
9133	 in ACmay reflect the presence of alternative activating aberrations in AC, eg,mutations in EGFR, BRAF, or
9134	 correlated with shorter MFSand
9135	 and
9136	DUSP6EGFRERBB3STAT1LCK
9137	DUSP6EGFRERBB3STAT1LCKMMDAbbreviations: AC ¼ adenocarcinoma; CSF1 ¼ colony stimulating factor for macrophages;
9138	 inhibitors may sensitize some tumor cells to conven-tional
9139	 was non-significantly higherfor patients with wild-type versus mutant
9140	 in patients with wild-type
9141	 mimetic smallmolecule that inhibits V
9142
9143	 rate of 18%, median
9144	 rate was 13%, median
9145	 exon 19 deletion mutations were detected in two pa-tients with PRs and a
9146	 amplification has been documented in NSCLC,especially after treatment with
9147	 mutation who initially respond well to an oralEGFR inhibitor are found to have a c-Met mutation, and it is cur-rently believed that this mutation contributes to ‘‘acquired resis-tance’’ to these agents when patients progress over time bydriving
9148	 and
9149	 mutation, and 13% were positive for
9150	 for PFS and
9151	 was not observed in other sub-groups, including nonsquamous,
9152	 system shares significant crosstalk with the
9153
9154
9155	 andthe
9156	 mutation status may be predictiveof outcome with panobinostat and possibly other
9157	 inhibition results in loss ofHsp90 chaperone function and enhanced degradation of BCR-ABL,human epidermal growth factor receptor 2/neu, and
9158	 inhibitorswith
9159	 deacet-ylates Hsp90; small interfering RNA-mediated depletion of HDAC6induces Hsp90 acetylation, inhibiting its binding to
9160	 groups were below the targetORR of 20%, among the three patients with an
9161	 TKI treatment, although prolonged responsesand PFS were observed among patients with
9162	 amplifications occurs with or withoutT790M mutations in
9163	   inhibitor   following   crizotinib,median
9164	   was  poor   among   patients   who   did   not   receive   a  second-generation
9165	  inhibitor  at  any  time  after  dis-continuing  crizotinib  (n  =  98),  median
9166	  inhibitor  in  theline  following  crizotinib  discontinuation  (n  =  32),  median
9167	  staining  assays,  which  are  based  on  the  principle  that  apop- totic cells, among their other typical features, are characterized by
9168	 TGG AAT TGA
9169
9170	 scan or bonescan, and
9171	 scans of the chest and abdomen; repeat
9172	 or
9173
9174	 (a total of 1707 and 1772 patients who didand did not receive CCT following conRCT, respectively) failed to de-monstrate survival benefit related to the addition of CCT (median
9175	 staging may have been initially beyond curativemeasures [60], thus diluting potential benefit from
9176	 mutation and
9177	 (from 2010) and
9178	 between positive and
9179	 patients for
9180
9181	 analysis at the National Cancer CentreSingapore (NCCS) and Singapore General Hospital (SGH) in 2010and added
9182	 or
9183	 analysisand 405 patients for the
9184	 underwent PCR amplification forEGFR exons 18, 19, 20 and 21 [10,11] and the products were ana-lysed by direct sequencing with
9185	 analysis and
9186	 and
9187	 positive group had more lines ofpalliative treatment than the ALK wild type group, there was nosignificant difference in
9188	 and
9189	 positivityand improved survival, although this was not so for
9190	 and
9191	 and
9192	 of the
9193	 and
9194	 and HOXA11) and one target
9195	 methylation anddeletions at the oligodendrocyte transcription factor 1(
9196	 forward, 50-CAG CCA ACTGGC
9197	 methylation,and have shown that in 96% of all cases of lung tumor pa-tients, the
9198	 promoter has been reported toexhibit high levels of
9199	 promotes breast tumor cell differen-tiation and inhibits cancer progression by directly regulat-ing expression of tumor suppressor gene
9200	 and HOXC9,but not p16INK4A, DAPK1,
9201	 gene amplification and
9202	 and
9203	  were  used  for  immunoprecipi-tation  and  Western  blotting:  a  rabbit  polyclonal  antibody  againstthe  C-terminal  intracellular  domain  (anti-EGFR(CT))  (Santa  CruzBiotechnology;  Milan,  Italy);  a  goat  polyclonal  antibody  againstthe  N-terminal  EGFR
9204	  indicates  A549  CL  (30
9205
9206
9207	 Rearrangements inNever-smokers With NoneSmall-cell LungCancer: Analyses From a ProspectiveMultinational
9208	 mutations in patients with
9209	 and activating
9210	 and
9211	 and
9212	 exposure wasclosely associated with
9213	 and
9214	 gene rearrangements,
9215	 (cETS) exposure andthe occurrence of
9216	 questionnaireidentical to our previous study in Japan9 and performed a multi-national cETS study in an attempt to quantify the amount of cETSin never-smokers with
9217	 Questionnaireand Had Tumor Samples for
9218	 ¼ anaplastic lymphoma kinase; cETS ¼ cumulative environmental tobaccosmoke;
9219	 Mutation and
9220	 rearrangement oractivating
9221	 MutationsTable 2 Comparison of Clinical and Molecular Characteristicsof Patients With or Without c
9222	 ¼ environmentalMultivariate analysis on activating
9223	538 -Clinical Lung CancerSeptember 2017Total (N ¼ 498)Activating EGFR mutationsExposure periodChildhood (19 y or younger)Adulthood (20 y or older)Exposure placeHouseholdWorkplaceALK rearrangementsExposure periodChildhood (19 y or younger)Adulthood (20 y or older)Exposure placeHouseholdWorkplaceFemale (N ¼ 384)Activating EGFR mutationsExposure periodChildhood (19 y or younger)Adulthood (20 y or older)Exposure placeHouseholdWorkplaceALK rearrangementsExposure periodChildhood (19 y or younger)Adulthood (20 y or older)Exposure placeHouseholdWorkplaceMale (N ¼ 114)Activating EGFR mutationsExposure periodChildhood (19 y or younger)Adulthood (20 y or older)Exposure placeHouseholdWorkplaceALK rearrangementsExposure periodChildhood (19 y or younger)Adulthood (20 y or older)Exposure placeHouseholdWorkplaceOR95%
9224	 ¼ anaplasticinterval;EGFR ¼ epidermal growth factor receptor;
9225	 Mutations in Total (A),Female (B), and Male (C) Never-smokers and
9226
9227	 Exposure and Association With EGFRMutations and
9228	 rearrangement,there was no significant association with the period of
9229	 for
9230	 gene rearrangement in either female or malenever-smokers with an
9231
9232	 ¼ anaplastic lymphoma kinase; cETS ¼ cumulative environmental tobaccosmoke; CI ¼ confidence interval;
9233	 expo-sure and
9234	 was observed with an
9235	 and
9236	 muta-tions and
9237	 is regarded as a potential cause of these genealterations, conflicting results on association between ETSexposure and
9238	 mutations for each 10-yearincrement in cumulative
9239	 mutation þ stage IV NSCLCProgression on EGFR TKISingle arm phase IIEGFR mutation þ stage IV NSCLCGood partial response to first-line TKI 4
9240
9241	  and
9242	 and
9243	34015Clinical FactorsLymphovascularinvasion, invasivepatternHigh stage, invasivepattern, node(þ),distant metastasisIB stage,lymphovascularinvasion, pleuralinvasion, solidnodules on CTMicropapillarycomponentInvasive patternSolid component,vascular invasion,pleural invasion,node(þ)nodal metastasis,high stage,precence ofmicropapillary orcribriformcomponent,lymphovascularinvasionInvasive pattern,pleural invasion,tumor size,SUVmax,consolidation/tumorratioHigh stage,node(þ), tumorbuddingHigh stage,lymphovascularinvasion, tumorsize, necrosis,nuclear diameterLymphovascularinvasionPrognosisRR[ (limitedresection group)
9244
9245	  and
9246	 and
9247	 is a sequence-specific zinc finger repressor and has threeknown functional regions, the N-terminal BTB/POZ domain, the centralregion and the C-terminal
9248	 isfrequently inactivated by
9249	 repairpathway and transcriptional regulation by
9250	 and
9251	 repairpathway and transcriptional regulation by
9252	 co-operated with p53 and played a vital role in inducing chromosomalinstability in
9253	 as upregulated targets by lossof
9254	 is a member of the metalloprotease large family andepigenetically inactivated in breast cancer through blocking EGFR- andTGFβ1/TβR(I/II)-activated
9255	 and
9256	 (hypermethylated in cancer 1)SUMOylation is dispensable for
9257	 (Hypermethylated in Cancer 1) inthe
9258	 and
9259	 ¼ hazard ratio; ORR ¼ overall response rate;
9260	 and KRASmutations in non-small cell lung carcinomas using
9261	 versus WT/WT,respectively) compared with
9262	 scan were independent pre-dictors of
9263	 mutations were analyzed inthe unpaired tStatistical AnalysisClinical and pathologic findings,
9264	 rearrangement and
9265	 rearrangement and
9266	 Rearrangement and
9267
9268	 mutations are frequentlyassociated with adenocarcinoma with lepidic growthpattern that commonly manifests as GGO-dominantlesion on
9269
