Don't like ads? PRO users don't see any ads ;-)
Public Pastes
Guest

Untitled

By: a guest on May 8th, 2012  |  syntax: None  |  size: 62.20 KB  |  hits: 13  |  expires: Never
download  |  raw  |  embed  |  report abuse  |  print
Text below is selected. Please press Ctrl+C to copy to your clipboard. (⌘+C on Mac)
  1. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  2. t/001_app.t ............................ ok
  3. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  4. t/002_basic_routes.t ................... ok
  5. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  6. t/003_aligner.t ........................ ok
  7. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  8. t/004_job.t ............................ ok
  9. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  10. already present:
  11.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nhr
  12.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nin
  13.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsd
  14.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsi
  15.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsq
  16. already present:
  17.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nhr
  18.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nin
  19.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsd
  20.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsi
  21.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsq
  22. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  23. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  24. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  25. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  26. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  27. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  28. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  29. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  30. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  31. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  32. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  33. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  34. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  35. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  36. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  37. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  38. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  39. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  40. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  41. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  42. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  43. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  44. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  45. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  46. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  47. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  48. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  49. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  50. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  51. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  52. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  53. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  54. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  55. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  56. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  57. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  58. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  59. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  60. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  61. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  62. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  63. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  64. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  65. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  66. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  67. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  68. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  69. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  70. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  71. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  72. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  73. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  74. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  75. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  76. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  77. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  78. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  79. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  80. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  81. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  82. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  83. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  84. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  85. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  86. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  87. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  88. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  89. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  90. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  91. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  92. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  93. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  94. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  95. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  96. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  97. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  98. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  99. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  100. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  101. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  102. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  103. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  104. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  105. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  106. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  107. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  108. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  109. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  110. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  111. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  112. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  113. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  114. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  115. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  116. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  117. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  118. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  119. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  120. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  121. substr outside of string at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 433, <GEN22> line 3.
  122. Use of uninitialized value in transliteration (tr///) at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 436, <GEN22> line 3.
  123. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 444, <GEN22> line 3.
  124. Use of uninitialized value $piece in length at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 445, <GEN22> line 3.
  125. Use of uninitialized value $piece in sprintf at /home/rob/cpan-lib/lib/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm line 451, <GEN22> line 3.
  126. already present:
  127.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nhr
  128.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nin
  129.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsd
  130.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsi
  131.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsq
  132. already present:
  133.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nhr
  134.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nin
  135.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsd
  136.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsi
  137.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsq
  138. already present:
  139.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nhr
  140.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nin
  141.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsd
  142.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsi
  143.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsq
  144. already present:
  145.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nhr
  146.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nin
  147.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsd
  148.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsi
  149.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsq
  150. already present:
  151.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nhr
  152.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nin
  153.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsd
  154.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsi
  155.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsq
  156. already present:
  157.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nhr
  158.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nin
  159.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsd
  160.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsi
  161.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsq
  162. t/005_submit_route.t ................... ok
  163. t/006_model_BCS.t ...................... ok
  164. t/007_schema.t ......................... ok
  165. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  166. t/009_download_raw.t ................... ok
  167. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  168. t/010_post_index.t ..................... ok
  169. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  170. t/010_submit_invalid.t ................. ok
  171. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  172. t/011_config_min_seq_length.t .......... ok
  173. t/012_config_temp_dir.t ................ ok
  174. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  175. adding extraomgbbq (4ba77abdd9570d393aba58742b727caf76219bc0) to the db at /home/rob/cxgn/mimosa/lib/App/Mimosa/Controller/JSON.pm line 51.
  176. t/013_grid_json.t ...................... ok
  177. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  178. already present:
  179.  - /home/rob/cxgn/mimosa/t/data/.mimosa_cache_fbe21c6749e08ae8eef1b203a53fd385c52238a4.nhr
  180.  - /home/rob/cxgn/mimosa/t/data/.mimosa_cache_fbe21c6749e08ae8eef1b203a53fd385c52238a4.nin
  181.  - /home/rob/cxgn/mimosa/t/data/.mimosa_cache_fbe21c6749e08ae8eef1b203a53fd385c52238a4.nsd
  182.  - /home/rob/cxgn/mimosa/t/data/.mimosa_cache_fbe21c6749e08ae8eef1b203a53fd385c52238a4.nsi
  183.  - /home/rob/cxgn/mimosa/t/data/.mimosa_cache_fbe21c6749e08ae8eef1b203a53fd385c52238a4.nsq
  184. already present:
  185.  - /home/rob/cxgn/mimosa/t/data/.mimosa_cache_fbe21c6749e08ae8eef1b203a53fd385c52238a4.nhr
  186.  - /home/rob/cxgn/mimosa/t/data/.mimosa_cache_fbe21c6749e08ae8eef1b203a53fd385c52238a4.nin
  187.  - /home/rob/cxgn/mimosa/t/data/.mimosa_cache_fbe21c6749e08ae8eef1b203a53fd385c52238a4.nsd
  188.  - /home/rob/cxgn/mimosa/t/data/.mimosa_cache_fbe21c6749e08ae8eef1b203a53fd385c52238a4.nsi
  189.  - /home/rob/cxgn/mimosa/t/data/.mimosa_cache_fbe21c6749e08ae8eef1b203a53fd385c52238a4.nsq
  190. t/014_submit_multiple_sequence_sets.t .. ok
  191. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  192. t/015_mimosa_database.t ................ ok
  193. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  194. t/016_validate.t ....................... ok
  195. t/017_config_default_seq.t ............. ok
  196. # Removing t/var/BCS.db
  197. t/018_chado.t .......................... ok
  198. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  199. t/020_auth.t ........................... ok
  200. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  201. already present:
  202.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nhr
  203.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nin
  204.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsd
  205.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsi
  206.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsq
  207. [error] Caught exception in App::Mimosa::Controller::Sequence->sequence "Directory /home is not writable, cannot make dirs
  208.  at /home/rob/cxgn/mimosa/lib/App/Mimosa/Database.pm line 37"
  209.  
  210. #   Failed test '200 GET /api/sequence/1/LE_HBa0001A15_T7_30.txt'
  211. #   at t/025_sequence_api.t line 35.
  212. #          got: '500'
  213. #     expected: '200'
  214.  
