Advertisement
Not a member of Pastebin yet?
Sign Up,
it unlocks many cool features!
- Why do I get this error - "Nucleotide BLAST database './nt' does not exist in the NCBI servers" - when running the code below? The stack trace is pasted below the code. Thank you.
- #!/usr/bin/perl -w
- use strict;
- use Bio::Tools::Run::StandAloneBlastPlus;
- use Bio::Seq;
- my $fac = Bio::Tools::Run::StandAloneBlastPlus->new(-db_name => 'nt', -remote => 1);
- my $seq_obj = Bio::Seq->new(-id =>"test query", -seq =>"TTTAAATATATTTTGAAGTATAGATTATATGTT");
- my $result = $fac->blastn(-query => $seq_obj);
- ------------- EXCEPTION: Bio::Root::Exception -------------
- MSG: /usr/local/blast+/bin/blastn call crashed: There was a problem running /usr
- /local/blast+/bin/blastn : BLAST Database error: Nucleotide BLAST database './nt
- ' does not exist in the NCBI servers
- STACK: Error::throw
- STACK: Bio::Root::Root::throw /home/lupey/downloads/bioperl/bioperl-live/Bio/Roo
- t/Root.pm:472
- STACK: Bio::Tools::Run::WrapperBase::_run /home/lupey/downloads/bioperl/bioperl-
- live/Bio/Tools/Run/WrapperBase/CommandExts.pm:1012
- STACK: Bio::Tools::Run::StandAloneBlastPlus::AUTOLOAD /home/lupey/downloads/biop
- erl/bioperl-run/lib/Bio/Tools/Run/StandAloneBlastPlus.pm:1303
- STACK: Bio::Tools::Run::StandAloneBlastPlus::run /home/lupey/downloads/bioperl/b
- ioperl-run/lib/Bio/Tools/Run/StandAloneBlastPlus/BlastMethods.pm:264
- STACK: Bio::Tools::Run::StandAloneBlastPlus::AUTOLOAD /home/lupey/downloads/biop
- erl/bioperl-run/lib/Bio/Tools/Run/StandAloneBlastPlus.pm:1301
- STACK: ./myblastplus.pl:10
- -----------------------------------------------------------
Advertisement
Add Comment
Please, Sign In to add comment
Advertisement