9270	 rear-rangementthan in patients with
9271	 and
9272	 molecularphenotype in non-small cell lung cancer:
9273	 (A) and
9274	 and
9275	/
9276	 or
9277	 (also known as erb-B1 or HER1) isoverexpressed in most NSCLC, and
9278	 competi-tive inhibitors of the
9279	 copy number, response to gefitinibcorrelated with
9280
9281	 as first-line treat-ment, has a total P/S of 232 for
9282	  alone,  her  P/S would be 25 for
9283	 in our model, with an
9284	  histology  had  a  poorer  survival  compared  with  those with AC or AC with lepidic pattern suptype, with an
9285	B, treatment with PC alone correlated with an
9286	   =  net  monetary  benefit;  QALY  =  quality-adjusted  life  year;  all  QALYs  were  monetized  by  assuming  the  value  of  a  QALY  is  $150,000
9287	   =  net  monetary  benefit;  QALY  =  quality-adjusted  life  year;  all  monetary  values  in  2016
9288	   amplification  and  activatingmutations  in  KRAS,
9289	   and
9290	   and
9291
9292	  mutations  on  NSCLCare  non-V600  has  direct  therapeutic  implications,  since  non-V600mutant  B-Raf  kinases  are  resistant  to  B-Raf  inhibitors,  but  they  maybe  sensitive  to
9293	   inhibitors  concomitantly  with
9294	  pathway  downstream  to
9295	   and  B-Rafinhibitors  reduced  dramatically  the  incidence  of  second  cutaneoustumors  in  melanoma  patients,  by  blocking
9296	  kinase  inhibitor,  demonstrated  noinhibitory  effect  on
9297	  or  MEK,  tyrosine  kinase  inhibitors  generate  a  blockade  point  in
9298	  mutations,  activating
9299	   mutations,  activating
9300	  selective  inhibitorPan-RAF  inhibitorMutant  BRAF  selective  inhibitorMutant  BRAF  selective  inhibitorreducing  pMEK  and  blocking
9301	   inhibitors  theoreticallycan  be  effective  in  patients  harboring  B-Raf  non-V600  mutations,this  may   be  an  interesting  therapeutic  option  for  NSCLC  patientsharboring  non-V600
9302	   inhibitors  and  dual
9303	  inhibition  through
9304	  G12/13  mutations  inurine  cell-free  (cf)
9305	  inhibitors  mediated  by  a  RAFkinase  switch  in  melanoma  can  Be  overcome  by  cotargeting
9306
9307	 tyrosine kinase (
9308	 and
9309	 mutations have been found outside exonslarge-cell18e21, which encode part of the
9310
9311	-
9312	 amplification has been reported in almost20% of cases that carry
9313	 subse-quently leads to phosphorylation-mediated
9314	 isoform in humancancer is
9315	 mutations are refractory to
9316	 kinase, which is downstream of
9317	 (~50%),
9318	 mutations are moreor sclerosing BACscommonly found in the presence of
9319	 mutationepositive NSCLCtumors, and in 1 of the 4
9320	 are mutually exclusive to
9321	 mutations have alsobeen shown to be mutually exclusive to
9322	 and
9323	 inhibitor was recently shown toinhibit MEK activation resulting from somatic mutationof
9324	 mutations have been shown todemonstrate sensitivity to combinatorial
9325	 and
9326	 mutations are stronglyassociated with mucinous BAC subtypes of AD, whereasEGFR and
9327	 and
9328	 and
9329	 and related signalingpathway genes in lung adenocarcinomas identifies a novel somatickinase domain mutation in
9330	 and
9331	 and
9332	 amplification leads to gefitinib resistance in lungcancer by activating
9333	 amplified and
9334	 inhib-itor due to
9335	 inhibitorsthe fourThe
9336	 5 hazard ratio; LDH 5 lactate dehydrogenase;NLR 5 neutrophil–lymphocyte ratio;
9337	 in vitro and in vivo, which depends on a struc-turally intact
9338	 Requiresa Structurally Intact
9339	 domain isrequired for the tumor-suppressive activity of
9340	 ranging from 0 to 1218 was appliedto classify tumors (Figure 3A) as
9341	 mutant bearing a charge-relevantamino acid exchange within the
9342	 depends on the
9343	 in our experimental mod-els in vitro and in vivo, which depended on a structurallyintact
9344	 ¼ chemotherapy and radiation; CRS ¼ chemotherapy, radiation, surgery;
9345	  structures  have  a  unique  hingeregion  lacking  a  hydrogen  bond  donor,  suggesting  a  possibilityfor  the  development  of  specific  PIM1  kinase  inhibitors  that  targetthe
9346	  kinase  and  several  groupshave  reported  the  complex  crystal  structure  of  PIM1  with  a  numberof
9347
9348	  was  extracted  twice  from  the  beads␮l  of  elution  buffer  (1%
9349	  TCT  GAG  T-3’,  5’-CAG  GCT
9350	  inhibitors,  and  used  assubstrate  for  the  PIM1  kinase  assay  that  measures  [␥-32P]
9351	  inhibitors  and  irradiation,  HA-tagged  PRAS40
9352	  kinase-treated  and  untreatedradioresistant  cells,  A549  cells  were  transfected  with  a  luciferasereporter  plasmid  containing  the
9353	  inhibitor-treated  cells  were  more  sensitive  to  IR-mediated  cytoplasmichistone-associated
9354	  and
9355	  luciferase  reporter  gene  plasmid  and  wild  type  FLAG-tagged  FOXO3a  orFLAG-tagged  FOXO3a-3  M  mutant,  allowed  to  recover  for  24  h,  and  then  treated  with
9356	  fragmentation  in  NSCLC  cells±treated  with
9357	  by  two  distinct  binding  modeswhich  are
9358	  kinases  have  been  investigated  foreffects  of  casein  kinase  2  (CK2)  inhibition  as  dual  inhibitors  becauseof  relatively  similar
9359	 prevents cisplatin apoptosis througha
9360	 and
9361	  and
9362	  1236C>TC/C C/T  T/T  ABCB1  2677G>T  or  AG/G G/T   or  A T   or  A/Tor  A ABCB1  3435C>TC/C C/T  T/T
9363	  phenotyping  approach  to  predictsystemic  exposure  to
9364	   amplification  leads  togefitinib  resistance  in  lung  cancer  by  activating
9365	 and TP53genes in human lung cancer tumors detected by ion torrent
9366
9367	 TKIs, and most(Xalkori-triphosphate(ATP)-competitive
9368	 signalingCrizotinib (PF02341066)NCT00932893Open-label trial of monotherapy versus investigator choice ofdocetaxel or pemetrexed as second-line therapy after 1 platinum-based chemotherapy regimen in patients with
9369	 and
9370	 and
9371	 Adenosquamous  carcinoma Smoking  historyCurrent  or  former Type  of  surgeryLobectomy Pneumonectomy Bilobectomy Disease  stageIA IB IIA IIB  T  stageT1 T2 T3 N   stageN0 N1 Nuclear
9372	  with  an
9373	  from  the  plasma  membrane  to  thenucleus  include  phosphorylation  of  the  dimerized  receptor  bySRC  family  kinases  and
9374	  associates  with  STAT3,  STAT5  and
9375	  with  mutations  that  impairnuclear  transport  demonstrated  reduced  repair  of
9376	  by  co-exposing  cellsto  either  dasatinib,  a
9377	  and
9378	  nuclear  translocation  mod-ulates
9379	 mediates PI3K/Akt and
9380	 onghrelin-induced PI3K/Akt and
9381	 reduced ghrelin-induced phosphorylation ofPI3K/Akt and
9382
9383
9384	 repair and replication pathways,including POLD1, BRCA2,
9385	 expression of immunosuppressive protein
9386	 and prognostic importanceof
9387	  (%)
9388	  forms  a  heterodimer  with  XPF  which  acts  as5(cid:3)-endonuclease  and  executes  the  5(cid:3)-excision  in  the
9389	  mutatedtumors),  cisplatin  plus  pemetrexed  (EGFR  wild-type,
9390	 p27  p53  Bax
9391	  repair  and  synthesisERCC1  [9]Negative Positive
9392	  expres-sion,  alone  or  combined  with
9393	  controls  substrate  specificity  andenzyme  activity,  whereas
9394	  and
9395	  orlow
9396	The  RAS  proteins  HRAS,
9397	  muta-tions  are  located  in  the
9398
9399	)EGFR-
9400	  gene  expressions  but  not
9401	  repair  proteins  MLH1,
9402	 (Phospho-Ser221), and the down-regulations of
9403	 experience within subgroups defined  by
9404	  SUVmax  as  a  continuous  variable  on
9405	  and
9406	 images were then acquired from skull base to mid thighs,  using  the  following  scanners:  a  GE  Discovery
9407	 images were reviewed along  with  the
9408	  SUVmax  (uncategorized)  and TTR, as well as
9409	 and
9410	  SUVmax  (uncat-egorized) has a significant association with
9411	 within each of four patient groups defined by quartiles of the distribution of
9412	 SUVmax and survival, as well as between PET SUVmax and
9413	 SUVmax and survival, and between SUVmax and
9414	 SUVmax  of  stage  I  NSCLC  at  diagnosis  is  predictive  of survival and
9415	  –  Pacific  Islander;  SES  –  socio-economic  status;  BAC  –  bronchoalveolar  carcinoma;
9416	  mutation  biomarker  and  the only  FDA-approved  biomarker  in  this  disease  being  the
9417	 1rearrangement and
9418	 ¼ docetaxel; ECOG ¼ Eastern Cooperative Oncology Group;
9419	 (95% CI)Unstratified Log Rank P valueRAM and
9420	 (95% CI)Unstratified Log Rank P valueRAM and
9421	 (95% CI)Unstratified Log Rank P valueRAM and
9422	 ¼ hazard ratio; ITT ¼ intent to treat;
9423
9424	 (%): CR D
9425	 ¼ docetaxel; PL ¼ placebo; RAM ¼ ramucirumab;
9426	 ¼ docetaxel;