  215. #   Failed test 'got the correct desc line back'
  216. #   at t/025_sequence_api.t line 37.
  217. #                   '<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
  218. #     "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
  219. # <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
  220. # <head>
  221. #     <meta http-equiv="Content-Language" content="en" />
  222. #     <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
  223. #     <title>Mimosa</title>
  224. #     <script type="text/javascript">
  225. #         <!--
  226. #         function toggleDump (dumpElement) {
  227. #             var e = document.getElementById( dumpElement );
  228. #             if (e.style.display == "none") {
  229. #                 e.style.display = "";
  230. #             }
  231. #             else {
  232. #                 e.style.display = "none";
  233. #             }
  234. #         }
  235. #         -->
  236. #     </script>
  237. #     <style type="text/css">
  238. #         body {
  239. #             font-family: "Bitstream Vera Sans", "Trebuchet MS", Verdana,
  240. #                          Tahoma, Arial, helvetica, sans-serif;
  241. #             color: #333;
  242. #             background-color: #eee;
  243. #             margin: 0px;
  244. #             padding: 0px;
  245. #         }
  246. #         :link, :link:hover, :visited, :visited:hover {
  247. #             color: #000;
  248. #         }
  249. #         div.box {
  250. #             position: relative;
  251. #             background-color: #ccc;
  252. #             border: 1px solid #aaa;
  253. #             padding: 4px;
  254. #             margin: 10px;
  255. #         }
  256. #         div.error {
  257. #             background-color: #cce;
  258. #             border: 1px solid #755;
  259. #             padding: 8px;
  260. #             margin: 4px;
  261. #             margin-bottom: 10px;
  262. #         }
  263. #         div.infos {
  264. #             background-color: #eee;
  265. #             border: 1px solid #575;
  266. #             padding: 8px;
  267. #             margin: 4px;
  268. #             margin-bottom: 10px;
  269. #         }
  270. #         div.name {
  271. #             background-color: #cce;
  272. #             border: 1px solid #557;
  273. #             padding: 8px;
  274. #             margin: 4px;
  275. #         }
  276. #         code.error {
  277. #             display: block;
  278. #             margin: 1em 0;
  279. #             overflow: auto;
  280. #         }
  281. #         div.name h1, div.error p {
  282. #             margin: 0;
  283. #         }
  284. #         h2 {
  285. #             margin-top: 0;
  286. #             margin-bottom: 10px;
  287. #             font-size: medium;
  288. #             font-weight: bold;
  289. #             text-decoration: underline;
  290. #         }
  291. #         h1 {
  292. #             font-size: medium;
  293. #             font-weight: normal;
  294. #         }
  295. #         /* from http://users.tkk.fi/~tkarvine/linux/doc/pre-wrap/pre-wrap-css3-mozilla-opera-ie.html */
  296. #         /* Browser specific (not valid) styles to make preformatted text wrap */
  297. #         pre {
  298. #             white-space: pre-wrap;       /* css-3 */
  299. #             white-space: -moz-pre-wrap;  /* Mozilla, since 1999 */
  300. #             white-space: -pre-wrap;      /* Opera 4-6 */
  301. #             white-space: -o-pre-wrap;    /* Opera 7 */
  302. #             word-wrap: break-word;       /* Internet Explorer 5.5+ */
  303. #         }
  304. #     </style>
  305. # </head>
  306. # <body>
  307. #     <div class="box">
  308. #         <div class="error"></div>
  309. #         <div class="infos"><pre>
  310. # (en) Please come back later
  311. # (fr) SVP veuillez revenir plus tard
  312. # (de) Bitte versuchen sie es spaeter nocheinmal
  313. # (at) Konnten's bitt'schoen spaeter nochmal reinschauen
  314. # (no) Vennligst prov igjen senere
  315. # (dk) Venligst prov igen senere
  316. # (pl) Prosze sprobowac pozniej
  317. # (pt) Por favor volte mais tarde
  318. # (ru) Попробуйте еще раз позже
  319. # (ua) Спробуйте ще раз пізніше
  320. # </pre>
  321. # </div>
  322. #         <div class="name"></div>
  323. #     </div>
  324. # </body>
  325. # </html>
  326. #                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 '
  327. #     doesn't match '(?-xism:^>LE_HBa0001A15_T7_30 Chromat_file:Le-HBa001_A15-T7\.ab1 SGN_GSS_ID:30 \(vector and quality trimmed\))'
  328.  
  329. #   Failed test 'looks like the same FASTA'
  330. #   at t/025_sequence_api.t line 38.
