SHARE
TWEET

Sequence 2

a guest Oct 14th, 2012 56 Never
  1. GCCGTGTAAAATCGATGAATAAACTGAGTTGCGTTAGCTTCTTTGCTCCCCGCCTGTGACCCTAGTCGGGAGGCCGAGCCACATGTCAGCGGACGCAAATACTACTCACCAGACGGGGTATAAGTACTGTGCAACATTGAACACCTTCGCCTCAAGCTGCACTCAGGAGTGTAGTGAGGATATTCCCTCTGGGCCCGCGAAGACAAAGGCATCCACTTCCGGACTGCATTACGTAGGAAGGTACAACCGGTTGGAGCAGATACCCTCGTAGCAAGTTCATGCGCAATGTCGTCGCATATGTATTCGTGAAACCCGATTGACTAGAGTATTTGTTACTCGTATGATAAAACCTCCCCATCCGCCTAGAAAATTGTTGACCTGCCATGGTTCTAAGATATACCGCCCCAACTGCTTATCACTAGCGAATGATCTCCACAGCTCGGGAATGTAAGGATCGTTTACGTTGTCCACCTATAGCCGCCGGTAGAATTAGTGGGTGTTGTGCTATCCCGCGCTTGTAGCCTCCTCGACCCGTGGAAGCGTCTCCGCACAACCCGGTTCAGCGCACCCTATTAACCTAGAAACCGTTCCGGGCTGTTCAGTCATTGCGAGGGCTTGAAGGGGAGACATCTTACTACGCCATCCTGCTCCAAGAACCACAGTTTTAAGAGCGGTCTTCATCCTCATTATTTCGGTGCCCGGAGTTCATCTTGCTAAAACAGTCTCACTACCAGACCCGCTCCATTCCTTATGTGGCCACCACTCCCCCATCGTCATGTTAAGGATTCATTCTAAGGATTCATTTTGGAACGCGGCAAAGGGCTTTCGGAACCAACGATCAATGCGCACCGTAATGAGTTCAGACAGCCACATTTTCTCATAACTCTTAAGACCAAAATCTGAGAAGCTATGTGTCCCACCCCTCTTCGCGACCTGGGTGGTCCGATGGCCAGCGAAAGGTTTATGGTCACGGCTTTCAACCTTGAACAAACAACCAGGGCCACACAGGATTAATCTGGCGACGAAATAAACCGAGGCCAGAGGTACTCGGCACGTAACCGCTCGTTATCATTTAGCGCGTCCTCGGTTCTGAACCAGGTACGGGTTATGACTCCTTTTGATCCCAGGCCGAACGCTTATGAGAGAAAACGAAAGAAAAGTGATTACAATTGTCATGAGTATTAGAGCCGTGAAATCCATGCCGCTTGAATTGTGAGGGTCGGAGTATTTTTTGGGGAGAATTCGTCTCATCAGGAGGGCTACACCAATCCACTGCGCTGGAAGGACCTCGCGTTAGTAGTCAGGATCTCTGTACCTTACAAATTGTAACGACCGGCGTCCTTAATCTTCTATTATTGTAAACATATTGTTGAACGCCCTCGCACATTCGCTATTCACGCTCACATTGCGTGCACGTGTTGGCTAACCGGGCGGCTTCTGTTCATCCAGAATCCGCATACAGTGGCATAATTACCGTCTTGGGTGGGTACTACTGTGTATACCAATGAAGTTTAAGCCGCTCCGATCTGCCCCCATTGCAGAAGCCCGCAGGCAACCTTCTTCAGCAGGGATGCGCATAGATGGGCGCACTAAGAACGGCCACATCCGTGGCGAATCCGGAAGAGACTTCCCCACGGGTAGCCTCCCTATATGGACATGCTCGGCCAGACAGTGCTGCCGGACGTAAAGGCATATATCTAGATCGCCACCAGTTAATTGGATACCTACCCAGTGTTCAAGGACACATGCGCGGTAGCACTCAATTTATCGCAGACTCTTTAGGCGAACACCTGCCCCCCTCTAACGAGGTGTAACACTTTCCTTGCGGCGGTAGTATAGTTGACAGTATTCGCTAGTTTGCCACGAGCCTGTATCGCTCTCAACAATTTTTGCAAGGTAGTGACGTCAGTCGCTTTTCAGCTTGCCTAATCGGGCGTGAGTCACTGTAACTACCGTAAGCTACCACATGCCCGAACCGTTGGAGCGACAGAACGTAGATT
RAW Paste Data
Top