SHARE
TWEET

Sequence 1

a guest Oct 14th, 2012 64 Never
  1. TCTCCCAAGTTATCATTATACCGGGGCGGATGTACATGAACTATGTGCAACGAGGGAGCCGAGGACAACCTGGAAAATATGCATCAGATTGTGTACTGACAGATGCAGTCCTCAAAAGCTGAAGATGATACCCCCCTGGGCGGCTGAGCCCCCACAGATGTGGACGTTCTGGCGTACAAGGGAGTTGAGCGCAGGATCTGAAACAACGAGTTATTTGTTTAGGTACTCTTAAATCTCATCGGGGAGCGACCGCGAGTAGAGGAACCTGAGCCCGGGCAGGGTGTAACTTATCATAGAAGAGCTACTCAAACAAAGATCAGTTTTCAAAACACGACCCCCAGCGAAAAAATGCCACCAAGGAAACACACATAGGTTGAAAAACCATCAAGACCTTGTAGCTATGTAACAGCTTCATACCCAAACTCATCTCGCAGTCACTTGGTTCGCACGACTAAATTTGTGCTGGGTTTGCCTGCGGAGAATATTCTAAATTATCACTGACATAAGCTTTAACCTCTAGCTCAATTGACTCCCAAAACCAGTTCTAACAGAACGTAACACAGAACGAACTGCATTATGCAGTGGATGTTCAGGAGTCGTAAACGTCTAGTGGGCCGTACAACACTGAGCTTATTTGAATTGCTCTGCGCCCGAGCACGACTTCTGCGAGCCCACGAGGCCTCTTCCTCTAGAAAGTGCGGAAGACGCCAGAGAACAGGTAACTCGGTTGTAGCAGAAGCGGCTTGGCGATCTAGTATGTAGCGTGTTGGTCCAGAACACGATAGCGTATAGACCTATATCAAAAGAAGGTCATTGAGGTCGGTTTAAAAAAACGTGATGTCGCTCAGGTTAAGGTTCATGTTCTTGTAACACAGCAAGCATCGTCTTGCCTACGTCTTAAGGGAGAGACACGTCGCTTTCAGCCGAGTAGTGGAAGTAATCGTACTTGACCTTAAAACTGCCGTGATGTCCTGAACATCTGTATGATTGGACGTTTTTAGCCTCCAATAAGGCACAATATTAGGAAGATTGGGTCGTGCAGGTGGTTCTATAACACCTGACCACCACGGCTGTCAAGTGCTAGCCTGTGTCGATGGTTCGGTCATTTCATTTCTGGACATCCTCGTTTACCAGTAGTGTATACCACATGCAGGATGAGACCCATGGTCGTTGACAAAACATGGGGAGCGTCTGAATCAACGAGCCTTGCACGGACTTCACACATTGTGTGCGTATGCTAGGAGCCTTGCCAATTATTGGTACGGTTACGCCTCTTACATACCCTGAGACAGGGCAGCGCGTGAGTTCGCGAAATTACAACTACAGACTGAGTGAGAATCCTTCCTAAAGTGAACGTTTGCTTCTGATATCACACTAATTACAAAGATCCGTCATTTCGTAACTTTCTCATAGGTACAGATAGCGCCGTTGACCACGAAAGACCGAACACCACGCGGGCTCGTAATTCCTTGGAAGACTGAGACAACGAACACCGCATCCATCCCAGCTAGTTAATGGGGAGTCCTATTCGGTCCGGGTAAGCTGCTCGCCAGGAACCTTGGTTGAGCGACGTAGACGACCGTCTCCATCCCGATGCCGGCATACGGATAGGTCTTAGAGGAGTCTGTTAGTGGTGGTCGTAGTGACCACGAGATAATGACTGCCTGAGGCCCGACTACACCTGACATGTACGTAGGCTACTTCAAGCTCCAGGATAAATAGCAGACGTGGTGGAGGGAACGGGGTGAGTGCGGTATACTGCAGTAGATTCCCGTGGGTCCAGGACTAAAGTTCTGCCGGAATACACTCAAACGTATGCTAATGCGCTTGGATATTCGCAATTGTAACGACTACACTGAGCTTAACGTTTCTACGTGCGGTGACAGAGGGATGACACTCGCGCAGGCTAGAAGCGAACCACCCAATCGGTGAGCGGAAATGAATGCTTATTTTAGCAATAAACGTTCGTTGATTGCTAAGAGGCACACTAGCAAAAGCTC
RAW Paste Data
Top