  331. #                   '<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
  332. #     "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
  333. # <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
  334. # <head>
  335. #     <meta http-equiv="Content-Language" content="en" />
  336. #     <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
  337. #     <title>Mimosa</title>
  338. #     <script type="text/javascript">
  339. #         <!--
  340. #         function toggleDump (dumpElement) {
  341. #             var e = document.getElementById( dumpElement );
  342. #             if (e.style.display == "none") {
  343. #                 e.style.display = "";
  344. #             }
  345. #             else {
  346. #                 e.style.display = "none";
  347. #             }
  348. #         }
  349. #         -->
  350. #     </script>
  351. #     <style type="text/css">
  352. #         body {
  353. #             font-family: "Bitstream Vera Sans", "Trebuchet MS", Verdana,
  354. #                          Tahoma, Arial, helvetica, sans-serif;
  355. #             color: #333;
  356. #             background-color: #eee;
  357. #             margin: 0px;
  358. #             padding: 0px;
  359. #         }
  360. #         :link, :link:hover, :visited, :visited:hover {
  361. #             color: #000;
  362. #         }
  363. #         div.box {
  364. #             position: relative;
  365. #             background-color: #ccc;
  366. #             border: 1px solid #aaa;
  367. #             padding: 4px;
  368. #             margin: 10px;
  369. #         }
  370. #         div.error {
  371. #             background-color: #cce;
  372. #             border: 1px solid #755;
  373. #             padding: 8px;
  374. #             margin: 4px;
  375. #             margin-bottom: 10px;
  376. #         }
  377. #         div.infos {
  378. #             background-color: #eee;
  379. #             border: 1px solid #575;
  380. #             padding: 8px;
  381. #             margin: 4px;
  382. #             margin-bottom: 10px;
  383. #         }
  384. #         div.name {
  385. #             background-color: #cce;
  386. #             border: 1px solid #557;
  387. #             padding: 8px;
  388. #             margin: 4px;
  389. #         }
  390. #         code.error {
  391. #             display: block;
  392. #             margin: 1em 0;
  393. #             overflow: auto;
  394. #         }
  395. #         div.name h1, div.error p {
  396. #             margin: 0;
  397. #         }
  398. #         h2 {
  399. #             margin-top: 0;
  400. #             margin-bottom: 10px;
  401. #             font-size: medium;
  402. #             font-weight: bold;
  403. #             text-decoration: underline;
  404. #         }
  405. #         h1 {
  406. #             font-size: medium;
  407. #             font-weight: normal;
  408. #         }
  409. #         /* from http://users.tkk.fi/~tkarvine/linux/doc/pre-wrap/pre-wrap-css3-mozilla-opera-ie.html */
  410. #         /* Browser specific (not valid) styles to make preformatted text wrap */
  411. #         pre {
  412. #             white-space: pre-wrap;       /* css-3 */
  413. #             white-space: -moz-pre-wrap;  /* Mozilla, since 1999 */
  414. #             white-space: -pre-wrap;      /* Opera 4-6 */
  415. #             white-space: -o-pre-wrap;    /* Opera 7 */
  416. #             word-wrap: break-word;       /* Internet Explorer 5.5+ */
  417. #         }
  418. #     </style>
  419. # </head>
  420. # <body>
  421. #     <div class="box">
  422. #         <div class="error"></div>
  423. #         <div class="infos"><pre>
  424. # (en) Please come back later
  425. # (fr) SVP veuillez revenir plus tard
  426. # (de) Bitte versuchen sie es spaeter nocheinmal
  427. # (at) Konnten's bitt'schoen spaeter nochmal reinschauen
  428. # (no) Vennligst prov igjen senere
  429. # (dk) Venligst prov igen senere
  430. # (pl) Prosze sprobowac pozniej
  431. # (pt) Por favor volte mais tarde
  432. # (ru) Попробуйте еще раз позже
  433. # (ua) Спробуйте ще раз пізніше
  434. # </pre>
  435. # </div>
  436. #         <div class="name"></div>
  437. #     </div>
  438. # </body>
  439. # </html>
  440. #                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 '
  441. #     doesn't match '(?-xism:AATTATTTTATTTGGTTTATTGTAGTCCTTAAGACAGTTAGGATACCTGAGTTATGTATC)'
  442.  
  443. #   Failed test 'got non-zero content length'
  444. #   at t/025_sequence_api.t line 40.
  445. #          got: '3879'
  446. #     expected: '596'
  447. # <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
  448. #     "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
  449. # <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
  450. # <head>
  451. #     <meta http-equiv="Content-Language" content="en" />
  452. #     <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
  453. #     <title>Mimosa</title>
  454. #     <script type="text/javascript">
  455. #         <!--
  456. #         function toggleDump (dumpElement) {
  457. #             var e = document.getElementById( dumpElement );
  458. #             if (e.style.display == "none") {
  459. #                 e.style.display = "";
  460. #             }
  461. #             else {
  462. #                 e.style.display = "none";
  463. #             }
  464. #         }
  465. #         -->
  466. #     </script>
  467. #     <style type="text/css">
  468. #         body {
  469. #             font-family: "Bitstream Vera Sans", "Trebuchet MS", Verdana,
  470. #                          Tahoma, Arial, helvetica, sans-serif;
  471. #             color: #333;
  472. #             background-color: #eee;
  473. #             margin: 0px;
  474. #             padding: 0px;
  475. #         }
  476. #         :link, :link:hover, :visited, :visited:hover {
  477. #             color: #000;
  478. #         }
  479. #         div.box {
  480. #             position: relative;
  481. #             background-color: #ccc;
  482. #             border: 1px solid #aaa;
  483. #             padding: 4px;
  484. #             margin: 10px;
  485. #         }
  486. #         div.error {
  487. #             background-color: #cce;
  488. #             border: 1px solid #755;
  489. #             padding: 8px;
  490. #             margin: 4px;
  491. #             margin-bottom: 10px;
  492. #         }
  493. #         div.infos {
  494. #             background-color: #eee;
  495. #             border: 1px solid #575;
  496. #             padding: 8px;
  497. #             margin: 4px;
  498. #             margin-bottom: 10px;
  499. #         }
  500. #         div.name {
  501. #             background-color: #cce;
  502. #             border: 1px solid #557;
  503. #             padding: 8px;
  504. #             margin: 4px;
  505. #         }
  506. #         code.error {
  507. #             display: block;
  508. #             margin: 1em 0;
  509. #             overflow: auto;
  510. #         }
  511. #         div.name h1, div.error p {
  512. #             margin: 0;
  513. #         }
  514. #         h2 {
  515. #             margin-top: 0;
  516. #             margin-bottom: 10px;
  517. #             font-size: medium;
  518. #             font-weight: bold;
  519. #             text-decoration: underline;
  520. #         }
  521. #         h1 {
  522. #             font-size: medium;
  523. #             font-weight: normal;
  524. #         }
  525. #         /* from http://users.tkk.fi/~tkarvine/linux/doc/pre-wrap/pre-wrap-css3-mozilla-opera-ie.html */
  526. #         /* Browser specific (not valid) styles to make preformatted text wrap */
  527. #         pre {
  528. #             white-space: pre-wrap;       /* css-3 */
  529. #             white-space: -moz-pre-wrap;  /* Mozilla, since 1999 */
  530. #             white-space: -pre-wrap;      /* Opera 4-6 */
  531. #             white-space: -o-pre-wrap;    /* Opera 7 */
  532. #             word-wrap: break-word;       /* Internet Explorer 5.5+ */
  533. #         }
  534. #     </style>
  535. # </head>
  536. # <body>
  537. #     <div class="box">
  538. #         <div class="error"></div>
  539. #         <div class="infos"><pre>
  540. # (en) Please come back later
  541. # (fr) SVP veuillez revenir plus tard
  542. # (de) Bitte versuchen sie es spaeter nocheinmal
  543. # (at) Konnten's bitt'schoen spaeter nochmal reinschauen
  544. # (no) Vennligst prov igjen senere
  545. # (dk) Venligst prov igen senere
  546. # (pl) Prosze sprobowac pozniej
  547. # (pt) Por favor volte mais tarde
  548. # (ru) Попробуйте еще раз позже
  549. # (ua) Спробуйте ще раз пізніше
  550. # </pre>
  551. # </div>
  552. #         <div class="name"></div>
  553. #     </div>
  554. # </body>
  555. # </html>
  556. #                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
  557. [error] Caught exception in App::Mimosa::Controller::Sequence->sequence "Directory /home is not writable, cannot make dirs
  558.  at /home/rob/cxgn/mimosa/lib/App/Mimosa/Database.pm line 37"
  559.  