9427	 ¼ docetaxel;
9428	 induced by iMDKtreatment in H441 lung adenocarcinoma cellsIn the previous study, we demonstrated that iMDK suppressed thePI3K–AKT pathway (12 h after treatment) while inducing theMAPK pathway (48 h after treatment), as detected by the phos-phorylation of ERK (MAPK), in H441 lung adenocarcinoma cellsthat carry a
9429	 inhibitorPD0325901 cooperatively suppressed the growth of NSCLC cellsregardless of
9430	 mutation uncouples tumor growth and cyclinD1 regulation from MEK/ERK and mutant
9431	 inhibitorsto treat mutant Kras G12D and
9432	  drug-sensitive mutation  (SM)  or  absence  of
9433	 gene mutation in their tumor-DNA, and for the other 14 cases, TKI therapy was initi-ated without the benefit of EGFR or
9434	  gene  were  amplified  individu-ally  using  one-tenth  volume  of
9435	 together with 100,000 copies of wt
9436	 from 300-ng total genomic
9437	 and four (44%) had T790M detectable in plasma, eight had persistence of the initial SM whereas one was negative for
9438	 normally present in genomic
9439	 and
9440	 and
9441	 mutations in plasma
9442
9443	  T790  M,
9444	 repair pathwayswere identified, along with DACH1, CFTR, RELN,ABCB5, and
9445	) tyrosinekinase (
9446	 (D594N and V413L),
9447	 mutations validated in our cohort werepresent in the founder clones of the associated tumor samplesthe
9448	 mutations are initiating events for lung cancer, andother mutations such as
9449	 and
9450	 and
9451	 and
9452	 &
9453	 and
9454	 and
9455	 fusions) and smokers (KRAS, TP53, BRAF,JAK2, and
9456	 repairpathway lesions may confer unusual susceptibility of cancercells to
9457	 and
9458	 group for developing tools and softwareto manage samples and sequencing, and the Systems group for providing theIT infrastructure and
9459	 and
9460	 rearrange-ments with
9461	 (95% CI)ORR (CR +
9462	 in synchronous
9463	 was the strongest predictor for PFS and
9464	 may derive a similarbenefit from
9465	 or MRI, *** EBUS-staging or mediastinoscopy, # Not included for PS matching,
9466	 significantly discriminatedfor
9467	 having either received
9468	 andconsecutively derive a further benefit from
9469	 to the standard of care improves PFS and
9470	 TKI treatmentand (2)
9471	 repair by
9472	 and itsreceptor
9473	 and
9474	 functions through
9475	 guided biopsy confirmed a left upper lobeadenocarcinoma, T4 N3 M1b, with
9476
9477	 - such as T790M mutation withinexon 20, by bypass tracks arising from
9478	 and
9479	 damage pathways includ-ing
9480	 mutations are common among non-smokers, adenocarcinoma, female and South East Asian patientsSquamous NSCLCNon-squamous NSCLC with no ‘identifiable’ mutationNon-squamous NSCLC with EGFR mutationNon-squamous NSCLC with
9481
9482	 tyrosine kinase inhibitor, with IGF-1 kinase inhibitory propertiesNintedinibC Multi-targeted tyrosine kinase inhibitor, including inhibitor of VEGFR, PDGFR and
9483	 break-positive and displayed
9484	-IHC status  of  every  case  had  to  be  reported  as  negative  or  posi-tive  (binary  interpretation)  using  the  ALK  (D5F3)  Rabbit Monoclonal Primary Antibody combined with the OptiView
9485	  IHC  detection and  OptiView Amplification  kits  can  be  regarded  as  a  reli-able multicenter technique for the detection of
9486	 and
9487	-
9488	  and
9489	  at  7  years  follow-up:
9490	  [5]IALT  [3]BLT  [6] CALGB9633  [7] BR10  [8] ANITA  [10] N 1209 1867 381 344 482 840 Stage I–IIIAI–IIIA I–IIIA IB IB–II I–IIIA Chemotherapy
9491	  at  7  years  follow-up:
9492
9493	-mutant   patients),   those   with   EGFR   mutanttumors  had   a   higher
9494	   mutation   status,
9495	  repair  by
9496	  isoform  expres-sion  and
9497	 to
9498	 to
9499	 have been yet reported, which couldbe grouped in four main categories: first, the presence of secondarymutations in
9500	 kinases contributes to the proliferative activity of EGFR, whereas activation of
9501
9502
9503	 to
9504	 to
9505	 pocket of
9506	 TKI has a limited efficacy due to dosagelimitation related to the toxicity when
9507	 and
9508	 AMPLIFICATION
9509	 to
9510	 receptor inhibitor, an indolocarbazole compound, is alsounder investigation as potent and reversible inhibitor of EGFRT790M that spare
9511	 mutations and T790M and prelimin-ary results in a phase I trial (NCT 01526928) exhibits tumorshrinkage (29%) in EGFR-mutant tumors and
9512	 to
9513	 amplification and
9514	 oncogene has been reported inapproximately 5–22% of NSCLC patients with
9515	 was originally identified in the resistantHCC827 cell line, which harbours both the sensitive
9516	 to
9517	 amplification causes
9518	 and
9519	 amplification can occur with the
9520	 inhibitors have been designedfor TKI resistant
9521	 and
9522	 to
9523	 overexpressionMET activation by its ligand, hepatocyte growth factor (HGF),produced by stromal as well as tumor cells, also induces drug resis-tance to
9524	 T790M or METamplification,
9525	 expression, T790M muta-tion and
9526	 expression wassignificantly higher in tumors with
9527	 measured by immu-nohistochemistry had a prognostic value and those patients withweak HGF expression tended to have lower 5-year
9528	 and
9529	 to
9530
9531	-TKI (WZ4002) and a
9532	 mutations, showed thatthese transformed SCLC tumors express neuroendocrine markers,maintained the original EGFR-sensitizing mutation and respondto standard SCLC chemotherapy, but none demonstrated T790Mmutation or
9533	 inhihibitor, combined with erlotinib after progressionto chemotherapy, showed increased
9534	 and its down-stream effector STAT3, has alsobeen reported in resistant lung cancer cells with
9535	 receptor tyrosine ki-nase by overexpression or upregulation of its ligand GAS6, confersAR to
9536	 TKI resistant tumors show increased
9537	 to
9538	 and
9539	 was identi-fied in 5% of EGFR-mutant lung cancers that developed
9540	 to
9541	 activation, have a deficient homologousrecombinant
9542
9543	 amplification: HER2 is found to be amplified by FISH in12% of tumors with
9544	 amplification: MAPK1 amplification was described inapproximately 5% of clinical specimens from patients with
9545	 amplification were mutuallyexclusive with
9546	 inhibitors reverseresistance in tumors with
9547	 mutation: The RAS/RAF/MEK/MAPK signalling pathwaydownstream of
9548	 mutations were identified in 195 tumor samples (1%)with
9549	 mutation (V600E) coex-isted with T790M mutation and
9550	 is reported to be a critical mediator of onco-genic effects of
9551	 protein binds to another phosphory-lated STAT protein (dimerizes) and translocates into the cell nu-cleus, where it binds to
9552	 mutant gene: Loss of activating EGFR-mu-tant gene contributes to
9553	 to
9554	 to
9555	 TKI can lead to long-term survival in selectedEGFR-mutant patients with
9556	 positive patients treated with crizotinib (N = 38) and
9557	 to
9558	 mutated patients) aftergefitinib-failure, showed that platinum-based combination or tax-ane-containing regimen were associated with a higher RR andgemcitabine/platinum resulted in better
9559	 TKI con-tinuation with chemotherapy in a cohort of 78 EGFR-mutant pa-tients with
9560	 inhibitor;Dacomitinib: irreversible pan-HER inhibitor (HER-1, HER-2, HER-4 TK); CO-1686: irreversible inhibitor of
9561	 amplified resistant NSCLC cells but not in those harbour-ing T790M mutation, suggesting that an antifolate drug plus TKIcould be of interest in
9562	 to
9563	 to
9564	 to
9565	 kinasecauses drug resistance by increasing the affinity for
9566	 amplification leads togefitinib resistance in lung cancer by activating
9567	 inhibitor and
9568	 and
9569	 amplification: a potentialmechanism of acquired resistance to
9570	 signaling causesresistance to
9571	 inhibitors occasionally harbour
9572	 activates
9573	 mutations and
9574	 activity and phosphorylation levels of downstream signaling pathway proteins
9575	 (nEGFR) interacts with
9576	 (#4267), Lamin A/C (#2032), Tubulin (#2144),phospho-STAT3 (#9131), phospho-
9577
9578	 downstream pathway proteins: ERKand
9579	 upon NSC305787 treatment further validated depen-dency of the
9580	 and
9581	 and
9582
9583	 and of common EGFRdownstream target proteins,
9584	 [26,28], and recentstudies havedemonstrated that growth factors EGF, PDGF, and
9585	 and
9586	 nuclear translocationmodulates
9587	   and
9588	  and
9589	  gene  and
9590	  (exons  2–11),
9591	  and
9592	  and  at
9593	  mutation  in  NSCLC,  whereas  LKB1  and  KRAS  mutations  arerarely  found  in  tumors  with  an
9594	  and  RB1,EGFR  and  KRAS,  and
9595	-independent  manner  and  in  promotionof  cell  cycle  arrest  and  cell  death  in  a  TP53-dependent  manner  bydirect  phosphorylation  of  TP53  S15  by  the  LKB1  substrate  kinasesAMPK  and