  560. #   Failed test '200 GET /api/sequence/1/LE_HBa0001A15_T7_30.fasta'
  561. #   at t/025_sequence_api.t line 35.
  562. #          got: '500'
  563. #     expected: '200'
  564.  
  565. #   Failed test 'got the correct desc line back'
  566. #   at t/025_sequence_api.t line 37.
  567. #                   '<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
  568. #     "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
  569. # <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
  570. # <head>
  571. #     <meta http-equiv="Content-Language" content="en" />
  572. #     <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
  573. #     <title>Mimosa</title>
  574. #     <script type="text/javascript">
  575. #         <!--
  576. #         function toggleDump (dumpElement) {
  577. #             var e = document.getElementById( dumpElement );
  578. #             if (e.style.display == "none") {
  579. #                 e.style.display = "";
  580. #             }
  581. #             else {
  582. #                 e.style.display = "none";
  583. #             }
  584. #         }
  585. #         -->
  586. #     </script>
  587. #     <style type="text/css">
  588. #         body {
  589. #             font-family: "Bitstream Vera Sans", "Trebuchet MS", Verdana,
  590. #                          Tahoma, Arial, helvetica, sans-serif;
  591. #             color: #333;
  592. #             background-color: #eee;
  593. #             margin: 0px;
  594. #             padding: 0px;
  595. #         }
  596. #         :link, :link:hover, :visited, :visited:hover {
  597. #             color: #000;
  598. #         }
  599. #         div.box {
  600. #             position: relative;
  601. #             background-color: #ccc;
  602. #             border: 1px solid #aaa;
  603. #             padding: 4px;
  604. #             margin: 10px;
  605. #         }
  606. #         div.error {
  607. #             background-color: #cce;
  608. #             border: 1px solid #755;
  609. #             padding: 8px;
  610. #             margin: 4px;
  611. #             margin-bottom: 10px;
  612. #         }
  613. #         div.infos {
  614. #             background-color: #eee;
  615. #             border: 1px solid #575;
  616. #             padding: 8px;
  617. #             margin: 4px;
  618. #             margin-bottom: 10px;
  619. #         }
  620. #         div.name {
  621. #             background-color: #cce;
  622. #             border: 1px solid #557;
  623. #             padding: 8px;
  624. #             margin: 4px;
  625. #         }
  626. #         code.error {
  627. #             display: block;
  628. #             margin: 1em 0;
  629. #             overflow: auto;
  630. #         }
  631. #         div.name h1, div.error p {
  632. #             margin: 0;
  633. #         }
  634. #         h2 {
  635. #             margin-top: 0;
  636. #             margin-bottom: 10px;
  637. #             font-size: medium;
  638. #             font-weight: bold;
  639. #             text-decoration: underline;
  640. #         }
  641. #         h1 {
  642. #             font-size: medium;
  643. #             font-weight: normal;
  644. #         }
  645. #         /* from http://users.tkk.fi/~tkarvine/linux/doc/pre-wrap/pre-wrap-css3-mozilla-opera-ie.html */
  646. #         /* Browser specific (not valid) styles to make preformatted text wrap */
  647. #         pre {
  648. #             white-space: pre-wrap;       /* css-3 */
  649. #             white-space: -moz-pre-wrap;  /* Mozilla, since 1999 */
  650. #             white-space: -pre-wrap;      /* Opera 4-6 */
  651. #             white-space: -o-pre-wrap;    /* Opera 7 */
  652. #             word-wrap: break-word;       /* Internet Explorer 5.5+ */
  653. #         }
  654. #     </style>
  655. # </head>
  656. # <body>
  657. #     <div class="box">
  658. #         <div class="error"></div>
  659. #         <div class="infos"><pre>
  660. # (en) Please come back later
  661. # (fr) SVP veuillez revenir plus tard
  662. # (de) Bitte versuchen sie es spaeter nocheinmal
  663. # (at) Konnten's bitt'schoen spaeter nochmal reinschauen
  664. # (no) Vennligst prov igjen senere
  665. # (dk) Venligst prov igen senere
  666. # (pl) Prosze sprobowac pozniej
  667. # (pt) Por favor volte mais tarde
  668. # (ru) Попробуйте еще раз позже
  669. # (ua) Спробуйте ще раз пізніше
  670. # </pre>
  671. # </div>
  672. #         <div class="name"></div>
  673. #     </div>
  674. # </body>
  675. # </html>
  676. #                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 '
  677. #     doesn't match '(?-xism:^>LE_HBa0001A15_T7_30 Chromat_file:Le-HBa001_A15-T7\.ab1 SGN_GSS_ID:30 \(vector and quality trimmed\))'
  678.  
  679. #   Failed test 'looks like the same FASTA'
  680. #   at t/025_sequence_api.t line 38.
  681. #                   '<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
  682. #     "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
  683. # <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
  684. # <head>
  685. #     <meta http-equiv="Content-Language" content="en" />
  686. #     <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
  687. #     <title>Mimosa</title>
  688. #     <script type="text/javascript">
  689. #         <!--
  690. #         function toggleDump (dumpElement) {
  691. #             var e = document.getElementById( dumpElement );
  692. #             if (e.style.display == "none") {
  693. #                 e.style.display = "";
  694. #             }
  695. #             else {
  696. #                 e.style.display = "none";
  697. #             }
  698. #         }
  699. #         -->
  700. #     </script>
  701. #     <style type="text/css">
  702. #         body {
  703. #             font-family: "Bitstream Vera Sans", "Trebuchet MS", Verdana,
  704. #                          Tahoma, Arial, helvetica, sans-serif;
  705. #             color: #333;
  706. #             background-color: #eee;
  707. #             margin: 0px;
  708. #             padding: 0px;
  709. #         }
  710. #         :link, :link:hover, :visited, :visited:hover {
  711. #             color: #000;
  712. #         }
  713. #         div.box {
  714. #             position: relative;
  715. #             background-color: #ccc;
  716. #             border: 1px solid #aaa;
  717. #             padding: 4px;
  718. #             margin: 10px;
  719. #         }
  720. #         div.error {
  721. #             background-color: #cce;
  722. #             border: 1px solid #755;
  723. #             padding: 8px;
  724. #             margin: 4px;
  725. #             margin-bottom: 10px;
  726. #         }
  727. #         div.infos {
  728. #             background-color: #eee;
  729. #             border: 1px solid #575;
  730. #             padding: 8px;
  731. #             margin: 4px;
  732. #             margin-bottom: 10px;
  733. #         }
  734. #         div.name {
  735. #             background-color: #cce;
  736. #             border: 1px solid #557;
  737. #             padding: 8px;
  738. #             margin: 4px;
  739. #         }
  740. #         code.error {
  741. #             display: block;
  742. #             margin: 1em 0;
  743. #             overflow: auto;
  744. #         }
  745. #         div.name h1, div.error p {
  746. #             margin: 0;
  747. #         }
  748. #         h2 {
  749. #             margin-top: 0;
  750. #             margin-bottom: 10px;
  751. #             font-size: medium;
  752. #             font-weight: bold;
  753. #             text-decoration: underline;
  754. #         }
  755. #         h1 {
  756. #             font-size: medium;
  757. #             font-weight: normal;
  758. #         }
  759. #         /* from http://users.tkk.fi/~tkarvine/linux/doc/pre-wrap/pre-wrap-css3-mozilla-opera-ie.html */
  760. #         /* Browser specific (not valid) styles to make preformatted text wrap */
  761. #         pre {
  762. #             white-space: pre-wrap;       /* css-3 */
  763. #             white-space: -moz-pre-wrap;  /* Mozilla, since 1999 */
  764. #             white-space: -pre-wrap;      /* Opera 4-6 */
  765. #             white-space: -o-pre-wrap;    /* Opera 7 */
  766. #             word-wrap: break-word;       /* Internet Explorer 5.5+ */
  767. #         }
  768. #     </style>
  769. # </head>
  770. # <body>
  771. #     <div class="box">
  772. #         <div class="error"></div>
  773. #         <div class="infos"><pre>
  774. # (en) Please come back later
  775. # (fr) SVP veuillez revenir plus tard
  776. # (de) Bitte versuchen sie es spaeter nocheinmal
  777. # (at) Konnten's bitt'schoen spaeter nochmal reinschauen
  778. # (no) Vennligst prov igjen senere
  779. # (dk) Venligst prov igen senere
  780. # (pl) Prosze sprobowac pozniej
  781. # (pt) Por favor volte mais tarde
  782. # (ru) Попробуйте еще раз позже
  783. # (ua) Спробуйте ще раз пізніше
  784. # </pre>
  785. # </div>
  786. #         <div class="name"></div>
  787. #     </div>
  788. # </body>
  789. # </html>
  790. #                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 '
  791. #     doesn't match '(?-xism:AATTATTTTATTTGGTTTATTGTAGTCCTTAAGACAGTTAGGATACCTGAGTTATGTATC)'
  792.  
  793. #   Failed test 'got non-zero content length'
  794. #   at t/025_sequence_api.t line 40.
  795. #          got: '3879'
  796. #     expected: '596'
  797. # <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
  798. #     "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
  799. # <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
  800. # <head>
  801. #     <meta http-equiv="Content-Language" content="en" />
  802. #     <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
  803. #     <title>Mimosa</title>
  804. #     <script type="text/javascript">
  805. #         <!--
  806. #         function toggleDump (dumpElement) {
  807. #             var e = document.getElementById( dumpElement );
  808. #             if (e.style.display == "none") {
  809. #                 e.style.display = "";
  810. #             }
  811. #             else {
  812. #                 e.style.display = "none";
  813. #             }
  814. #         }
  815. #         -->
  816. #     </script>
  817. #     <style type="text/css">
  818. #         body {
  819. #             font-family: "Bitstream Vera Sans", "Trebuchet MS", Verdana,
  820. #                          Tahoma, Arial, helvetica, sans-serif;
  821. #             color: #333;
  822. #             background-color: #eee;
  823. #             margin: 0px;
  824. #             padding: 0px;
  825. #         }
  826. #         :link, :link:hover, :visited, :visited:hover {
  827. #             color: #000;
  828. #         }
  829. #         div.box {
  830. #             position: relative;
  831. #             background-color: #ccc;
  832. #             border: 1px solid #aaa;
  833. #             padding: 4px;
  834. #             margin: 10px;
  835. #         }
  836. #         div.error {
  837. #             background-color: #cce;
  838. #             border: 1px solid #755;
  839. #             padding: 8px;
  840. #             margin: 4px;
  841. #             margin-bottom: 10px;
  842. #         }
  843. #         div.infos {
  844. #             background-color: #eee;
  845. #             border: 1px solid #575;
  846. #             padding: 8px;
  847. #             margin: 4px;
  848. #             margin-bottom: 10px;
  849. #         }
  850. #         div.name {
  851. #             background-color: #cce;
  852. #             border: 1px solid #557;
  853. #             padding: 8px;
  854. #             margin: 4px;
  855. #         }
  856. #         code.error {
  857. #             display: block;
  858. #             margin: 1em 0;
  859. #             overflow: auto;
  860. #         }
  861. #         div.name h1, div.error p {
  862. #             margin: 0;
  863. #         }
  864. #         h2 {
  865. #             margin-top: 0;
  866. #             margin-bottom: 10px;
  867. #             font-size: medium;
  868. #             font-weight: bold;
  869. #             text-decoration: underline;
  870. #         }
  871. #         h1 {
  872. #             font-size: medium;
  873. #             font-weight: normal;
  874. #         }
  875. #         /* from http://users.tkk.fi/~tkarvine/linux/doc/pre-wrap/pre-wrap-css3-mozilla-opera-ie.html */
  876. #         /* Browser specific (not valid) styles to make preformatted text wrap */
  877. #         pre {
  878. #             white-space: pre-wrap;       /* css-3 */
  879. #             white-space: -moz-pre-wrap;  /* Mozilla, since 1999 */
  880. #             white-space: -pre-wrap;      /* Opera 4-6 */
  881. #             white-space: -o-pre-wrap;    /* Opera 7 */
  882. #             word-wrap: break-word;       /* Internet Explorer 5.5+ */
  883. #         }
  884. #     </style>
  885. # </head>
  886. # <body>
  887. #     <div class="box">
  888. #         <div class="error"></div>
  889. #         <div class="infos"><pre>
  890. # (en) Please come back later
  891. # (fr) SVP veuillez revenir plus tard
  892. # (de) Bitte versuchen sie es spaeter nocheinmal
  893. # (at) Konnten's bitt'schoen spaeter nochmal reinschauen
  894. # (no) Vennligst prov igjen senere
  895. # (dk) Venligst prov igen senere
  896. # (pl) Prosze sprobowac pozniej
  897. # (pt) Por favor volte mais tarde
  898. # (ru) Попробуйте еще раз позже
  899. # (ua) Спробуйте ще раз пізніше
  900. # </pre>
  901. # </div>
  902. #         <div class="name"></div>
  903. #     </div>
  904. # </body>
  905. # </html>
  906. #                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
  907. [error] Caught exception in App::Mimosa::Controller::Sequence->sequence "Directory /home is not writable, cannot make dirs
  908.  at /home/rob/cxgn/mimosa/lib/App/Mimosa/Database.pm line 37"
  909.  