9596	  mutation,  the  presence  of  concomi-tant  LKB1  and  TP53  alterations  was  not  significantly  associated  withclinicopathological  factors  including
9597	 and
9598
9599
9600	 and
9601	 and
9602	 andWISP2 and overexpression of
9603	 (A),
9604	 and
9605	 hasbeen previously shown to be a marker for premalignant lungcancer lesions and an independent predictor of lung cancermortality [33,34], there is no such data regarding
9606	 (Cetuximab)(cid:129) EGFR (Cetuximab)(cid:129) VEGF-A (Bevacizumab)(cid:129) VEGF-A (Bevacizumab)(cid:129) IGFR (Figitumumab)(cid:129) IGFR (Figitumumab)Tumor cells or lysatesTumor cells or lysates(cid:129) allogeneic or autologous(cid:129) allogeneic or autologous(cid:129) genetically – chemically modified(cid:129) genetically – chemically modifiedDendritic cells (from blood)Dendritic cells (from blood)(cid:129) pulsed (peptides – proteins - tumor lysate)(cid:129) pulsed (peptides – proteins - tumor lysate)(cid:129) transfected (RNA - c
9607
9608	 protein formulated with monophosphoryllipid A (MPL), a
9609	 (a
9610	 is another
9611	 is a target of particular interest inNSCLC as it was recently observed that high co-expressionof both IGF1R and
9612	 re-ceptors have been developed, acting at the catalytic site of thekinase and interfering with the activation of natural sub-strates or with
9613	 (most com-monly small in-frame deletions in exon 19 or an L858R amino-acid substitution)in increased EGF-inducedactivation and gefitinib-induced
9614	 re-ceptors other than
9615	 repair genes
9616	 and
9617	 (rs1051730, and in-cluded in this study) and
9618	, and there was no difference in OS between the treat-ment groups in patients with
9619	 and
9620	 or
9621	  exon  19  dele-tions, EGFR exon 20 insertions, and
9622	 and
9623	 and
9624	  and
9625	 status, n (%)
9626	  and
9627	  and
9628	 and
9629	 and
9630	 and
9631	 mutantcancers in an earlier phase 2 study of erlotinib plus the oral
9632	 alterations, specific therapy for
9633	 amplification is recognized as a key mechanism of primaryand secondary resistance to
9634	 function may relate toputative autocrine feedback loops through which transmembrane re-ceptors such as
9635	 and other oncogenic driver mutations,where co-occurrence in the same tumor is rare [18],
9636	 mutant cancers demonstratedparticular benefit from combination therapy (PFS
9637	 or
9638	 mutant cancersand promising findings of a subset analysis of an earlier trial of erlotinibplus tivantinib (a small molecule
9639	 inhibitors such as erlotinib and gefitinib are generallyconsidered to have minimal efficacy, and may even be detrimental, inpatients with
9640
9641	 and
9642	 amplification leads togefitinib resistance in lung cancer by activating
9643	 and
9644	 but patients who received erlotinib had longer
9645	 and
9646	 P3 months, the erlotinibgroup tended to have better
9647	 in allpatients; (B)
9648	 and
9649	 = time to treatment failure;
9650	 and
9651	 or
9652	 thanpatients who received gefitinib, but
9653	 wasnot parallel to
9654	  98059  is  an  inhibitor  of  the
9655	  and  BCL2L14,and  down-regulate  apoptosis  inhibitors,
9656	 damage is augmentedby inhibition of DNA damage repair processesParacrine cell signalling which switches onsurvival pathways is blocked leading to reducedcell survivalMalignant cell ability to cope with telomeredamage from radiotherapy is reducedRadiation-induced inflammation within thetumour is detected by activated T-cells, whichin turn leads to anti-tumour adaptive immuneresponseTherapeutic agent overcomes tumour cellability to avoid apoptosis followingradiotherapyProliferative potential after exposure toradiation is reduced or terminatedFollowing radiation the tumour cellproliferative signalling response is reduced,which triggers apoptosisAKT-mediated enhanced aerobic glycolysisradioresistance within tumour cells is reducedTherapeutic agents for considerationPARP inhibition,
9657	 inhibitor,
9658	 and
9659	34015Clinical FactorsLymphovascularinvasion, invasivepatternHigh stage, invasivepattern, node(þ),distant metastasisIB stage,lymphovascularinvasion, pleuralinvasion, solidnodules on CTMicropapillarycomponentInvasive patternSolid component,vascular invasion,pleural invasion,node(þ)nodal metastasis,high stage,precence ofmicropapillary orcribriformcomponent,lymphovascularinvasionInvasive pattern,pleural invasion,tumor size,SUVmax,consolidation/tumorratioHigh stage,node(þ), tumorbuddingHigh stage,lymphovascularinvasion, tumorsize, necrosis,nuclear diameterLymphovascularinvasionPrognosisRR[ (limitedresection group)
9660	 (
9661	 functionally modulates ADC to SCC transdifferentiationin
9662	Interestingly, whil
9663	 oxidative modification by
9664	 accumulation is specific to
9665	 than
9666	 accumulation is relatively specific toADC of
9667	 Accumulation inLung ADC and SCC of
9668	 IHC stainingof
9669	 levels in
9670	 Inhibits AST in
9671	 alleviation affects AST, we performedtumor analysis in Ad-Cre-infected
9672	 cells, NRF2overexpression increased the expres-sion its targets and alleviated glucosedeprivation-elicited
9673	 can functionallymodulate the tumor plasticity in
9674	 mice, we observed SCC and mixed Ad-SCC in 40%–60% of these mice; these SCC and squamous components ofmixed Ad-SCC expressed both p63 and
9675	 Alleviation Inhibits AST in
9676	 SCC was enriched for gene sets of purine metabolismand pyrimidine metabolism (Figures 4A and 4B), correlating withenhanced cell cycle progression and
9677	 ADC, KP ADC not only expressed higher levelsof
9678	 levelin
9679	 can regulate
9680	 expression to investi-gate whether
9681	 cells,
9682	 cells,
9683	 levelin
9684	A ADC or SCC remained comparable to that in KL modelwith similar tumor burden (Figure S5J), and the KLA SCC alsoexpressed
9685	 is deregulated, themajor source of reducing equivalents for
9686	 Functionally Modulates AST in
9687	 signature gene expression in
9688	 and
9689	 and
9690	 mouse lung tumors, theseresults thus suggest a correlation of differential
9691	 in LKB1-deficient cancer cell lines (Figure S8A),we reasoned that
9692	 accumu-lation in
9693	 signatures between
9694	 deregulation can be attributed to the nutrient limita-tion during
9695	 and p63 in mouse lung tumor serialsections from the PL treatment group in Ad-Cre-infected
9696	 ADC, KP ADC has less
9697	 loss synergizeswith
9698	 and
9699	 inhibitors prevent the release of PARPfrom radiation-damaged
9700	 defects are considered synthetically lethalwith
9701	 (Permanent Red)sections0Statistical analysisData were expressed as means 
9702	 expression is down-regulated in hypoxicregions of Calu-6 xenograftsHypoxia can decrease
9703	 plays a central role in
9704	 inhibitionis more effective in
9705	 and
9706	  mRNA  andprotein  compared  with
9707	  protein  levels  in
9708	 polymorphisms [rs3020450, rs1256031, rs1256049,rs4986938] were genotyped in the 1021 lung cancer cases and 826controls by the 5’ nuclease assay (Taqman) using the
9709	  (AKT-CA)  vectors  significantly  rescuedthe  decreased
9710	  (H-136)  (sc-8312),ERK2  (C-14)  (sc-154),
9711
9712	  protein  and  mRNA  expression  andsuppressed
9713	  wasinvolved  in  the  down-regulation  of
9714
9715	  expression  by  specific  si-AKTRNA  could  also  promote  reduced
9716	  expression  in  an
9717	  mRNA  and  proteinin thetamoxifen-induced
9718	  expression  via
9719	  glioma  cells, in  a insight the  activation  of
9720	  mRNA  level  inhuman  colon  carcinoma  cells  via  the  activation  of
9721	  signaling  proteininvolved  in
9722	 and
9723	  Shepherd
9724	 formsa complex with p50 homodimers that binds to the
9725	 controls
9726	 of 71 and a
9727	 of 67 and a
9728	 based on the predefined rule that theMTD was the dose level at which the expectation of a posterior dis-tribution of Grade 2
9729	 mutations and NRG2, RET, NTKR1,
9730	 or KRAS, and rearranged
9731	 and
9732	 and
9733	 (Repressor of transcription) di-rectly repress transcription of miR-141-5p, miR-200c-3p and membersof miR-200 family (which regulates both ZEB1 and
9734	 and
9735	 and
9736	 family members, particularly, Murine
9737	-TKIs in approximately 30% ofNSCLC patients with EGFR mutation is acquired due to activated METamplification, PI3K mutation,
9738	 and Raf-1 mRNA ex-pression and attenuates
9739	 and
9740	 and
9741	 pathway by targeting
9742	 mutation in human cancer impairsmicroRNA processing and
9743	 and
9744	 and
9745	)mutations and anaplastic lymphoma kinase (
9746	 T790M mutation,
9747	 and