  910. #   Failed test '200 GET /api/sequence/1/LE_HBa0001A15_T7_30'
  911. #   at t/025_sequence_api.t line 35.
  912. #          got: '500'
  913. #     expected: '200'
  914.  
  915. #   Failed test 'got the correct desc line back'
  916. #   at t/025_sequence_api.t line 37.
  917. #                   '<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
  918. #     "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
  919. # <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
  920. # <head>
  921. #     <meta http-equiv="Content-Language" content="en" />
  922. #     <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
  923. #     <title>Mimosa</title>
  924. #     <script type="text/javascript">
  925. #         <!--
  926. #         function toggleDump (dumpElement) {
  927. #             var e = document.getElementById( dumpElement );
  928. #             if (e.style.display == "none") {
  929. #                 e.style.display = "";
  930. #             }
  931. #             else {
  932. #                 e.style.display = "none";
  933. #             }
  934. #         }
  935. #         -->
  936. #     </script>
  937. #     <style type="text/css">
  938. #         body {
  939. #             font-family: "Bitstream Vera Sans", "Trebuchet MS", Verdana,
  940. #                          Tahoma, Arial, helvetica, sans-serif;
  941. #             color: #333;
  942. #             background-color: #eee;
  943. #             margin: 0px;
  944. #             padding: 0px;
  945. #         }
  946. #         :link, :link:hover, :visited, :visited:hover {
  947. #             color: #000;
  948. #         }
  949. #         div.box {
  950. #             position: relative;
  951. #             background-color: #ccc;
  952. #             border: 1px solid #aaa;
  953. #             padding: 4px;
  954. #             margin: 10px;
  955. #         }
  956. #         div.error {
  957. #             background-color: #cce;
  958. #             border: 1px solid #755;
  959. #             padding: 8px;
  960. #             margin: 4px;
  961. #             margin-bottom: 10px;
  962. #         }
  963. #         div.infos {
  964. #             background-color: #eee;
  965. #             border: 1px solid #575;
  966. #             padding: 8px;
  967. #             margin: 4px;
  968. #             margin-bottom: 10px;
  969. #         }
  970. #         div.name {
  971. #             background-color: #cce;
  972. #             border: 1px solid #557;
  973. #             padding: 8px;
  974. #             margin: 4px;
  975. #         }
  976. #         code.error {
  977. #             display: block;
  978. #             margin: 1em 0;
  979. #             overflow: auto;
  980. #         }
  981. #         div.name h1, div.error p {
  982. #             margin: 0;
  983. #         }
  984. #         h2 {
  985. #             margin-top: 0;
  986. #             margin-bottom: 10px;
  987. #             font-size: medium;
  988. #             font-weight: bold;
  989. #             text-decoration: underline;
  990. #         }
  991. #         h1 {
  992. #             font-size: medium;
  993. #             font-weight: normal;
  994. #         }
  995. #         /* from http://users.tkk.fi/~tkarvine/linux/doc/pre-wrap/pre-wrap-css3-mozilla-opera-ie.html */
  996. #         /* Browser specific (not valid) styles to make preformatted text wrap */
  997. #         pre {
  998. #             white-space: pre-wrap;       /* css-3 */
  999. #             white-space: -moz-pre-wrap;  /* Mozilla, since 1999 */
  1000. #             white-space: -pre-wrap;      /* Opera 4-6 */
  1001. #             white-space: -o-pre-wrap;    /* Opera 7 */
  1002. #             word-wrap: break-word;       /* Internet Explorer 5.5+ */
  1003. #         }
  1004. #     </style>
  1005. # </head>
  1006. # <body>
  1007. #     <div class="box">
  1008. #         <div class="error"></div>
  1009. #         <div class="infos"><pre>
  1010. # (en) Please come back later
  1011. # (fr) SVP veuillez revenir plus tard
  1012. # (de) Bitte versuchen sie es spaeter nocheinmal
  1013. # (at) Konnten's bitt'schoen spaeter nochmal reinschauen
  1014. # (no) Vennligst prov igjen senere
  1015. # (dk) Venligst prov igen senere
  1016. # (pl) Prosze sprobowac pozniej
  1017. # (pt) Por favor volte mais tarde
  1018. # (ru) Попробуйте еще раз позже
  1019. # (ua) Спробуйте ще раз пізніше
  1020. # </pre>
  1021. # </div>
  1022. #         <div class="name"></div>
  1023. #     </div>
  1024. # </body>
  1025. # </html>
  1026. #                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 '
  1027. #     doesn't match '(?-xism:^>LE_HBa0001A15_T7_30 Chromat_file:Le-HBa001_A15-T7\.ab1 SGN_GSS_ID:30 \(vector and quality trimmed\))'
  1028.  
  1029. #   Failed test 'looks like the same FASTA'
  1030. #   at t/025_sequence_api.t line 38.
  1031. #                   '<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
  1032. #     "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
  1033. # <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
  1034. # <head>
  1035. #     <meta http-equiv="Content-Language" content="en" />
  1036. #     <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
  1037. #     <title>Mimosa</title>
  1038. #     <script type="text/javascript">
  1039. #         <!--
  1040. #         function toggleDump (dumpElement) {
  1041. #             var e = document.getElementById( dumpElement );
  1042. #             if (e.style.display == "none") {
  1043. #                 e.style.display = "";
  1044. #             }
  1045. #             else {
  1046. #                 e.style.display = "none";
  1047. #             }
  1048. #         }
  1049. #         -->
  1050. #     </script>
  1051. #     <style type="text/css">
  1052. #         body {
  1053. #             font-family: "Bitstream Vera Sans", "Trebuchet MS", Verdana,
  1054. #                          Tahoma, Arial, helvetica, sans-serif;
  1055. #             color: #333;
  1056. #             background-color: #eee;
  1057. #             margin: 0px;
  1058. #             padding: 0px;
  1059. #         }
  1060. #         :link, :link:hover, :visited, :visited:hover {
  1061. #             color: #000;
  1062. #         }
  1063. #         div.box {
  1064. #             position: relative;
  1065. #             background-color: #ccc;
  1066. #             border: 1px solid #aaa;
  1067. #             padding: 4px;
  1068. #             margin: 10px;
  1069. #         }
  1070. #         div.error {
  1071. #             background-color: #cce;
  1072. #             border: 1px solid #755;
  1073. #             padding: 8px;
  1074. #             margin: 4px;
  1075. #             margin-bottom: 10px;
  1076. #         }
  1077. #         div.infos {
  1078. #             background-color: #eee;
  1079. #             border: 1px solid #575;
  1080. #             padding: 8px;
  1081. #             margin: 4px;
  1082. #             margin-bottom: 10px;
  1083. #         }
  1084. #         div.name {
  1085. #             background-color: #cce;
  1086. #             border: 1px solid #557;
  1087. #             padding: 8px;
  1088. #             margin: 4px;
  1089. #         }
  1090. #         code.error {
  1091. #             display: block;
  1092. #             margin: 1em 0;
  1093. #             overflow: auto;
  1094. #         }
  1095. #         div.name h1, div.error p {
  1096. #             margin: 0;
  1097. #         }
  1098. #         h2 {
  1099. #             margin-top: 0;
  1100. #             margin-bottom: 10px;
  1101. #             font-size: medium;
  1102. #             font-weight: bold;
  1103. #             text-decoration: underline;
  1104. #         }
  1105. #         h1 {
  1106. #             font-size: medium;
  1107. #             font-weight: normal;
  1108. #         }
  1109. #         /* from http://users.tkk.fi/~tkarvine/linux/doc/pre-wrap/pre-wrap-css3-mozilla-opera-ie.html */
  1110. #         /* Browser specific (not valid) styles to make preformatted text wrap */
  1111. #         pre {
  1112. #             white-space: pre-wrap;       /* css-3 */
  1113. #             white-space: -moz-pre-wrap;  /* Mozilla, since 1999 */
  1114. #             white-space: -pre-wrap;      /* Opera 4-6 */
  1115. #             white-space: -o-pre-wrap;    /* Opera 7 */
  1116. #             word-wrap: break-word;       /* Internet Explorer 5.5+ */
  1117. #         }
  1118. #     </style>
  1119. # </head>
  1120. # <body>
  1121. #     <div class="box">
  1122. #         <div class="error"></div>
  1123. #         <div class="infos"><pre>
  1124. # (en) Please come back later
  1125. # (fr) SVP veuillez revenir plus tard
  1126. # (de) Bitte versuchen sie es spaeter nocheinmal
  1127. # (at) Konnten's bitt'schoen spaeter nochmal reinschauen
  1128. # (no) Vennligst prov igjen senere
  1129. # (dk) Venligst prov igen senere
  1130. # (pl) Prosze sprobowac pozniej
  1131. # (pt) Por favor volte mais tarde
  1132. # (ru) Попробуйте еще раз позже
  1133. # (ua) Спробуйте ще раз пізніше
  1134. # </pre>
  1135. # </div>
  1136. #         <div class="name"></div>
  1137. #     </div>
  1138. # </body>
  1139. # </html>
  1140. #                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 '
  1141. #     doesn't match '(?-xism:AATTATTTTATTTGGTTTATTGTAGTCCTTAAGACAGTTAGGATACCTGAGTTATGTATC)'
  1142.  
  1143. #   Failed test 'got non-zero content length'
  1144. #   at t/025_sequence_api.t line 40.