9748	 amplification: a potentialmechanism of acquired resistance to
9749	 and
9750	 expression by blockingnuclear translocation of
9751	 amplification occurs with or without T790Mmutations in
9752	 and
9753	 after exclusion of rare
9754	 and PI3KCA or
9755	 and
9756	 or
9757	 Prism 7900 HT sequence detection system (AppliedBiosystems) using standard thermocycling conditions andanalyzed with the
9758	 and
9759	 (A) and
9760	 exon 6, and
9761	 and
9762	 mu-tations were associated with
9763	 mutations were associatedwith
9764	 mutations were also detected insamples with AKT1, MET, and
9765	 exon 3,
9766	 and Co-Occurring POD and NTD Alterations,
9767	 (TKIsensitivity),32 KRAS, and
9768	 or
9769	 pathway,mutations in
9770	 and
9771	 mutationswere outside the catalytic
9772	 were identified, with only 1 associatedwith a
9773	 mutations, 3 of 11 were associatedwith a validated driver, and
9774	 and
9775	 mutations, ALKand
9776	 and
9777	 and
9778	 muta-tions and
9779	 HON
9780	 L337, Oregon Health & Science University,3181 SW Sam Jackson Park Road, Portland,
9781	 ¼ chemotherapy and radiation; CRS ¼ chemotherapy, radiation, surgery;
9782	 is suppression ofcell migration and metastasis formation, which is at least partiallymediated through induction of
9783	 expressing tumors (DFS:
9784	 expression did not correlate with
9785	 significantly correlatedwith
9786	 and ERCC1, they identified agroup of patients whose tumors had high expression of both mark-ers (55 of 187 patients) and these patients had significantly longermedian DFS and
9787	 expressionalone, and in particular in combination with
9788	 and
9789	 and
9790	 and low
9791	 and
9792	 muta-tion status and
9793	 expressing tumor had betteroutcomes if treated with an anti-tubulin agent and patients withlow
9794	 gene expression was lower among
9795	 expression may explain the greater efficacy of thechosen double-agent chemotherapy in
9796	 pathways, rendering them independent of
9797	 in these tumorsboth preclinically and clinically has produced dramatic benefits,similar to those seen with
9798	 gene rearrangements are mutually exclu-sive of
9799	 mutations may beutilized as a factor to consider testing for
9800
9801	 and
9802	 repair by
9803	 and insignificant
9804	 mutationsand
9805
9806	 kinase domain mutation results in constitutive phosphorylation and acti-vation of HER2 and
9807	 synthesis andrepair genes
9808	 is identified as a regulator of
9809	 through Ets-mediated transactivation of
9810	 position to 3–5 with methyl and ester sub-stituents at the
9811	 and/or
9812	 and
9813	 countwith DFS and (3-year)
9814	 number with chemotherapy was also correlatedwith increased PFS and
9815	 enumeration and acut-off of 5 CTCs/ml for survival analysis, reflecting the mean CTCcount of all available measurements, the authors found a statisticallysignificant correlation between higher levels of the above variable andshorter
9816	 count,using the CellSearch platform, in a small cohort comprising 24 meta-static NSCLC patients with
9817	 count from baseline to the 5th chemotherapy cycle wassignificantly associated with worse PFS and
9818	 count after adminis-tration of two chemotherapy cycles and
9819	 count, en-umerated by CellSearch before or after one chemotherapy cycle, was anindependent predictor of PFS and
9820	 counts, both at baseline and on the 22nd day aftertreatment initiation, were significantly correlated with shorter
9821	 count after one chemotherapy cycle was thestrongest predictor of
9822	 count (CTCs < 2) after the first chemotherapy cyclewas the only variable for
9823	 count was in-dependently associated with
9824	 enumeration and character-Evaluation of circulating tumor cells and circulating tumor
9825	 and
9826	 and
9827	  mutations  are  not  present  in  tumours harbouring
9828
9829	 and
9830	  Tyr-Val-lung  adenosquamous Met-Ala  mutation  develop tumour carcinomas; in shrinkage  was 2992 (Boehringer Ingelheim, Ingelheim, Germany), a tyrosine kinase  inhibitor  that  inhibits
9831	 mutationsB-RAF  is  a  Ser-Thr  kinase  that  links
9832	 mutations are mutually exclusive  to
9833	  mutations  are  associated  with  increased  kinase activity and lead to constitutive activation of MAPK2 and
9834	  mutations  also  specifi cally  predict  effi  cacy  of CI-1040 (Pfi zer, Ann Arbor, MI, USA), a fi rst-generation specifi c inhibitor of
9835	 mutationsMAPKK1 (also known as MEK1) is a Ser-Thr kinase that activates MAPK2 and
9836	  mutations  are  mutually  exclusive  to  EGFR, KRAS,  HER2,  PIK3CA,  and
9837	 amplifi cation is independent from
9838	 inhibitor but also inhibits HGFR kinase activity in mutant
9839	 kinase domain mutation results in constitutive phosphorylation and activation of HER2 and
9840	 and
9841	  protein tyrosine-kinase fusions and amplifi cation of
9842
9843	 inhibitors to treat mutant Kras G12D and
9844	 and
9845	 mutation predicts sensitivity to
9846	 amplifi cation occurs with or without T790M mutations in
9847	 amplifi cation leads to gefi tinib resistance in lung cancer by activating
9848	 for
9849	 2p13 208100_x_at
9850	  and
9851	  (205015_s_at)and
9852	 gene with the
9853	 and
9854	 Break Apart FISH Probe Kit (Abbott Diagnostics), 4  the ALK  FISH
9855	 testing in Italy,20,21 the success of the
9856	  and
9857	 ⫽ mitomy-cin C (8 mg/m2 on day 1), vindesine (3 mg/m2 on days 1 and 8), andcisplatin (100 mg/m2 on day 1) every 3 weeks for 3 cycles;
9858	 in 2015, 78% of the 26 participatinginstitutionsthe10-weekday
9859	 translocation status assessed by fluorescence in situhybridization (FISH) using the Vysis ALK Break-Apart FISH probeset (Abbott Molecular, Inc, Des Plaines, IL), and
9860	 ¼ anaplastic lymphoma kinase;
9861	 in2015, 78% of the 26 participating institutions reported theywere able to routinely meet the 10-weekday
9862	 and
9863	 between patientswith
9864	 forInduction ineligible50% trt effectReferentDominated$121425Dominated$148995DominatedExtended dominance$190534DominatedInduction ineligible100% trt effectReferentDominated$121425Dominated$149178DominatedExtended dominance$191078DominatedPooled
9865
9866	  shRNA  constructs  and  used  to  determine  levels  of±STAT3  mRNA  by  quantitative  RT-PCR  (A)  or  levels  of  pSTAT3,  total  STAT3  and
9867	  through  phosphorylation  on  Y705  (pSTAT3)leads  to  its  dimerization,  nuclear  translocation,
9868	  but  not
9869	  kinase  domain  mediate
9870	  (cyclin-dependent  kinases4)  and
9871	  and
9872	  gene  amplification  in  osteosarcoma:reciprocal  relationship  with
9873	,  EGFR  resistance  mutation,
9874	 time startingfrom gefitinib resistance in the
9875	 ¼ chemotherapy; LT ¼ local therapy;
9876	 rates in the
9877	 generearrangement or
9878	 amplificationleads to gefitinib resistance in lungcancer by activating
9879	 inhibitors occa-sionally harbor
9880	 ¼ cell cycle progression; CI ¼ confidence interval;
9881	 ¼ cellcycle progression;
9882
9883	 activation of the
9884	 and/or
9885	 by SDF-1 is followed by phosphorylationof
9886	 Pathways in Different Types of NSCLC Cell Linese208 -Clinical Lung Cancer May 2017ConclusionsIn summary, our results describe the different expression patternsof
9887	 and
9888	 and
9889	 and
9890	 enhances proliferation in pancreatic cancer cells through AKTand
9891	 signaling induced epithelial-mesenchymal transition by PI3K/AKT and
9892	 and
9893	 and s
9894	 benefit, althoughthere was clearly improving
9895	 gene, which encodesfor a
9896	 which encodes forPD-L1,
9897	  mutations  are  not  mutuallyexclusive  with
9898	  or
9899	  mutations  hadshorter  survival  compared  with  KRAS
9900	  mutated  and
9901
9902	  mutated  patients  with  advanced  disease  treatedwith  chemotherapy,  both  PFS  and
9903	  mutated  patientsreceiving  first  line  chemotherapy  with  a  platinum  and  either  a  tax-ane  or  pemetrexed,  the  platinum-taxane  combination  improvedORR  and  PFS  but  not
9904	  inhibitorsMost  published  data  underscore  the  negative  predictive  valueof
9905	  mutated  patients  assignedto  the  triplet  combination  of  paclitaxel,  carboplatin  and  erlotinibhad  a  trend  for  worse  ORR  and  also  experienced  shorter  TTP  andOS  compared  to  KRAS
9906	  mutationswere  not  predictive  for
9907	  TKIs  in
9908	  mutations  in  40–50%  ofpatients  with
9909	  and
9910	  was   not  readilytargetable,  it  was  initially  thought  that
9911	 NR NRNRNRNR26 Abemaciclib Single  arm,  pretreated,  bothmutant  and
9912	  mutated  cells  in  the  presence  of
9913	  mutated  tumors  to  receive  the
9914	  mutated  patients,  compared  with37%  in  the
9915	  damage  due  to  the  suppression  of  repair  mechanismsand  in  enhanced  radio-sensitization  of
9916	  and  not
9917	  mutated  NSCLCis  sorafenib,  which  targets  the  vascular  endothelial  growth  factorreceptor  (VEGFR),  platelet-derived  growth  factor  receptor  (PDGFR),B-Raf  and
9918	  mutated  compared  withEGFR  mutated  or  double
9919	   inhibition  with  trametinib  provoked  acompensatory  activation  of  fibroblast  growth  factor  receptor  1(
9920	  mutated  NSCLC,  pre-liminary  data  demonstrate  that  synthetic  lethality  could  be  inducedby  the  inhibition  of  several  targets,  such  as
9921	  mutations  are  well  characterized  in  NSCLC,  thispatient  subgroup  may   be  less  homogeneous  than  initially  thought,in  similar  fashion  with
9922	  gene  exhibit  variable  predictive  significance,with  some  inducing  differential  sensitivity  to  specific  chemother-apeutics  and  others  mediating  a  deleterious  effect  from
9923	   inhibitor MEK   inhibitor,
9924	  (ctDNA)  assessed  by  droplet  digitalpolymerase  chain  reaction  (ddPCR)  has  been  shown  to  have  100%specificity  and  positive  predictive  value  and  64%  sensitivity  for  thedetection  of
9925	  mutations,  EGFR  copy  number  and
9926	  4/6  inhibitor  palbociclib  (PD  0332991)  inpreviously  treated,  advanced  non-small  cell  lung  cancer  (NSCLC)  patients  withinactivated
9927	  and
9928	  and
9929	  inhibitors  enhance  MET-  andEGFR-driven
9930	  and
9931	  with
9932	  Damage  Response  and  Its  InhibitionRadiosensitizes  Mutant
9933	  and
9934	  and
9935
9936	  and  NIKKaplan-Meier  analysis  showed  that  the  expression  of  OTUD7Bin  NSCLC  patients  (log-was  significantly  associated  with
9937	  showedlonger
9938	  of  patients  with  combination  ofhigh
9939	 NIK
9940	  regulates
9941	  deubiqui-tinates
9942	  had  shorter
9943	  +  NIK-group  is  the  best  with  the  longest
9944	  and
9945	 Z epidermal growth factor receptor,
9946	 and
9947	 account for 63% of the population, and ATMand
9948	 mutations had a median
9949	 mutations had a median
9950	 mutations had a median
9951	 mutations had a median
9952	 accompanied mutationsmight play a worse prognosis in
9953	 mutations had a median
9954	 and
9955
9956	 score, andcurrent smoking) into a
9957	 analysis highlighted max esoph-ageal dose and higher
9958	 mutationsand
9959	 and
9960	 mutation or
9961
9962	 or
9963	 mutation or
9964	 Mutation- and
9965	 ¼ anaplastic lymphoma kinase;
9966	 mutationEGFRþcEGF
9967	 ¼ anaplastic lymphoma kinase;
9968	 with positive findings for an
9969	 mutation and 70% for an
9970
9971	 and
9972	 rearrangements are mutuallyexclusive with mutations in
9973	 mutation and
9974	 mutationEGFRþEGF
9975	 ¼ anaplastic lymphoma kinase;
9976
9977	  C118T/C8092A  and
9978	,  MDM2  proto-oncogene,  E3  ubiquitin  protein  ligase;  MMR,  mismatch  repair;MTHFR,  methylenetetrahydrofolate  reductase;  MTR,  methionine  synthase;
9979
9980	 PARP1,
9981
9982	  gene is  a  cell  membranetransporter in  the
9983	  and
9984
9985	  (rs50872,  rs238405,rs238416)  were  found  to  be  correlated  with  clinical  outcome  in  acohort  129  Asian  advanced  NSCLC  patients  [128],  with  rs50872associated  with  longer
9986	  and
9987	  and
9988	XRCC1  rs1799782  (A !!The  XRCC1  protein  interacts  with
9989	  (rs1136410)  has  also  beenassociated  with  survival;  in  particular,  patients  with
9990	  (MRE11homolog  A,  double  strand  break  repair  nuclease),
9991	  tumor  suppressor  gene  regulates  the
9992	  may  induce  apoptosis,arresting  the  cell  cycle  progression,  when
9993	  and
9994	  polymorphisms  rs6494633and  rs11632964  have  been  associated  with  better
9995	  vs  CT/TT  and
9996	 and
9997
9998	  polymorphisms  have  recently  been  associ-ated  with
9999	  rs1143634  polymor-phism,  the  T-allele  has  been  correlated  with  better
10000	  rs1800795  was  found  to  be  associated  withbetter
10001	  C118T/C8092A  and
10002	  and
10003	  contains  a
10004	 expression playsdiffering roles in non-small-cell lung cancer patients with or without
10005	  cDNA  75  bp  amplicon  was  amplifiedemploying  the  primer  pair:  (50 TGA
10006	  AAG  GAC  CAG  GAC  ATC  30)(forward,  nt  676-693)  and  (50 TCA
10007	  is  commonly  expressedin  the  human  lung  and  metabolizes  E2  to  2-  and  4-catecholestrogens,  which  generate
10008
10009	  Age  Female RaceWhite Black Other Annual  income Smoking  pack  years Worse  PSCharlson  CI  (>6)Pre-treatment  albumin Stage   III-B T   status N   statusHistology Adenocarcinoma Squamous
10010	   persisted  in  this  model  with  a
10011	  is  posited  to  be  suppressed  in  theobesogenic  environment  and  has  been  shown  by  genomic  sequenc-ing  to  be  down-regulated  in  obese  clear  cell
10012	  scans)  in  additionto
10013	 [13] and were found to activate
10014	 (1:500 dilution, non-reducing conditions, BD Pharmingen), and
10015	 and SD patients, those with either
10016	and
10017	 patients, consolidation CHTwould act only on a microscopic disease level, both intrathoracicallyand extrathoracically, while in the
10018	 LU   +  LL Treated  with  chemo? MissingNoYes  Metabolic  syndrome  (definition  1) Missing No  YesMetabolic  syndrome  (definition  2)Missing No  Yes  #   Nodes  resected N  Mean  (SD) Median Range #   Nodes  positiveN Mean  (SD)Median Range ≥30
10019	  (cytochrome  p4503A5),  CYP1A2,  and
10020	  phenotype  forCYP2D6  and
10021	  phe-notype  for
10022
10023	  and
10024	  and
10025	  and
10026	   than   with   gefit-inib:  median
10027	  BY-NC-ND licenseEffect   of   gefitinib   plus
10028	   pro-longed  PFS   and
10029	   or
10030	   was   observed   between   gefitinibplus
10031	   in   gefiti-nib   plus
10032	   of   gefitinib   plus
10033	   kinase   domain   (found   in   50%   of   cases)and
10034	   family   members   and   T790M   mutation,20 hasalso   demonstrated   to   be   superior   to   chemotherapy   in   EGFREffect   of   gefitinib   plus
10035	  stutasMutation  Unknown GenderMale Female Smoking  statusNever   smoked  Previous  or   current   smoker  Pathologic  typesAdenocarcinoma  Squamous-cell   carcinoma  Adenosquamous   carcinoma  Gefitinib   plus
10036	   in   patients   with   advanced   NSCLC  1015Figure   2  patients  whose
10037	   were   bet-ter   in   NSCLC   patients   of   whole   population   treated   withgefitinib   plus
10038	   betweentreatments   in   groups   defined   according   to
10039	   in   gefitinib   plus
10040	  amplification  leads  to  gefitinib  resis-tance  in  lung  cancer  by  activating
10041	 a, Xue-Bo Yan PhD a, Yang Ma PhD b, Wei-Hua Xiao PhD b, Rong-Yu Liu MD, PhD a,⁎aDepartment of Pulmonary Medicine, Anhui Geriatric Institute, the First Affiliated Hospital of Anhui Medical University,Hefei 230022, Anhui,
10042	 predicts poor patient prognosis with VEGF-A overexpression and
10043	 phosphoryla-tion but does not affect
10044	 regulatesVEGF-A activity through the
10045	 upregulated VEGF-A expression andactivated
10046	 phosphorylation without affecting the activity of
10047	 phosphorylation but not
10048	 expres-sion predicts poor patient prognosis and survival and correlates withincreased tumor size, high VEGF-A expression and
10049	 mutations result in tumor development through their intrinsic  ability  to  hyperactivate  the  MEK-ERK  pathway,5  non-V600E  BRAF  mutations induce this pathway at lower levels and are significantly coincident with
10050	  mutation status, in contrast to
10051	 mutation and one patient had  an  activating
10052	  mutations  do  occur  in  concert  with  other activating mutations, in particular
10053	 inhibitors in advanced disease: a case report published in this journal by rudin et al14 found a
10054	 and
10055	   and
10056	  class  Imolecules  such  as
10057	  and
10058	  class  Imolecules,
10059	  and
10060	  (95%  CI) p-Value HR   (95%  CI) p-ValueAge  (years)Sex  Histological  type Grade  of  differentiationTNM   stage Lesion
10061
10062	  and
10063	  and
10064
10065	  surface  expression  on  B  cell  monocyte  cell  linesis   partially  independent  from  tapasin  completely  independent  from
10066	   and
10067	   and
10068	   and
10069	  pathway,  which  is  negatively  regulatedby
10070	  sequencing  shows  PC9  cell  line  was
10071
10072	  and
10073	  or
10074	  and
10075	  and
10076	  and
10077	  or
10078	  or
10079	  and
10080	  expression,finally  resulted  in  acquired  resistance  to
10081	  and
10082	  and
10083	   amplification  and
10084	  via  targeting  of  the  proinflammatorytumor  suppressor