  1145. #          got: '3879'
  1146. #     expected: '596'
  1147. # <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
  1148. #     "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
  1149. # <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
  1150. # <head>
  1151. #     <meta http-equiv="Content-Language" content="en" />
  1152. #     <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
  1153. #     <title>Mimosa</title>
  1154. #     <script type="text/javascript">
  1155. #         <!--
  1156. #         function toggleDump (dumpElement) {
  1157. #             var e = document.getElementById( dumpElement );
  1158. #             if (e.style.display == "none") {
  1159. #                 e.style.display = "";
  1160. #             }
  1161. #             else {
  1162. #                 e.style.display = "none";
  1163. #             }
  1164. #         }
  1165. #         -->
  1166. #     </script>
  1167. #     <style type="text/css">
  1168. #         body {
  1169. #             font-family: "Bitstream Vera Sans", "Trebuchet MS", Verdana,
  1170. #                          Tahoma, Arial, helvetica, sans-serif;
  1171. #             color: #333;
  1172. #             background-color: #eee;
  1173. #             margin: 0px;
  1174. #             padding: 0px;
  1175. #         }
  1176. #         :link, :link:hover, :visited, :visited:hover {
  1177. #             color: #000;
  1178. #         }
  1179. #         div.box {
  1180. #             position: relative;
  1181. #             background-color: #ccc;
  1182. #             border: 1px solid #aaa;
  1183. #             padding: 4px;
  1184. #             margin: 10px;
  1185. #         }
  1186. #         div.error {
  1187. #             background-color: #cce;
  1188. #             border: 1px solid #755;
  1189. #             padding: 8px;
  1190. #             margin: 4px;
  1191. #             margin-bottom: 10px;
  1192. #         }
  1193. #         div.infos {
  1194. #             background-color: #eee;
  1195. #             border: 1px solid #575;
  1196. #             padding: 8px;
  1197. #             margin: 4px;
  1198. #             margin-bottom: 10px;
  1199. #         }
  1200. #         div.name {
  1201. #             background-color: #cce;
  1202. #             border: 1px solid #557;
  1203. #             padding: 8px;
  1204. #             margin: 4px;
  1205. #         }
  1206. #         code.error {
  1207. #             display: block;
  1208. #             margin: 1em 0;
  1209. #             overflow: auto;
  1210. #         }
  1211. #         div.name h1, div.error p {
  1212. #             margin: 0;
  1213. #         }
  1214. #         h2 {
  1215. #             margin-top: 0;
  1216. #             margin-bottom: 10px;
  1217. #             font-size: medium;
  1218. #             font-weight: bold;
  1219. #             text-decoration: underline;
  1220. #         }
  1221. #         h1 {
  1222. #             font-size: medium;
  1223. #             font-weight: normal;
  1224. #         }
  1225. #         /* from http://users.tkk.fi/~tkarvine/linux/doc/pre-wrap/pre-wrap-css3-mozilla-opera-ie.html */
  1226. #         /* Browser specific (not valid) styles to make preformatted text wrap */
  1227. #         pre {
  1228. #             white-space: pre-wrap;       /* css-3 */
  1229. #             white-space: -moz-pre-wrap;  /* Mozilla, since 1999 */
  1230. #             white-space: -pre-wrap;      /* Opera 4-6 */
  1231. #             white-space: -o-pre-wrap;    /* Opera 7 */
  1232. #             word-wrap: break-word;       /* Internet Explorer 5.5+ */
  1233. #         }
  1234. #     </style>
  1235. # </head>
  1236. # <body>
  1237. #     <div class="box">
  1238. #         <div class="error"></div>
  1239. #         <div class="infos"><pre>
  1240. # (en) Please come back later
  1241. # (fr) SVP veuillez revenir plus tard
  1242. # (de) Bitte versuchen sie es spaeter nocheinmal
  1243. # (at) Konnten's bitt'schoen spaeter nochmal reinschauen
  1244. # (no) Vennligst prov igjen senere
  1245. # (dk) Venligst prov igen senere
  1246. # (pl) Prosze sprobowac pozniej
  1247. # (pt) Por favor volte mais tarde
  1248. # (ru) Попробуйте еще раз позже
  1249. # (ua) Спробуйте ще раз пізніше
  1250. # </pre>
  1251. # </div>
  1252. #         <div class="name"></div>
  1253. #     </div>
  1254. # </body>
  1255. # </html>
  1256. #                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
  1257. # Looks like you failed 12 tests of 17.
  1258. t/025_sequence_api.t ...................
  1259. Dubious, test returned 12 (wstat 3072, 0xc00)
  1260. Failed 12/17 subtests
  1261. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  1262. t/030_download_html_report.t ........... ok
  1263. t/099_pod.t ............................ skipped: set TEST_POD to enable this test
  1264. t/100_podcoverage.t .................... skipped: set TEST_POD to enable this test
  1265. Name "SQL::Translator::Schema::DEBUG" used only once: possible typo at /home/rob/cpan-lib/lib/perl5/Class/Base.pm line 54.
  1266. already present:
  1267.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nhr
  1268.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nin
  1269.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsd
  1270.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsi
  1271.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsq
  1272.  
  1273. --------------------- WARNING ---------------------
  1274. MSG: sequence '1' doesn't validate, mismatch is <,",",!</
  1275. ---------------------------------------------------
  1276. already present:
  1277.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nhr
  1278.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nin
  1279.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsd
  1280.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsi
  1281.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsq
  1282. already present:
  1283.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nhr
  1284.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nin
  1285.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsd
  1286.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsi
  1287.  - /home/rob/cxgn/mimosa/t/data/blastdb_test.nucleotide.nsq
  1288. [error] Caught exception in App::Mimosa::Controller::Sequence->sequence "Directory /home is not writable, cannot make dirs
  1289.  at /home/rob/cxgn/mimosa/lib/App/Mimosa/Database.pm line 37"
  1290.  
  1291. #   Failed test 'All /api links work'
  1292. #   at t/integration/blast.t line 112.
  1293. # /api/sequence/1/LE_HBa0001A17_SP6_33.fasta
  1294. [error] Caught exception in App::Mimosa::Controller::Sequence->sequence "Directory /home is not writable, cannot make dirs
  1295.  at /home/rob/cxgn/mimosa/lib/App/Mimosa/Database.pm line 37"
  1296.  
  1297. #   Failed test 'All /api links work'
  1298. #   at t/integration/blast.t line 112.
  1299. # /api/sequence/1/LE_HBa0001A17_SP6_33.fasta
  1300. # Looks like you failed 2 tests of 28.
  1301. t/integration/blast.t ..................
  1302. Dubious, test returned 2 (wstat 512, 0x200)
  1303. Failed 2/28 subtests
  1304.  
  1305. Test Summary Report
  1306. -------------------
  1307. t/025_sequence_api.t                 (Wstat: 3072 Tests: 17 Failed: 12)
  1308.   Failed tests:  2, 4-7, 9-12, 14-16
  1309.   Non-zero exit status: 12
  1310. t/integration/blast.t                (Wstat: 512 Tests: 28 Failed: 2)
  1311.   Failed tests:  21, 27
  1312.   Non-zero exit status: 2
  1313. Files=24, Tests=157, 61 wallclock secs ( 0.08 usr  0.05 sys + 53.41 cusr  3.76 csys = 57.30 CPU)
  1314. Result: FAIL
create a new version of this paste RAW Paste Data