10085	  losscontributes  to  erlotinib  resistance  in
10086	 (anaplastic lymphoma ki-nase) or
10087	 or
10088	  is  a  nuclear  corepressor  withconserved  domains  for
10089	  double-strand  break-induced  chromatindecondensation  is  modulated  by  phosphorylated
10090	  stimulates
10091	  binds  the
10092	  stimulates formation  of
10093	  prism  7000
10094	  mRNA,  was  expressed  as(GAPDH)
10095	 LUNX CEA KS1/4
10096	  expression  amount  normalized  by  the  amount  of
10097	  in  NSCLC  cellsTo  see  whether  up-regulation  of  TRIM28  plays  a  role  in  growthor  survival  of  lung  cancer  cells,  we  designed  and  constructedplasmids  to  express  siRNA  against  TRIM28  (si-1,  si-2,  si-3,  si-4),along  with  two  different  control  plasmids  (siRNAs  for
10098	  content  was  performed  to  determine  whetherinhibition  of
10099	  expressionamount  was  normalized  by  the  amount  of
10100	  and
10101	 LUNX CEA KS1/4
10102	 LUNX
10103	  was  observed  to  inhibit
10104	  also  suppressed  the  cyclin-dependentkinase  inhibitor
10105	  and
10106	  and
10107	 uncertainties reflected its robustness,especially the association between
10108	 score was not completely accountedfor by PS, ADL score, and
10109	 score, PS 0e1, never smoked status, ADLscore, and
10110	 score remained statistically significantin allsensitivity analyses, conducted without ADL,
10111
10112	 46,46<GH<67, and GH 67), GH score remained asso-interquartilerangesciated with
10113	 dimensionscore provided significant value in addition to PS,treatment type, smoking status, histology, and bothADL and
10114	 in the modelwithout ADL, these results suggest that the EORTCQLQ-C30 questionnaire could even surpass the ADLscore, reflecting the same characteristics while addingthe global
10115	 <4646 GH 67GH >67TreatmentMonochemotherapyDoublet chemotherapyPerformance status score0e12Smoking statusNever smokedEver smokedHistologyAdenocarcinomaSquamousOther
10116	 90-beta (HSP90A),heat shock 70 kDa protein 1A variant (HSPA1A), histone deacetylase 1 (HDAC1) and
10117
10118	 gene has putative
10119	 and
10120	 togetherwith the HSP90A, HDAC1, or
10121	 alone significantly transactivatedthe
10122	 transactivation was repressed byHSP90A, HDAC1, or
10123	 was repressed by HSP90A, HDAC1,and
10124	 protein is specifically induced by an
10125	 expression plasmids and constructs for FOXA2 binding protein expression such as HSP90A,
10126	   gene:   SNP   rs12064957,
10127	  and
10128	  gene  (rs13173911,  transcriptionfactor  binding  sites,  TFBS;  rs2864963,  TFBS),  1  SNP  in
10129	  gene  exhibited  significant  protectiveeffects  on  RFS  of  NSCLC  patients  with
10130	  geneexhibited  significant  protective  effects  on
10131	  gene  and  rs1414493  inFH  gene  were  significantly  associated  with  increased  death  riskin  NSCLC  patients  with
10132	 RFSBest  fitting  model HRa (95%  CI) P-value Best  fitting  model HRa (95%  CI) P-valueSDHA
10133	  rs13173911  WW,
10134
10135	  and  SDH  genes  result  in  accumulation  of  fumarate  and  suc-cinate,  whereas  gain-of-functions  mutations  in
10136	  and
10137	  and
10138	  and
10139	 mRNA expression in human tumor FSCscorrelates with immune cell infiltration and intratumoralaccumulation of
10140	 and
10141	 and
10142	 and
10143	 (Fig 3, B) and
10144	 and
10145	 expression and
10146	 (PIAS1) is a
10147	 and
10148
10149	 protein accumulation in PKCi and serum treatment, but not with
10150	 correlates with activation ofseveral transcriptional programs that include
10151	 repair and cell cycle progression, a hypothesisconsistent with the known function of
10152
10153	 is oncogenic and that, at least in part,this activity depends on its ability to promote FAK nuclear accumulation,integrin signaling activation and
10154	 E3-ligases
10155	 modificationpathway is involved in the
10156	 regulates the tumor suppressor
10157	 E3 ligase
10158	 BY-NC-ND licenseundertheKeywords: Non–small cellTyrosine kinase inhibitors; cost-effectivenesslung cancer;
10159	 period was calculated onthe basis of the difference between the
10160	 docetaxel (2001),
10161	 (May 2001 to April 2002), 688 in
10162	 2001
10163	 2001 BSC
10164
10165	 imaging with the respiratory cycleresults in improved target-to-background ratio, resulting ina more accurate delineation of tumor volume and mea-surement in
10166	 for defining lung tumor volumes and
10167	 as prognostic factorFDG-PET provides biologic information about tumorsand may be utilized to predict outcome in patients withPractical Radiation Oncology: October-December 2011Role of PET for NSCLC285AC8VUS765432100B7654321076543210Coronal ProfileSagittal ProfileCranio-Caudal ProfileGatedUn-Gated5101520Pixel Index Across Coronal PlaneVUS876543210GatedUn-GatedGatedUn-Gated87654321VUS05101520Pixel Index Across Sagittal Plane0400Pixel Index Across Cranio-Caudal Direction102030Figure 2 An improvement in tumor delineation and measurement of
10168
10169	 emission images obtained using
10170	 protocol:
10171	 Z computed tomography;
10172	 scan and visual correlation with
10173	 = computed tomography;
10174	 = computed tomography;
10175	 repairgenes such as ERCC1, RRMI and
10176	 pathways and their downstream targets (b-catenin, c-myc, cyclin D1, cyclin B1, pERK,MMP9 and VEGF proteins), enhanced cleavage of the apoptotic mediators Bcl2 and
10177
10178	 pathway signaling such as with monoclonalantibodies or TKIs could potentially be used clinically to treat NSCLCpatients with alterations in this pathway including those who havedeveloped resistance to
10179	 and
10180	 and LVDImmunohistochemical reactions for
10181	 and
10182	 (matriptase) was linked to
10183	 and
10184	 and
10185	 and
10186	 and Vimentin levelswere predominant in cell lines expressing
10187	 than didVimentin and
10188	 (Table 2), but represented by a single Affymetrix
10189	, ST14, EpCAM and Vimentin, along with E-cadherin and N-cad-Table 3Changes in gene expression induced by exogenous ZEB1 or
10190	-correlated genes are responsive to ZEB1 and
10191	 and barelydetectable
10192	 or
10193	 induction led to a55-fold upregulation of endogenous
10194	 induction had little to no effecton
10195	 and
10196	 and
10197	 and EpCAM proteins are decreased by exogenousZEB1 or
10198	 (A)or
10199	 and EpCAM in H157 cellswere increased by knockdown of
10200	 and
10201	 negatively correlated genes are also responsive to ZEB over-expression and downregulation, whereas Vimentin and
10202	 and
10203	 and E-cadherin or
10204	 and
10205	 positivecells were present in 28/31 (90%) tumors that had lost E-cadherin, andsimilar results were observed for
10206	 positive cells are found in the stroma, there is less prob-ability to find E-cadherin or
10207	 and
10208	 and EpCAM are increased by
10209	 and
10210	 associated with resistance to
10211	 positively correlates with E-cadherin but negatively with
10212	 level and corresponding immunostaining for E-cadherin and
10213	 and compared with E-cadherin or
10214	 and 2 are RNA binding proteins that regulate epi-thelial-specific splicing of several relevant genes includingFGFR2,
10215	 was the fourthmost negatively correlated gene with
10216	 stainingwas highly significantly correlated with E-cadherin andnegatively associated with
10217	 and
10218	  is  a  noveltranscriptional  repressor  for  the  breast  cancer  oncogene
10219	 plus
10220	 19111, USAA R T I C L
10221	 and PDK1phosphorylation, but enhanced
10222	 and
10223	 and PDK1activation, together with slightly increased
10224	 and
10225	 and
10226	 signaling and down-regulated
10227	  T790M  mutation  and
10228	 ¼ anaplastic lymphoma kinase;
10229	 mutations and
10230	 inhibition and downstream signaling inhibition of
10231	 activity or phosphorylation of downstream signalingproteins
10232	 amplificationhas been detected in approximately 20% of
10233	 or
10234	 include
10235	 and highly specificorally bioavailable small molecule for
10236	 inhibitors in a panel of NSCLC cell lines selectedon the basis of their MET dependency as well as those withEGFR and
10237	 mutant NSCLC celllines PC9 (Del E746_A750), PC9 GR4 (Del E746_A750/T790M),HCC827 and HCC827 GR6 and the
10238	 competitive,
10239	 andboth
10240	 exon 19 deletionas the parental HCC827 but with
10241	 and
10242	 wascoupled with partial inhibition of ERK1/2 phosphorylationand no inhibition of
10243	 phosphorylation or downstream ef-fectors such as
10244	 phosphorylation andERK1/2 phosphorylation and no inhibition of
10245	 dependency and collectively suggest264M O L E C U L A R O N C O L O G Y 9 ( 2 0 1 5 ) 2 6 0 e2 6 9Figure 2 e MET-dependent cell lines are sensitive to tivantinib, crizotinib and PHA-665752 but only crizotinib and PHA-665752 blocks MET,PI3K/AKT and
10246	 and ERK1/2 phosphorylation but not
10247	 and EGFRinhibition blocks PI3K/AKT and
10248	 and AKT/PI3K/mTOR path-ways has been seen as necessary for the complete efficacy of a
10249	 phosphorylation was inhibited with progressiveconcentrations of the drug no complete inhibition of bothERK1/2 and
10250	 damagebefore entering mitosis and the profile of G2/M phase arresthas been previously described for G2/M checkpoint modula-tors like
10251	 amplification in
10252	Targeted treatment of advanced non-small cell lung cancer patients with afatinib in EGFR mutation orcrizotinib in
10253	 pathway,
10254	 that devel-oped lung tumors and who were treated with erlotinib, revealeda T790M mutation in 5/17 and in 5/17 different mice a
10255	 or increased activa-tion of the
10256	 mutations with crizotinib (a known
10257	 mutation positive cell lines withmutant or wild type
10258	 siRNAs with either
10259	 gene expression and receptor involvement inresistanceTwo cell lines carrying the T790M
10260
10261	 copy numbergain has been found in almost 8% of resistant patients and
10262	 breaksmay co-exist with
10263	 rearrangements and
10264	 andincreased autophosphorylation of
10265	Activation of the EGFR signaling pathway, as another mecha-nism of resistance to
10266	 and crizotinib is the main drug to target
10267	 and
10268	 inhibitor entinostat showed that a subgroupof patients with EMT had an advantage in
10269	 and NF-kappaB signalling modulate dependence of lung cancers onmutant
10270	 and
10271	 secondary mutation and
10272	 amplification: a potential mechanism of acquired resistanceto
10273	 and
10274	 and
10275	 and regulatingWNT/β-catenin pathway in non-small cell lung cancerZhiwei Zhang⁎, Yang Yang, Xiuqiang ZhangTDepartment of Thoracic Surgery, The Fifth Central Hospital of Tianjin, Tianjin 300450,
10276	 could partly rescue the
10277	 and
10278	 and
10279	 and
10280	 and
10281	 and
10282	 and
10283	 and
10284	 conceived of the study, recruited patients andcorrected the manuscript;
10285	 and
10286	 and
10287	 and
10288	, and
10289	 and
10290	 and
10291	 and
10292	 and
10293	 mRNA were normalized to
10294	 and
10295	 and
10296	 and
10297	 and
10298	 and
10299	 and
10300	 and
10301	 and
10302	 and
10303	 and
10304	 and
10305	 and
10306	 and
10307	 or
10308	 and
10309
10310	 mRNA and
10311	 and
10312	 and
10313	 and
10314	 and
10315	 and
10316
10317	 promotes G1-S progression by formingactive holoenzymes with
10318	 and
10319	 and
10320	 or
10321	 can control
10322	 and
10323	 or
10324	 3′UTRs of
10325	 or
10326	 and
10327	 and
10328	 and
10329	 and
10330	 and
10331	 or
10332	 or
10333	 and
10334	 and
10335	 and
10336	 and
10337	 and
10338	 were observedaccording to
10339	 mutation status (FISH⫹/Mut⫹
10340	 with Erl in patients with
10341	 gene amplification57No improvement in
10342	 gene copynumber is associated with a worse
10343	 was observed in patientswith
10344	 genecopy (FISH) and
10345	 mutation positive patients, substantial im-provements in PFS have also been observed, although no trialto date has demonstrated improved
10346	 mutation positive patients receiving gefitinib but nodifferential effect on
10347	 on
10348	 had a significant improvementin
10349	 was not correlated withPFS or
10350	 mutations for
10351	 mutations whoreceived chemotherapy plus erlotinib appeared to have thelowest ORR and the shortest PFS and
10352
10353	 status was notpredictive of PFS or
10354	 expression may be prognosticfor improved
10355	 mRNA did not predict forORR or
10356	 for
10357	 in patients with
10358	 ⫾ Bev75Low plasma
10359	 mutations associated with improved
10360	 levels prognostic for overall survival (1-yr
10361	 repair by
10362	 and
10363	 and SD þ
10364	 Asp312Asn (G/A versus G/G,
10365	  Asn118Asn, ERCC1  C8092A,
10366	 muta-tion status, use of bevacizumab, and type of platinum agent, and polymorphic genotype as an indicator variable, we found a  significant  effect  of
10367	 was significantly lower for  patients  with
10368	 312 polymorphism, the
10369	 399 and
10370	 genotype on the ability of a cell to repair
10371	 adducts from two lymphoblast  cell  lines  exposed  to  vinyl  chloride  metabolite had been evaluated and showed that the efficiency of repair of DNA adducts in the
10372	  and
10373	  312  variant  alleles  may induce higher level of
10374	 312 polymorphism on
10375	 repair  by
10376	 and
10377	 and
10378	 and
10379
10380	 and
10381	 for alectinib compared with crizotinibtherapy in the
10382	 and
10383	 and
10384	 Kaplan-Meier curves of the grouptreated with alectinib as a first-line
10385	, sequentialtherapy with crizotinib followed by alectinib after cri-zotinib failure tends to provide a better OS benefit thanalectinib alone for the management of patients withNSCLC with
10386
10387
10388	 in 472 Patients Receiving
10389	 TKI therapy among patientsin group A (tumor tissue [TT]-positive/circulating tumor
10390	 assay contributed to the false-negative
10391	 mutation,
10392	 mutated Caucasian NSCLC: circulating-free tumor
10393	 mutations in plasma
10394	 and directsequencing for
10395	 T790M in plasmacell-free
10396	 has greater sensitivity and marginally greater spec-ificity relative to
10397	 to be superior to
10398	 and PET-
10399	 scan and mag-netic resonance imaging) is based on structural informationand defines disease states based on gross anatomic changes,whereas
10400	 ScannerGE AdvanceDiscovery LS (GE Medical)—Phillips AllegroGE Quest 300-HBiograph SL (Siemens)GE-LSO-based Discovery STBiograph Duo LSO (Siemens)Biograph SOMATOM Sensation 16 (Siemens)Picker Triple-Head Coincidence
10401	 and
10402	 has a small but consistent protective effecton the lungs and esophagus, and a few studies confirm abenefit for PET in terms of increasing the total dose and
10403	 standard uptakevalue and
10404
10405
10406	 3100 isa small molecule specific antagonist of the
10407	 and
10408	  chromo-somal  breakpoint  commonly  lies  between  exons  19  and  20 but is variable on the
10409
10410	 positivity for
10411	 (14) or
10412	  protein HEIHCFISHFKx400Positive: 2/3+Negative: FusionGLx200NegativePositive: BA patternHMx400NegativePositive:
10413	 rearrangement patterns were BA in 15 and
10414	 alteration  was  not  shown  to  be  restricted  to  adenocarcinoma but  was  present  in  the
10415	 screening to adenocarcinoma,16 but the data are consistent with recent guide-lines  from  the  National  Cancer  Comprehensive  Network  that recommend  analyzing  all  adenocarcinoma  and
10416	 polysomy with clusters of equal to or more than six fusion signals without BA or
10417	  amplification  in  NSCLC, and most of them were IHC negative for
10418	  wild-type  and
10419	 in clinically  selected  patients  with  NSCLC  and  an
10420	  or
10421	  and
10422	 rearrangements are mutually exclusive with mutations in
10423	 and
10424	 (Hs01058318_m1),EGFR (Hs01076078_m1), HER3 (Hs00176538_m1), IGF-1R( H s 0 0 6 0 9 5 6 6 _ m 1 ) , E G F ( H s 0 1 0 9 9 9 9 9 _ m 1 ) ,I G F(Hs01547656_m1), amphiregulin (Hs00950669_m1), NRG1(Hs00247620_m1), and
10425	 primer was used for normalizing
10426	 and
10427	 inhibitors in the presence of indicated
10428	 and stepwise increased concentrations of
10429	 and
10430	 mRNA, respectively, than theparental cell line; and both resistant cell lines expressed more thaneight-fold higher
10431	 also induces theH3122 parental cells to become resistant to AP26113 and PF06463922,two new-generation
10432
10433	 to both
10434	 fusion gene(NPM-ALK) but express only a very low level of HER3, to test thesensitivities of these ALK inhibitors in these two cell lines in thepresence of
10435	 inhibitors, either alreadyFDA approved or currently in clinical trials (Table 1), includingerlotinib (a first-generation EGFR inhibitor), afatinib (a second-generationirreversible EGFR inhibitor that targets wild-type EGFR, the T790MEGFR mutant, and HER2), AZD9291 (a third-generation irreversibleEGFR inhibitor selectively targeting the T790M EGFR mutant), andAZD8931 (a reversible,
10436	 and
10437	 expression using Western blot butfailed to detect p-HER2 expression, strongly suggesting that HER2 isnot a contributor to
10438	 and HER3170Resistance Mechanisms to
10439	 (NRG1) were responsive to
10440	 familyproteins in combination with
10441	 secondary mutationand
10442	 Staging and pN Staging on
10443	 and 4
10444	 mutations [L95H] were detectedonly in COPD patients, whereas